Recombinant collagen and application thereof in prevention or treatment of virus infection

Abstract

The invention provides recombinant collagen and application thereof in prevention or treatment of virus infection. Virus comprises HIV (human immunodeficiency virus) and HPV (human papillomavirus). The recombinant collagen provided by the invention comprises one or more repetitive units, the repetitive units are connected directly or through a linker, and each repetitive unit comprises an amino acid sequence as shown in any one of SEQ ID NO: 1-6 or a variant of the amino acid sequence.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and relates to recombinant collagen and its application in preventing or treating viral infections. Background Art

[0002] Collagen is a class of proteins widely distributed in human connective tissues and is also the most abundant protein in the human body, accounting for 25% - 35% of the total protein content. Its main functions are reflected in maintaining the extracellular environment, maintaining the normal physiological functions of tissues and organs, repairing body injuries, etc. Collagen is a natural biological resource with biocompatibility, support elasticity for cells, and degradability that are beyond the reach of other high-molecular materials. Therefore, collagen can be widely used in industries such as medicine and cosmetics.

[0003] Natural collagen molecules can form a special superhelical structure, which is a left-handed helix with 3 amino acid residues as the basic repeat unit, and these three amino acid residues are usually Gly-X-Y. Gly is essential for the formation of hydrogen bonds in collagen. It has no side chain itself, enabling collagen to be closely packed and maintaining skin tension and elasticity. Due to the disadvantages of natural collagen such as poor stability, sensitivity to enzymes such as collagenase and matrix metalloproteinase, short retention time in the body, and lack of mechanical strength in aqueous systems, its development and application in the biomedical field are limited. Through various chemical modifications and cross-linking reactions, the physical and chemical properties of collagen can be changed to improve its mechanical strength and anti-degradation properties, obtain new bioactive and functional collagen cross-linked derivatives, and further develop new biomaterials.

[0004] Currently, there are few studies and discoveries on collagen in the field of antiviral. Summary of the Invention

[0005] To solve the problems existing in the prior art, based on the unique design of recombinant humanized collagen, the present invention has screened out recombinant humanized type II collagen with antiviral activity against HIV and HPV viruses.

[0006] The first aspect of the present invention provides a collagen, which is composed of one or more repeating units, and the repeating unit is composed of the amino acid sequence shown in SEQ ID NO: 6 or 2, or is composed of an amino acid sequence with 1 - 5 Gly-X-Y motifs added at the N-terminus and / or C-terminus of SEQ ID NO: 6, where X is selected from E, L, P, D or R, and Y is selected from P, Q, S or A.

[0007] In some embodiments, the repeating unit is composed of the amino acid sequence shown in any one of SEQ ID NO: 1 - 6.

[0008] In some embodiments, the plurality of repeating units are 9 - 16 repeating units.

[0009] In some embodiments, the collagen consists of the amino acid sequence shown in any one of SEQ ID NOs: 7 - 12.

[0010] The second aspect of the present invention provides a nucleic acid encoding the collagen described in the first aspect of the present invention.

[0011] The third aspect of the present invention provides a vector comprising the nucleic acid described in the second aspect of the present invention.

[0012] The fourth aspect of the present invention provides a host cell comprising the nucleic acid described in the second aspect of the present invention or the vector described in the third aspect of the present invention.

[0013] The fifth aspect of the present invention provides a method for producing the collagen described in the fourth aspect of the present invention, comprising the following steps: (1) Culturing the host cell described in the fourth aspect under suitable culture conditions; (2) Harvesting the host cell and / or culture medium containing collagen; and (3) Purifying the collagen.

[0014] The sixth aspect of the present invention provides a composition comprising the collagen described in the first aspect of the present invention.

[0015] In some embodiments, the composition is a pharmaceutical composition, a medical device, a tissue engineering product, a cosmetic or a health product.

[0016] In some embodiments, the composition is a solid, liquid or gel composition.

