Gene editing vector of agrobacterium tumefaciens, gene editing method of gene editing vector and agrobacterium tumefaciens editing strain

Abstract

The invention relates to a gene editing vector of agrobacterium, a gene editing method of the gene editing vector and an agrobacterium editing strain. The agrobacterium gene editing vector comprises the following gene elements: a plasmid skeleton, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, gRNA, and an upstream homologous arm and a downstream homologous arm of a target gene. According to the agrobacterium gene editing vector, a CRISPR / spCas9-GFP gene editing system is adopted, an efficient, simple, convenient and traceless genome editing system is constructed in agrobacterium, and gene knockout and insertion can be achieved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a gene editing vector of Agrobacterium, a gene editing method thereof, and an Agrobacterium editing strain. Background Art

[0002] Agrobacterium tumefaciens is a Gram-negative α-proteobacterium. It is a powerful system for transferring target genes into plant cells and is a model bacterium for studying bacterial cell biology, host-microbe associations, and biofilm formation. However, traditional Agrobacterium genome editing technology has disadvantages such as low editing efficiency, cumbersome operation steps, and difficulty in removing selection markers, which has seriously hindered the research and application of Agrobacterium.

[0003] In 2014, Shengbiao Hu et al. established a gene editing method in Agrobacterium through the λ-Red homologous recombination system, and used the karanomycin resistance gene as a screening tag to successfully knock out related genes in the Agrobacterium genome. In 2021, Savio D. Rodrigues et al. based on CRISPR / Cas9-mediated single-base editing, they were able to effectively edit the target base in Agrobacterium, and the editing efficiency reached more than 80%. In 2022, Epharaim Aliu et al. achieved gene insertion in the Agrobacterium genome through the CRISPR RNA-mediated transposase system, and through the Cre-loxP recombination system, they were able to accurately delete large fragments.

[0004] Gene editing based on the λ-Red homologous recombination system requires the insertion of a karamycin resistance gene in order to screen the knockout strain while knocking out a gene. Therefore, this method cannot obtain edited strains without screening markers. Single-base editing mediated by CRISPR / Cas9 cannot achieve the knockout and knock-in of the entire gene in the Agrobacterium genome. Although the CRISPR RNA-mediated transposase system combined with the Cre-loxP recombination system can achieve gene insertion and deletion, both the genome integration caused by the transposase system and the deletion of large DNA fragments caused by the Cre-loxP recombination system will introduce exogenous DNA markers into the genome, and seamless editing cannot be achieved. In addition, the deletion of large DNA fragments through the Cre-loxP recombination system is time-consuming and labor-intensive, which is not conducive to the study of Agrobacterium. Summary of the invention

[0005] Based on this, the present application provides an Agrobacterium gene editing vector, which can achieve efficient editing of Agrobacterium genes.

[0006] An Agrobacterium gene editing vector comprises the following gene elements: a plasmid skeleton, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, an upstream homology arm and a downstream homology arm of a target gene.

[0007] The above-mentioned Agrobacterium gene editing vector adopts the CRISPR / spCas9-GFP gene editing system to construct an efficient, simple and scarless genome editing system in Agrobacterium, which can achieve gene knockout and insertion.

[0008] In some embodiments, the target gene includes the tdk gene.

[0009] In some of these embodiments, the gRNA includes at least one of the sequences shown as SEQ ID NO.29, SEQ ID NO.32 and SEQ ID NO.35.

[0010] In some of the embodiments, a repetitive sequence is connected between two adjacent gene elements in the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homologous arm of the target gene, and the downstream homologous arm of the target gene.

[0011] In some embodiments, the plasmid backbone is a pSJ-backbone plasmid backbone, and the nucleotide sequence of the pSJ-backbone plasmid backbone is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the Pvan promoter is shown in SEQ ID NO.4;

[0013] The nucleotide sequence of the spCas9 gene fragment is shown in SEQ ID NO.7.

