Method for assisting in enhancing detection sensitivity

By using the synergistic effect of the CRISPR-Cas12a system and the auxiliary chain AN with threshold concentration in food safety detection, the trans-cut activity of CRISPR-Cas12a is activated, solving the problems of complex operation and insufficient sensitivity of the existing detection methods, and achieving high sensitivity and simple food safety detection.

CN120099145APending Publication Date: 2025-06-06HAINAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510184138.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-19
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The existing food safety detection methods are complex in operation and high background signals, making it difficult to achieve fast and simple detection, and the detection sensitivity is insufficient, making it difficult to effectively identify the existence of pathogenic microorganisms in food.

Method used

The CRISPR-Cas12a system is used as the core of the biosensor. By adding the auxiliary chain AN at a threshold concentration to the target detector, the trans-cut activity of CRISPR-Cas12a is synergistically activated, thereby generating a fluorescent signal and achieving the signal release effect of "OFF+OFF=ON".

Benefits of technology

It significantly improves detection sensitivity, and increases it by two orders of magnitude compared with traditional detection methods, simplifies the operation process and shortens the detection time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099145A_ABST
    Figure CN120099145A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular biology, provides a biosensor based on a CRISPR-Cas12a system, and aims to enhance the sensitivity of an existing nucleic acid detection method. The working principle of the sensor is based on the concept of'threshold concentration ', namely the minimum concentration required by the reaction start or the obvious increase of the reaction rate. When the concentration of the target object is as low as a threshold value, the CRISPR-Cas12a is maintained in an inactive state, the fluorophore and the quencher (F-Q) are not cut, and the signal is in an off state (OFF). The auxiliary chain AN also remains in an OFF state. The synergistic effect of the two can activate the CRISPR-Cas12a cleavage activity and trigger signal opening (ON). According to the method, complex nucleic acid amplification and special instruments are not needed, and the detection sensitivity is remarkably improved. Compared with a traditional Cas12a detection system, the Cas12a detection system has the advantage that the detection sensitivity can be improved by two orders of magnitude. In addition, due to the application of the technology, the prospect of a CRISPR-Cas12a system in clinical diagnosis is expanded, and a new solution is provided for detection of pathogenic microorganisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of genetic engineering and molecular biology, and to a method of using the Cas12a system as the core of a biosensor to add an auxiliary chain AN at a threshold concentration to a target detection object to improve the detection sensitivity. In particular, when the target detection object and the auxiliary chain AN at the threshold concentration exist alone, no signal is generated (OFF), and when they work together, the signal release effect of "OFF+OFF=ON" can be achieved. Background Art

[0002] CRISPR-Cas12a is an RNA-guided nuclease whose catalytic activity can be activated by hybridization of crRNA with single-stranded (ssDNA) or double-stranded DNA (dsDNA). The activated CRISPR-Cas12a system not only has the ability to cut target DNA (called cis-cutting), but also can indiscriminately cut nonspecific DNA (called trans-cutting). Based on its excellent trans-cutting ability, the sensing platform of CRISPR-Cas12a has been constructed using ssDNA reporter genes labeled with fluorophores (F) and quenchers (Q), enzyme-labeled reporter genes, or spherical nucleic acid reporter genes.

[0003] Food safety is of vital importance. Improper food storage can cause pathogens to proliferate, which can not only cause skin and soft tissue infections, but also threaten the health of humans and animals in severe cases. With the continuous growth of the global population and the increasing demand for food consumption, the complexity of the food supply chain is also increasing, which makes food face more potential risks in processing, transportation, storage and other links. In particular, the rapid reproduction of pathogenic microorganisms such as bacteria, viruses, and fungi under suitable temperature and humidity conditions has become an important challenge in food safety management. PCR and LAMP technologies are commonly used in biological detection, but they are limited in on-site detection due to their complex operations and high background signals. Therefore, compared with traditional methods, there is an urgent need for a detection method that does not require PCR pre-amplification to shorten the detection time, simplify the operation process, and improve the sensitivity of the detected object. Summary of the invention

[0004] The main purpose of the present invention is to establish a method for enhancing the detection sensitivity of CRISPR-Cas12a-driven auxiliary based on threshold concentration. First, the threshold concentration of auxiliary chain AN is used to not activate the trans-cleavage activity of CRISPR-Cas12a, and no signal is generated "OFF" ( Figure 1 Pathway a). The specific gene (mecA) of methicillin-resistant Staphylococcus aureus commonly found in food is used as the target detection gene TN. When the threshold concentration of the target detection substance TN does not activate the trans-cleavage activity of CRISPR-Cas12a, no signal is generated "OFF" ( Figure 1Pathway b) The threshold concentration of AN and TN synergizes to activate the trans-cleavage activity of CRISPR-Cas12a, thereby generating a fluorescent signal "ON" ( Figure 1 Pathway c), experimental principle see Figure 1 Compared with traditional detection, this method significantly improves the detection sensitivity by two orders of magnitude.