[0017] In some embodiments, the composition is a human lubricant, a vaginal gel or a condom lubricant.

[0018] The seventh aspect of the present invention provides the use of the collagen described in the first aspect of the present invention in the preparation of a product for preventing and / or treating viral infections or diseases caused by viral infections; the virus is HPV or HIV.

[0019] In some embodiments, the product is a human lubricant, a vaginal gel or a condom lubricant.

[0020] In some embodiments, the product is a pharmaceutical composition.

[0021] In some embodiments, the disease is cervical intraepithelial neoplasia, condyloma acuminata or cervical cancer.

[0022] In some embodiments, the disease is acquired immunodeficiency syndrome.

[0023] The eighth aspect of the present invention provides a method for inhibiting virus infection in vitro, including contacting cells with the collagen described in the first aspect of the present invention or the composition described in the sixth aspect of the present invention; the virus is HPV or HIV.

[0024] The present invention has the following advantages over the prior art: The present invention has for the first time screened and constructed recombinant humanized type II collagen, which has antiviral (such as HIV and HPV) activities that the type II collagen of animal origin does not have, achieving unexpected technical effects. Brief Description of the Drawings

[0025] Figures 1A - 1B Shows the protein electrophoresis results of recombinant humanized type II collagen. Figure 1A Shows the protein electrophoresis results of Collagen II-1 and Collagen II-2; Figure 1B Shows the protein electrophoresis results of TC2J2, TC2J3, TC2J4 and TC2J5.

[0026] Figure 2 Shows the cell adhesion activities of recombinant humanized Collagen II-1 and Collagen II-2. Figure 2 Collagen in [reference] represents bovine type I collagen and is used as a control.

[0027] Figure 3 Shows the results of the cell scratch assay of recombinant humanized Collagen II-1 and Collagen II-2. Figure 3 Collagen in [reference] is type II collagen and is used as a control.

[0028] Figure 4 Shows the scratch closure rates of recombinant humanized Collagen II-1 and Collagen II-2. Figure 4 Collagen in [reference] is type II collagen and is used as a control (in the results of each time point, the middle column is the control result). At 24 h of treatment, Collagen II-1 and Collagen II-2 have significantly higher scratch closure rates than the control Collagen.

[0029] Figure 5 Shows the anti-HIV activities of recombinant humanized Collagen II-1 and Collagen II-2.

[0030] Figure 6 Shows the anti-HPV activities of recombinant humanized Collagen II-1 and Collagen II-2.

[0031] Figure 7It shows that the antiviral activity of recombinant humanized collagen II-2 mainly acts on viral proteins and does not act on target cells.

[0032] Figure 8 It shows that the antiviral activity of recombinant humanized collagen II-2 mainly acts on the virus entry stage.

[0033] Figure 9 It shows the comparison of the anti-HPV activities of recombinant humanized collagen II-1 and the single repeat unit R1P5.

[0034] Figure 10 It shows the comparison of the anti-HPV virus activities of collagen II-1, TC2J2, TC2J3, TC2J4 and TC2J5. Detailed implementation manners

[0035] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0036] Term definitions As used herein, "type II collagen" is a high molecular weight protein. Filamentous collagen fibers are intertwined with elastin and proteoglycans to form a network structure, generating a certain mechanical strength. Type II is mainly produced by chondrocytes and is mostly present in tissues such as bones, joints, and tendons.

[0037] As used herein, "recombinant humanized type II collagen" refers to a recombinant protein consisting of or substantially consisting of sequences derived from human type II collagen. In this article, recombinant humanized type II collagen can consist of or be substantially composed of fragments or multiple repeats of fragments derived from human type II collagen. In this article, "recombinant humanized type II collagen" contains one or more repeat units. The repeat unit can be derived from human type II collagen. The repeat unit can be the amino acid sequence shown in any one of SEQ ID NO: 1-6, preferably SEQ ID NO: 1 and SEQ ID NO: 2. Recombinant humanized type II collagen can be the amino acid sequence shown in any one of SEQ ID NO: 7-12. Collagen II-1 is as shown in SEQ ID NO: 7, and collagen II-2 is as shown in SEQ ID NO: 8.