[0014] A gene editing method of Agrobacterium, comprising the following steps:

[0015] Constructing the Agrobacterium gene editing vector as described above;

[0016] The Agrobacterium gene editing vector is transformed into Agrobacterium competent cells, cultured, and screened to obtain the gene-edited Agrobacterium editing strain.

[0017] In some of the embodiments, the step of constructing the Agrobacterium gene editing vector includes: assembling each of the gene elements by Gibson technology to obtain the Agrobacterium gene editing vector.

[0018] In some embodiments, the steps of transforming the Agrobacterium gene editing vector into Agrobacterium competent cells, culturing, and screening include:

[0019] The Agrobacterium gene editing vector is transformed into the Agrobacterium competent cells, and cultured on a resistant plate medium, and then the monoclonal colonies are observed under a blue light to see whether they emit green fluorescence;

[0020] The monoclonal colony that emits green fluorescence under blue light is verified to obtain the Agrobacterium editing strain.

[0021] In some of the embodiments, after the step of verifying the monoclonal colonies that emit green fluorescence under a blue light, the following step is also included: transferring the verified qualified Agrobacterium editing strain to an antibiotic-free culture medium for cultivation, and then performing PCR identification to obtain the Agrobacterium editing strain that does not carry the gene editing vector.

[0022] An Agrobacterium editing strain is prepared by the above gene editing method. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is the plasmid map of pSJ-P23119-gRNA-HRs-Pvan-spCas9-GFP in Example 1;

[0024] Figure 2 This is the result of PCR detection of tdk gene knockout;

[0025] Figure 3 This is a bar graph of the knockout efficiency of three different gRNAs of the tdk gene in Example 1;

[0026] Figure 4 This is a diagram showing the phenotypic identification results of the tdk gene knockout strain in Example 1. DETAILED DESCRIPTION

[0027] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation of the present invention is described in detail below in conjunction with specific embodiments and drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0028] An embodiment of the present application provides an Agrobacterium gene editing vector, which can achieve efficient editing of the Agrobacterium genome.

[0029] Specifically, the Agrobacterium gene editing vector includes the following gene elements: a plasmid backbone, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, and an upstream homology arm and a downstream homology arm of the target gene.

[0030] The CRISPR / spCas9 (Clustered Regularly Interspaced Short PalindromicRepeats-CRISPR associated protein spCas9) gene editing system is a CRISPR type II system. The CRISPR / spCas9-GFP system fuses the GFP green fluorescent protein gene at the C-terminus of the spCas9 protein to indicate whether the spCas9 protein is expressed. The principle of the CRISPR / spCas9 system: ① Recognition component: The CRISPR sequence is transcribed to form an sgRNA with targeted recognition function; ② Cutting component: The spCas9 protein is a nuclease that forms a complex with the sgRNA. As the sgRNA specifically recognizes and binds to a specific DNA sequence, the spCas9 protein cuts off the targeted DNA chain, causing a gap in the gene and achieving the break of the target gene; then the cell repairs the gene through a repair system such as homologous recombination or non-homologous end joining to achieve the purpose of gene editing. ③ Discrimination component: The spCas9-GFP fusion protein emits green fluorescence under a blue light, which can be used to determine whether the spCas9 protein is expressed. If the clone emits green fluorescence, it means that the spCas9 protein is expressed and gene editing is likely to occur in the cell; if the clone does not emit green fluorescence, it means that the spCas9 protein is not expressed, indicating that gene editing has not occurred in the cell. However, these designs are not enough to make the CRISPR / spCas9-GFP system work efficiently in Agrobacterium. We further optimized the promoter driving the pCas9 gene, the concentration of the promoter inducer, and the length of the homology arm, as detailed below: ① This study tested two inducible promoters, Pvan and Pxyl, and found that when the Pvan promoter induced the expression of the spCas9 gene, the gene editing efficiency was relatively high; ② Using a lower concentration of inducer to induce the expression of the spCas9 gene is conducive to the occurrence of gene editing; ③ Limited by the size of the plasmid, the longest homology arm should not exceed 2K.