[0005] The reaction reagents of the present invention are configured as follows: 1uM CRISPR Cas12a: dilute 1uL 100uM CRISPR Cas12a with 99uLLbaCas12a Diluent to the desired concentration. 1uM crRNA: dilute 1uL 100uM crRNA with 99uLDEPC to the desired concentration. 10uM F-Q: dilute 10uL 100uM F-Q with 90uLDEPC to the desired concentration.

[0006] Here are the steps:

[0007] Step 1: Design specific primer AN and crRNA, the sequences and serial numbers are shown in Table 1.

[0008] Step 2: Prepare reagents: 1uM CRISPRCas12a: dilute 1uL 100uM CRISPRCas12a with 99uL LbaCas12a Diluent to the desired concentration. 1uM crRNA: dilute 1uL 100uM crRNA with 99uL DEPC to the desired concentration. 10uM F-Q: dilute 10uL 100uM F-Q with 90uL DEPC to the desired concentration. 1XNE Buffer r2.1: 50mM NaCl, 10mMTris-HCl, 10mMMgCl 2 ,100μg / mlRecombinantAlbumin(pH7.9,25℃)

[0009] Step 3: Mix CRISPR-Cas12a protein with crRNA of the same concentration to form a binary complex, fill the system to 10ul with NEBufferr2.1, and incubate at 37°C for 30min.

[0010] Step 4: Add FQ to AN at different concentrations

[0011] Step 5: The incubated binary complex of CRISPR Cas12a and crRNA reacts with different concentrations of AN, and finally fills up to 20ul with NEBuffer r2.1. Add to 384-well plate for fluorescence kinetic detection (492nm, 520nM). Observe the data phenomenon and determine the threshold concentration of AN.

[0012] Step 6: Repeat step 3 and add FQ to the mecA assay at different concentrations.

[0013] Step 7: The incubated CRISPR Cas12a and crRNA binary complex reacts with different concentrations of mecA, and finally fills up to 20ul with NEBuffer r2.1. Add to 384-well plate for fluorescence kinetic detection (492nm, 520nM). Observe the data phenomenon and select the threshold concentration of mecA.

[0014] Step 8: Repeat step 3, mix the threshold concentration of AN and mecA and add them to the incubated CRISPRCas12a and crRNA binary complex for synergistic effect, and finally fill it up to 20ul with NEBuffer r2.1. Add it to a 384-well plate for fluorescence kinetic detection (492nm, 520nM).

[0015] Table 1

[0016] BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to better illustrate the specific implementation of the present invention or the technical solutions in the prior art, the following is a brief description of the drawings of the relevant implementation. Obviously, the following drawings only show some implementations of the present invention, and ordinary technicians can deduce other possible drawings based on these drawings without creative work.

[0018] Figure 1 Schematic diagram of the principle of the "OFF+OFF=ON" strategy without pre-amplification inspired by threshold concentration;

[0019] Figure 2 The threshold concentration screening diagram for auxiliary chains AN and mecA;

[0020] Figure 3 This is a data graph showing the detection of mecA in milk samples based on the “OFF+OFF=ON” strategy without pre-amplification. DETAILED DESCRIPTION

[0021] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. Usually, conventional conditions are followed, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0022] Example 1: Taking the mecA genome as an example, the present invention uses the CRISPR-Cas12a system as the core of the biosensor to add a threshold concentration of AN to the simulated sample detection of mecA to improve the detection sensitivity.

[0023] Step 1: Extract mecA genome;

[0024] Step 2: Design specific primers AN, crRNA and FQ sequences (as shown in Table 1);

[0025] Step 3: Prepare reagents: 1uM CRISPR Cas12a: dilute 1uL 100uM CRISPR Cas12a with 99uL LbaCas12a Diluent to the desired concentration. 1uM crRNA: dilute 1uL 100uM crRNA with 99uL DEPC to the desired concentration. 10uM FQ: dilute 10uL 100uM FQ with 90uL DEPC to the desired concentration. 1XNEBuffer r2.1: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl 2 , 100μg / ml RecombinantAlbumin (pH 7.9, 25℃);

[0026] Step 4: Mix CRISPR-Cas12a protein with crRNA of the same concentration to form a binary, add buffer to complete the system to 10uL, and incubate at 37°C for 30min;