[0038] As used herein, "one or more" can be any suitable integer. In the case of a collagen mutation (such as a substitution, deletion, insertion or addition), "one or more" is a number readily determined by one of ordinary skill in the art, such as 1 - 90 and any integer and range therebetween, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38 or 39, etc.

[0039] As used herein, the term "variant" means a polypeptide that includes alterations (i.e., substitutions, additions, insertions and / or deletions) at one or more positions, said polypeptide including repeat units and recombinant collagen. Substitution means replacing the amino acid occupying a position with a different amino acid; deletion means removing the amino acid occupying a position; and insertion means adding an amino acid adjacent to and immediately following the amino acid occupying a position. Addition refers to adding one or more amino acid residues at the C-terminus and / or N-terminus of an amino acid sequence. The substitution can be a conservative substitution. A variant of a repeat unit can be a sequence after altering (i.e., substituting, adding, inserting and / or deleting) one or more amino acid residues in any of SEQ ID NO:1 - 6. A variant of collagen can be a sequence after altering (i.e., substituting, adding, inserting and / or deleting) one or more amino acid residues in SEQ ID NO:7 - 12.

[0040] In the context of the present invention, conservative substitutions can be defined by substitutions within the amino acid classes reflected in one or more of the following tables: Substitution definition: Amino acid residues of conservative classes:

[0041] Physical and functional classification of alternative amino acid residues:

[0042] As used herein, "nucleic acid" refers to a plurality of nucleotides linked by internucleotide linkages. The internucleotide linkages can be, for example, phosphodiester bonds. The nucleic acids herein can include polynucleotides encoding the collagen of the present invention. For the convenience of subsequent processing of collagen, the nucleic acids of the present invention can also include nucleotides encoding purification tags, such as His tag, GST tag, MBP tag, SUMO tag or NusA tag, and nucleotide sequences encoding a leader sequence when needed.

[0043] As used herein, "operably linked" means a configuration in which a control sequence is placed at an appropriate position relative to a coding sequence of a polynucleotide such that the control sequence directs the expression of the coding sequence.

[0044] As used herein, a "vector" is a nucleic acid vehicle into which a polynucleotide can be inserted. When a vector enables the expression of a protein encoded by the inserted polynucleotide, the vector is called an expression vector. A vector can be introduced into a host cell by transformation, transduction, or transfection, enabling the genetic material elements it carries to be expressed in the host cell. Vectors are well known to those skilled in the art and include, but are not limited to: plasmids; phagemids; cosmids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as lambda phage or M13 phage, and animal viruses, etc. A vector can contain various elements for controlling expression, including but not limited to promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector can also contain an origin of replication. A vector can contain the nucleic acid of the present invention to facilitate its introduction into a cell for expression. A vector can contain expression control elements operably linked to the nucleic acid, such as promoters, terminators, and / or enhancers.

[0045] As used herein, a "host cell" is a cell into which a nucleic acid molecule has been introduced by molecular biology techniques. These techniques include transfecting with viral vectors, transforming with plasmid vectors, and introducing naked DNA by electroporation, lipofection, and particle gun acceleration. A host cell can be a eukaryotic cell or a prokaryotic cell. For example, eukaryotic cells are yeast cells, animal cells, and / or insect cells. Prokaryotic cells can be Escherichia coli cells.

[0046] As used herein, "personal lubricant" means a lubricant designed specifically for use on the human body. Personal lubricants enhance the lubricating effect, while also reducing skin damage and decreasing the chance of erosion by harmful microorganisms such as bacteria and viruses. Personal lubricants can effectively reduce the breakage of condoms and lower the probability of accidental pregnancy.