[0031] The system has the following advantages: ① The inducible promoter Pvan is used to drive the expression of the spCas9 gene in the CRISPR / spCas9-GFP system, which strictly controls the expression level of the spCas9 protein and is conducive to maximizing the editing efficiency of the CRISPR / spCas9-GFP system; ② By screening homologous arms of different lengths and assembling the homologous arms of the optimal length into the CRISPR / spCas9-GFP system, the gene editing efficiency obtained is relatively high; ③ In the CRISPR / spCas9-GFP system, the spCas9 protein is labeled with GFP green fluorescent protein, which can directly determine whether the spCas9 protein is expressed, and then determine the possibility of gene editing in the colony, which indirectly improves the screening efficiency of gene editing strains.

[0032] The above-mentioned Agrobacterium gene editing vector adopts the CRISPR / spCas9-GFP gene editing system to construct an efficient, simple and scarless genome editing system in Agrobacterium, which can achieve gene knockout and insertion.

[0033] In some embodiments, the target gene includes a tdk gene. Further, the gRNA includes at least one of the sequences shown in SEQ ID NO.29, SEQ ID NO.32, and SEQ ID NO.35. It should be noted that the target gene is not limited to the genes indicated above, and other genes in Agrobacterium can also be gene edited by designing the corresponding gRNA.

[0034] In some of the embodiments, a repetitive sequence is connected between two adjacent gene elements in the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homology arm of the target gene, and the downstream homology arm of the target gene;

[0035] Furthermore, the length of the repeated sequence is 30 bp.

[0036] In some embodiments, the plasmid backbone is a pSJ-backbone plasmid backbone. The nucleotide sequence of the pSJ-backbone plasmid backbone is shown in SEQ ID NO.1; the nucleotide sequence of the Pvan promoter is shown in SEQ ID NO.4; and the nucleotide sequence of the spCas9 gene fragment is shown in SEQ ID NO.7.

[0037] In some embodiments, the fluorescent protein gene is a GFP green fluorescent protein gene. It should be noted that the fluorescent protein gene is not limited to the above-mentioned genes, and may also be other reporter genes.

[0038] The above-mentioned Agrobacterium gene editing vector is an efficient and scarless gene editing system that can achieve gene knockout and gene knockin in Agrobacterium.

[0039] An embodiment of the present application also provides a gene editing method of Agrobacterium, comprising the following steps S110-S120:

[0040] S110, constructing the above-mentioned Agrobacterium gene editing vector;

[0041] S120, transforming the Agrobacterium gene editing vector into Agrobacterium competent cells, culturing, and screening to obtain Agrobacterium editing strains.

[0042] Among them, the Agrobacterium editing strain is a mutant Agrobacterium obtained after the Agrobacterium competent cells are subjected to gene editing (such as gene knockout or knockout operations) using the above-mentioned Agrobacterium gene editing vector.

[0043] In some of the embodiments, the step of constructing the Agrobacterium gene editing vector includes: assembling each of the gene elements by Gibson technology to obtain the Agrobacterium gene editing vector.

[0044] In some embodiments, the Agrobacterium gene editing vector is transformed into Agrobacterium competent cells, and the steps of culturing and screening include:

[0045] The Agrobacterium gene editing vector is transformed into the Agrobacterium competent cells, and cultured on a resistant plate medium, and then the monoclonal colonies are observed under a blue light to see whether they emit green fluorescence;

[0046] The monoclonal colony that emits green fluorescence under blue light is verified to obtain the Agrobacterium editing strain.

[0047] Specifically, the step of electroporation of Agrobacterium includes: taking 500ng of the successfully assembled Agrobacterium gene editing vector and adding it to 100 microliters of Agrobacterium competent cells. After gently mixing, transfer to a 2mm electroporation cup and let stand on ice for 20 minutes. Select the BIORAD ECO2 program, 2.5kV electroporation, quickly add 1mL of PYE liquid culture medium, and rejuvenate at 30℃ for 3h. Centrifuge at 6000rpm for 3min, remove 900 microliters of supernatant, resuspend the bacterial pellet in the remaining 100 microliters of liquid, and apply the resuspended liquid to a PYE resistant plate (Kan).