[0027] Step 5: Add FQ to AN at different concentrations;

[0028] Step 6: Incubate the CRISPR-Cas12a and crRNA dyad with different concentrations of AN, and finally fill to 20uL with NEBuffer r2.1. Add to 384-well plate for fluorescence kinetic detection (492nm, 520nM). Observe the data phenomenon and select the threshold concentration of AN (such as Figure 2 a);

[0029] Step 6: Repeat step 3 and add FQ to the mecA test at different concentrations;

[0030] Step 7: Incubate the CRISPR-Cas12a and crRNA dyads with different concentrations of mecA, and finally fill to 20uL with NEBuffer r2.1. Add to 384-well plate for fluorescence kinetic detection (492nm, 520nM). Observe the data phenomenon and select the threshold concentration of mecA genome (such as Figure 2 b);

[0031] Step 8: Repeat step 3, mix the threshold concentration of AN and mecA and add them to the incubated CRISPR-Cas12a and crRNA binary for synergistic action, and finally fill it up to 20uL with NEBuffer r2.1. Add it to a 384-well plate for fluorescence kinetic detection (492nm, 520nM) (such as Figure 3 ).

Claims

1. A method for improving the sensitivity of pathogen or nucleic acid detection based on CRISPR-Cas12a biosensor, characterized in that: The steps include: (1) Design of auxiliary chain AN sequence: Design the sequence of auxiliary chain AN based on the crRNA sequence; (2) Determination of the threshold concentration of auxiliary chain AN: After auxiliary chain AN activates CRISPR-Cas12a, the threshold concentration is screened; (3) Determination of the threshold concentration of the target substance: When the detection limit of the target substance is exceeded, it is determined as the threshold concentration; (4) Synergistic effect between auxiliary chain AN and target detection substance: When detecting low-concentration targets, the addition of auxiliary chain AN can shorten the detection time through synergistic effect. It does not need to rely on complex nucleic acid amplification methods when used, is low-cost, and can improve the detection sensitivity by two orders of magnitude.

2. A method according to claim 1, wherein the CRISPR-Cas12a system is used as a biosensor to improve the sensitivity of pathogen or nucleic acid detection, characterized in that The designed auxiliary chain AN can activate CRISPR-Cas12a activity when it is at a non-threshold concentration. When it is at a threshold concentration, it does not activate CRISPR-Cas12a activity and no signal is generated (OFF).

3. According to claim 1, it is characterized in that: When the target detection object reaches the threshold concentration, CRISPR-Cas12a remains inactive, the fluorophore-quencher (FQ) is not cut, and the signal is in a closed state (OFF). Adding an auxiliary chain AN with the same threshold concentration triggers the detection signal (ON) after synergistic action.

4. The method according to claim 1, characterized in that Step (1) specifically includes: preparing the reagents as follows: 1uM CRISPR Cas12a: dilute 1uL 100uM CRISPR Cas12a with 99uL Lba Cas12a Diluent to the desired concentration; 1uM crRNA: dilute 1uL 100uM crRNA with 99uL DEPC to the desired concentration; 10uM FQ: dilute 10uL 100uM F-Q with 90uL DEPC to the desired concentration; 1X NEBuffer r2.1: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100μg / ml Recombinant Albumin (pH 7.9, 25°C).

5. The method according to claim 2, characterized in that: The CRISPR-Cas12a and crRNA dyad was reacted with different concentrations of AN, and finally filled to 20uL with NEBuffer r2.1; added to a 384-well plate for fluorescence kinetic detection (492nm, 520nm); the data phenomenon was observed to determine the threshold concentration of AN.

6. The method according to claim 3, characterized in that: The incubated CRISPR-Cas12a and crRNA dyads were reacted with different concentrations of mecA genome, and finally filled to 20uL with NEBuffer r2.1; added to a 384-well plate for fluorescence kinetic detection (492nm, 520nM); the data phenomenon was observed and the threshold concentration of the mecA genome was selected.

7. The method according to claim 1, characterized in that Step (4) specifically includes: mixing the threshold concentration of AN and mecA and adding them to the incubated CRISPR-Cas12a and crRNA binary for synergistic effect, and finally filling up to 20uL with NEBufferr2.1; adding to a 384-well plate for fluorescence kinetic detection (492nm, 520nM).

8. The method according to claim 1, characterized in that The sequence of the auxiliary chain AN is complementary to the spacer sequence of crRNA, and the nucleotide sequence is AAATGATTATGGCTCAGGTACTGCTATCCACCCTCAAACAGGTGAATTA.