[0047] As used herein, a "biological dressing" is a new type of medical dressing that can be used for the repair and treatment of wounds. It is a special medical material made by professional manufacturers from biological materials and combined with drugs or other therapeutic substances. Collagen in the biological dressing forms a protective layer on the wound surface, promoting cell proliferation and regeneration and accelerating wound healing.

[0048] As used herein, "biomimetic material" refers to materials developed by mimicking various characteristics or properties of organisms. Artificial materials designed and manufactured by following the operating mode of the living system and the structural rules of biological materials are generally referred to as biomimetic materials. "Human biomimetic material" refers to materials developed by mimicking various characteristics or properties of the human body. Artificial materials designed and manufactured by following the operating mode of the living system and the structural rules of biological materials are generally referred to as biomimetic materials.

[0049] As used herein, "organoid culture material" refers to artificial materials used for culturing and constructing organoids with organoid functions to meet the needs of organ transplantation and replacement.

[0050] As used herein, "biological material" refers to materials that can be compatible with living tissues and are usually used to manufacture artificial organs or substitute tissues. "Biological material for 3D printed artificial organs" refers to biological materials used in 3D printing of artificial organs.

[0051] As used herein, the degree of relatedness between two amino acid sequences or two nucleotide sequences is described by the parameter "sequence identity". For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, Trends Genet. [Trends in Genetics] 16: 276-277) (preferably version 5.0.0 or later) implemented by the needle program in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, J. Mol. Biol. [Journal of Molecular Biology] 48: 443-453) is used to determine the sequence identity between two amino acid sequences. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of needle labeled "longest identity" (obtained using the non-simplified option) is used as the percentage identity and calculated as follows: (Number of identical residues × 100) / (Alignment length - Total number of gaps in the alignment) For the purposes of the present invention, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, ibid.) implemented using the needle program as in the EMBOSS software package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, ibid.) (preferably version 5.0.0 or later) is used to determine the sequence identity between two deoxynucleotide sequences. The parameters used are a gap opening penalty of 10, a gap extension penalty of 0.5, and the EDNAFULL (EMBOSS version of NCBI NUC4.4) substitution matrix. The output of needle labeled "longest identity" (obtained using the non-simplified option) is used as the percentage identity and is calculated as follows: (Number of identical deoxyribonucleotides × 100) / (Alignment length - Total number of gaps in the alignment) Recombinant collagen The present invention provides a collagen which is recombinant collagen, in particular recombinant humanized type II collagen, preferably having antiviral activity.

[0052] The recombinant collagen described herein comprises one or more repeating units which are directly or indirectly connected through a linker, and the repeating units comprise the amino acid sequence shown in SEQ ID NO: 2 or 6 or a variant thereof.

[0053] The variant of the repeating unit comprised in the recombinant collagen described herein is an amino acid sequence obtained by substitution, insertion, deletion and / or addition of one or more amino acids on the basis of SEQ ID NO: 2 or 6.

[0054] The variant of the repeating unit comprised in the recombinant collagen described herein includes an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO: 2 or 6.

[0055] The repeating unit comprised in the recombinant collagen described herein is composed of an amino acid sequence obtained by adding 0-15 amino acids to the N-terminus and / or C-terminus of SEQ ID NO: 2, SEQ ID NO: 6 or a variant thereof, respectively.

[0056] The repeating unit comprised in the recombinant collagen described herein is composed of the amino acid sequence shown in any one of SEQ ID NOs: 1-6.

[0057] The repeating unit comprised in the recombinant collagen described herein is composed of the amino acid sequence shown in SEQ ID NO: 1 or 2.

[0058] The recombinant collagen described herein may comprise multiple repeat units, such as 2 - 80 repeat units, preferably 2 - 50 repeat units, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 repeat units.

[0059] The linker in the recombinant collagen described herein may comprise one or more amino acid residues, such as 1 - 50, 1 - 20, 1 - 10, 1 - 9, 1 - 8, 1 - 7, 1 - 6, 1 - 5, 1 - 4, 1 - 3, 1 - 2 amino acid residues, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 amino acid residues.