[0048] The fluorescent protein gene is the green fluorescent protein gene GFP. The steps of screening the Agrobacterium editing strain include: three days after coating on the kan-resistant plate, observing the monoclonal colonies under a blue light to see whether they emit green fluorescence, and streaking the monoclonal colonies emitting green fluorescence into small squares on a new PYE-resistant plate (Kan), performing PCR verification the next day to obtain the Agrobacterium editing strain.

[0049] In some embodiments, after the step of verifying the monoclonal colonies that emit green fluorescence under a blue light, the following steps are also included: transferring the verified qualified Agrobacterium editing bacteria to a PYE liquid culture medium without antibiotics for culture, and then performing PCR identification to obtain an Agrobacterium editing strain that does not carry a gene editing vector. The purpose of removing the gene editing plasmid from the Agrobacterium editing strain is to obtain an Agrobacterium editing strain with a clean background without any screening markers, which is of great significance for the subsequent research on the Agrobacterium editing strain.

[0050] The above-mentioned Agrobacterium gene editing method can achieve gene knockout and knock-in in Agrobacterium. By constructing an efficient, simple and traceless gene editing system, it can realize process-based gene editing and obtain edited strains without screening markers, which greatly improves the efficiency of gene editing, fills the technical deficiencies in this field, and plays an important role.

[0051] One embodiment of the present application also provides an Agrobacterium editing strain prepared by the above-mentioned gene editing method.

[0052] The following are specific embodiments.

[0053] Unless otherwise specified, the reagents and instruments used in the examples are all conventionally selected in the art. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions, such as those described in literature or books or methods recommended by kit manufacturers.

[0054] The sequences of genes and primers involved in Example 1 are shown in Table 1. In Table 1, pJ23119 is the promoter of each sgRNA in the example, driving the expression of each sgRNA in the example; sgRNA scaffold is composed of sgRNA together with gRNA sequence. In gene editing, gRNA plays a role in targeting DNA target, and sgRNA scaffold sequence plays a role in binding spCas9 protein; in Table 1, the capital letter part is the corresponding designed homology arm.

[0055] Table 1 Sequences of genes and primers involved in Example 1

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064] Example 1 Gene Editing of Agrobacterium

[0065] (1) Design of gRNA:

[0066] The design was performed using the CHOPCHOP online tool, the specific URL of which is: http: / / chopchop.cbu.uib.no / .

[0067] Specifically, the targeting gene of this embodiment includes the tdk gene, whose nucleotide sequence is shown in Table 1; three gRNAs are designed for the application of the tdk gene, namely gRNA1, gRNA2, and gRNA3, and the specific sequences of gRNA1, gRNA2, and gRNA3 are tttccagggcaagctcttcc, gaaggcgcccagatcgaagt, and cagatcgaagttggcggcaa, respectively.

[0068] (2) Plasmid design:

[0069] See the plasmid map designed in this example for Figure 1 , mainly includes the following parts, namely pSJ-backbone plasmid skeleton, vanillate inducible promoter Pvan, spCas9 gene, green fluorescent protein gene GFP, gRNA and homology arm. Among them, gRNA and repair template (homologous arm) can be replaced according to the target gene. The sequence of each element is shown in Table 1. The main method used to assemble each element into a plasmid is the Gibson assembly method. The specific steps are as follows:

[0070] (a) Design primers to linearize the pSJ-backbone plasmid skeleton and Pvan. After linearization, there will be a 30bp repetitive sequence between the two elements (this needs to be considered before designing primers). Then assemble them. The system is 20 μl, of which the pSJ-backbone plasmid skeleton is 0.1 pmol, the Pvan induction system element is 0.2 pmol, 2 μl ExnaseⅡ, 4 μl 5X CEⅡBuffer, and water is added to make up to 10 μl. Then place it in a PCR instrument and react at 37℃ for 30 minutes. Then, the assembly product is transformed into DH5α competent cells and screened on LB karatomycin resistance plates to obtain the plasmid pSJ-Pvan.

[0071] (b) Design primers to linearize the obtained plasmid pSJ-Pvan and spCas9 gene elements, and also make a 30 bp repeat sequence between the two fragments. Assemble them according to the method of the above step (a), the molar ratio of the two elements is 1:1, and the other methods are the same as the above step (a), and the pSJ-Pvan-spCas9 plasmid can be obtained.

[0072] (c) After designing primers to linearize the plasmids pSJ-Pvan-spCas9 and GFP, a 30 bp repetitive sequence was also present between the two fragments. The two components were assembled according to the method of step (a) above, with a molar ratio of 1:1. The other methods were the same as step (a) above, and the pSJ-Pvan-spCas9-GFP plasmid was obtained.

[0073] (d) Design primers to assemble plasmid pSJ-Pvan-spCas9-GFP, P23119-sgRNA scaffold, upstream homology arms and downstream homology arms of the target gene. After linearization of plasmid pSJ-Pvan-spCas9-GFP, P23119-sgRNA scaffold, upstream and downstream homology arms of the target gene, there is a 30 bp repeat sequence between each element, and the assembly is performed using the method of step (a) above, with the molar ratio of each element being 1:1:1:1, and the total molar number not exceeding 0.2 pmol. The other methods are the same as the method of step (a) above, and the pSJ-P23119-sgRNA scaffold-HRs-Pvan-spCas9-GFP plasmid can be obtained.

[0074] (e) The gRNA sequence is designed on the primer, and circular PCR is performed on the plasmid pSJ-P23119-sgRNA scaffold-HRs-Pvan-spCas9-GFP to obtain a linear fragment. After that, the linear fragment is transformed into DH5α competent cells, and the gRNA is connected between P23119 and sgRNA scaffold by screening on LB resistance (Kan) plates to obtain the gene editing vector pSJ-P23119-sgRNA-HRs-Pvan-spCas9-GFP. The plasmid map is shown in Figure 1 shown.

[0075] (3) Agrobacterium gene editing:

[0076] (a) Take 500ng of the successfully assembled plasmid (i.e., pSJ-P23119-sgRNA-HRs-Pvan-spCas9-GFP plasmid) and add it to 100 μl of Agrobacterium competent cells; wherein the Agrobacterium competent cells are prepared from Agrobacterium cells with a strain deposit number of ATCC 33970. After gently mixing, transfer to a 2mm electroporation cup and let stand on ice for 20 minutes. Select the BIORAD ECO2 program, 2.5kV electroporation, quickly add 1mL of PYE liquid culture medium, and rejuvenate at 30℃ for 3h. Centrifuge at 6000rpm for 3min, remove 900 μl of supernatant, resuspend the bacterial pellet in the remaining 100 μl of liquid, and apply the resuspended liquid to a PYE resistant plate (Kan).

[0077] (b) After three days, check whether there are single clones growing. Under blue light, streak the single clones emitting green fluorescence on a new PYE resistance (kan) plate. Perform PCR verification the next day to obtain the Agrobacterium edited strain.

[0078] (4) Agrobacterium editing strain discards gene editing plasmid:

[0079] The purpose of discarding the gene editing plasmid in the Agrobacterium editing strain is to obtain a mutant strain with no screening markers and a clean background, which is of great significance for the subsequent study of Agrobacterium mutants. Specifically, the Agrobacterium mutants are picked into the PYE liquid medium without antibiotics and cultured overnight at 28°C, 220rpm. The next day, the bacterial solution was diluted 1000 times, 100 microliters were spread on the PYE solid plate without antibiotics, and cultured at 30°C. After 3 days, the specific primers on the gene editing plasmid were used to detect the clones on the plate to determine whether the plasmid was lost. If the plasmid is lost, no bands are produced after PCR amplification with specific primers; if the plasmid exists, a band is produced after PCR amplification with specific primers.