[0060] The recombinant collagen described herein may also comprise an amino acid sequence of the following group or a variant thereof: the amino acid sequence shown in any one of SEQ ID NO:7 - 12. The variant includes an amino acid sequence obtained by substitution, insertion, deletion or addition of one or more amino acids based on SEQ ID NO:7 - 12, wherein the substitution may be a conservative substitution. The variant includes an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identity with SEQ ID NO:7 - 12.

[0061] Nucleic acid construct The present invention also relates to a nucleic acid construct comprising the nucleic acid of the present invention operably linked to one or more control sequences which, under conditions compatible with the control sequences, direct the expression of the coding sequence in a suitable host cell. A vector may comprise the nucleic acid construct.

[0062] The nucleic acid can be manipulated in a variety of ways to provide for the expression of a polypeptide, such as collagen. Depending on the expression vector, it may be desirable or necessary to manipulate the nucleic acid prior to its insertion into the vector. Techniques for modifying nucleic acids using recombinant DNA methods are well known in the art.

[0063] The control sequence may be a promoter, i.e., a polynucleotide that is recognized by a host cell for expressing a polynucleotide encoding a polypeptide of the present invention, such as collagen. The promoter contains transcriptional control sequences that mediate the expression of the polypeptide, such as collagen. The promoter can be any nucleic acid that exhibits transcriptional activity in the host cell, including variant, truncated, and hybrid promoters, and can be obtained from genes encoding extracellular or intracellular polypeptides, such as collagen, that are homologous or heterologous to the host cell.

[0064] Examples of suitable promoters for directing transcription of the vectors or nucleic acid constructs of the present invention in bacterial host cells are promoters obtained from the following: Bacillus amyloliquefaciens α-amylase gene (amyQ), Bacillus licheniformis α-amylase gene (amyL), Bacillus licheniformis penicillinase gene (penP), Bacillus stearothermophilus malt amylase gene (amyM), Bacillus subtilis fructan sucrase gene (sacB), Bacillus subtilis xylA and xylB genes, Bacillus thuringiensis cryIIIA gene, Escherichia coli lac operon, Escherichia coli trc promoter.

[0065] In yeast hosts, useful promoters are obtained from the following genes: Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae galactokinase (GAL1), Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH1, ADH2 / GAP), Saccharomyces cerevisiae triose phosphate isomerase (TPI), Saccharomyces cerevisiae metallothionein (CUP1), and Saccharomyces cerevisiae 3-phosphoglycerate kinase.

[0066] The control sequence may also be a transcriptional terminator recognized by the host cell to terminate transcription. The terminator is operably linked to the 3'-end of the polynucleotide encoding the polypeptide, such as collagen. Any terminator that is functional in the host cell can be used in the present invention.

[0067] Preferred terminators for bacterial host cells are obtained from the following genes: Bacillus clausii alkaline protease (aprH), Bacillus licheniformis α-amylase (amyL), and Escherichia coli ribosomal RNA (rrnB).

[0068] Preferred terminators for yeast host cells are obtained from the following genes: Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), and Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al. (1992, supra).

[0069] The control sequence can also be an mRNA stabilizing region downstream of the promoter and upstream of the coding sequence of the gene, which enhances the expression of the gene.

[0070] Examples of suitable mRNA stabilizing regions are obtained from the following genes: the Bacillus thuringiensis cryIIIA gene (WO94 / 25612) and the Bacillus subtilis SP82 gene (Hue et al., 1995, Journal of Bacteriology 177:3465-3471).

[0071] The control sequence may also be a leader sequence, i.e., an untranslated region of an mRNA that is important for translation in the host cell. The leader sequence is operably linked to the 5'-end of the polynucleotide encoding the polypeptide. Any leader sequence that is functional in the host cell may be used.