[0080] (5) Result detection

[0081] The above steps (1)-(4) are used to knock out the tdk gene in Agrobacterium. PCR combined with gel electrophoresis is used to identify the knockout of the tdk gene. The detection results are as follows Figure 2 As shown, Figure 2 The results of the knockout test of tdk gene in Agrobacterium using gRNA1 are shown in the figure. The knockout efficiency of three different gRNAs of tdk gene was tested by PCR. Figure 3 As shown; the phenotypic identification of the tdk gene knockout mutant of Sinorhizobium using the nutritional metabolic deficiency method is shown in Figure 4 shown. Figure 4In the figure, the first culture dish (i.e., the culture dish labeled with PYE) is the result of phenotypic identification using PYE medium without 5-fluorodeoxyuridine, and the second culture dish (i.e., the culture dish labeled with PYE+5FudR) is the result of phenotypic identification using PYE medium containing 5-fluorodeoxyuridine.

[0082] from Figure 2-Figure 4 It can be seen that the knockout of the tdk gene was achieved in Agrobacterium, and the highest knockout efficiency reached 91%.

[0083] The Agrobacterium gene editing vector and editing method of the present application realize gene knockout and gene knock-in in Agrobacterium, construct an efficient, simple and traceless gene editing system, realize process-based gene editing, and can obtain edited strains without screening markers. The system greatly improves the efficiency of gene editing, fills the technical deficiencies in this field, and plays an important role.

[0084] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0085] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. An Agrobacterium gene editing vector, characterized in that: The Agrobacterium gene editing vector includes the following gene elements: a plasmid skeleton, a Pvan promoter, a spCas9 gene, a green fluorescent protein gene GFP, a gRNA, an upstream homology arm and a downstream homology arm of the target gene.

2. The Agrobacterium gene editing vector according to claim 1, characterized in that The target gene includes the tdk gene.

3. The Agrobacterium gene editing vector according to claim 2, characterized in that: The gRNA includes at least one of the sequences shown as SEQ ID NO.29, SEQ ID NO.32 and SEQ ID NO.

35.

4. The Agrobacterium gene editing vector according to any one of claims 1 to 3, characterized in that In the plasmid backbone, the Pvan promoter, the spCas9 gene, the green fluorescent protein gene GFP, the gRNA, the upstream homologous arm of the target gene and the downstream homologous arm of the target gene, a repetitive sequence is connected between two adjacent gene elements.

5. The Agrobacterium gene editing vector according to any one of claims 1 to 3, characterized in that: The plasmid backbone is a pSJ-backbone plasmid backbone, and the nucleotide sequence of the pSJ-backbone plasmid backbone is shown in SEQ ID NO.1; The nucleotide sequence of the Pvan promoter is shown in SEQ ID NO.4; The nucleotide sequence of the spCas9 gene fragment is shown in SEQ ID NO.

7.

6. A gene editing method of Agrobacterium, characterized in that: The steps include: Constructing the Agrobacterium gene editing vector according to any one of claims 1 to 5; The Agrobacterium gene editing vector is transformed into Agrobacterium competent cells, cultured, and screened to obtain Agrobacterium editing strains.

7. The gene editing method according to claim 6, characterized in that: The step of constructing the Agrobacterium gene editing vector comprises: assembling each of the gene elements by Gibson technology to obtain the Agrobacterium gene editing vector.

8. The gene editing method according to claim 6, characterized in that: The steps of transforming the Agrobacterium gene editing vector into Agrobacterium competent cells, culturing and screening include: The Agrobacterium gene editing vector is transformed into the Agrobacterium competent cells, and cultured on a resistant plate medium, and then the monoclonal colonies are observed under a blue light to see whether they emit green fluorescence; The monoclonal colony that emits green fluorescence under blue light is verified to obtain the Agrobacterium editing strain.

9. The gene editing method according to any one of claims 5 to 8, characterized in that: After the step of verifying the monoclonal colonies that emit green fluorescence under a blue light, the method also includes the following steps: transferring the verified qualified Agrobacterium editing strain to an antibiotic-free culture medium for cultivation, and then performing PCR identification to obtain the Agrobacterium editing strain that does not carry the gene editing vector.

10. An Agrobacterium editing strain, characterized in that: Prepared by the gene editing method according to any one of claims 6 to 9.

Images