[0072] Suitable leader sequences for yeast host cells are obtained from the following genes: Saccharomyces cerevisiae enolase (ENO-1), Saccharomyces cerevisiae 3-phosphoglycerate kinase, Saccharomyces cerevisiae alpha-factor, and Saccharomyces cerevisiae alcohol dehydrogenase / glyceraldehyde-3-phosphate dehydrogenase (ADH2 / GAP).

[0073] The control sequence may also be a polyadenylation sequence, a sequence that is operably linked to the 3'-end of the polynucleotide and that, when transcribed, is recognized by the host cell as a signal to add polyadenylate residues to the transcribed mRNA. Any polyadenylation sequence that is functional in the host cell may be used.

[0074] A useful polyadenylation sequence for yeast host cells is described by Guo and Sherman, 1995, Mol. Cellular Biol. 15:5983-5990.

[0075] The control sequence may also be a signal peptide coding region that encodes a signal peptide linked to the N-terminus of a polypeptide (such as collagen) and directs the polypeptide into the secretory pathway of the cell. The 5'-end of the coding sequence of the polynucleotide may itself contain a signal peptide coding sequence that is naturally linked in the translation reading frame to a coding sequence segment encoding a polypeptide (such as collagen). Alternatively, the 5'-end of the coding sequence may contain a signal peptide coding sequence that is foreign to the coding sequence. In cases where the coding sequence does not naturally contain a signal peptide coding sequence, a foreign signal peptide coding sequence may be required. Alternatively, the foreign signal peptide coding sequence may simply replace the native signal peptide coding sequence in order to enhance polypeptide secretion. However, any signal peptide coding sequence that directs the expressed polypeptide (such as collagen) into the secretory pathway of the host cell may be used.

[0076] The effective signal peptide coding sequences of bacterial host cells are signal peptide coding sequences obtained from the following genes: Bacillus NCIB 11837 maltogenic amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus alpha-amylase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Additional signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57:109-137.

[0077] Useful signal peptides of yeast host cells are obtained from the following genes: Saccharomyces cerevisiae alpha-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding sequences are described by Romanos et al. (1992, ibid.).

[0078] Expression vector The present invention also relates to recombinant expression vectors comprising the nucleic acid, promoter, and transcriptional and translational termination signals of the present invention. The nucleic acid and control sequences can be ligated together to produce a recombinant expression vector which may include one or more convenient restriction sites to enable insertion or substitution of a polynucleotide encoding the polypeptide (such as collagen) at such sites. Alternatively, the polynucleotide can be expressed by inserting the nucleic acid or a nucleic acid construct comprising the nucleic acid into an appropriate vector for expression. When producing an expression vector, the coding sequence is positioned in the vector such that the coding sequence is operably linked to the appropriate control sequences for expression.

[0079] The recombinant expression vector can be any vector (e.g., plasmid or virus) that can be conveniently subjected to recombinant DNA procedures and can cause the expression of a polynucleotide. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector can be a linear or closed circular plasmid.

[0080] The vector can be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, whose replication is independent of chromosomal replication, such as a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector can contain any means for ensuring self-replication. Alternatively, the vector can be a vector that integrates into the genome when introduced into the host cell and replicates with one or more chromosomes into which it has been integrated. Moreover, a single vector or plasmid or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of the host cell can be used, or a transposon can be used.

[0081] The vector preferably contains one or more selectable markers that allow for the convenient selection of cells such as transformed cells, transfected cells, transduced cells, etc. A selectable marker is a gene whose product provides biocide resistance or virus resistance, heavy metal resistance, prototrophy for auxotrophs, etc.

[0082] Examples of bacterial selectable markers are the dal genes of Bacillus licheniformis or Bacillus subtilis, or markers that confer antibiotic resistance such as ampicillin, chloramphenicol, kanamycin, neomycin, spectinomycin, or tetracycline resistance. Suitable markers for yeast host cells include, but are not limited to: ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3.

[0083] The selectable marker can be a dual selectable marker system as described in WO 2010 / 039889. In one aspect, the dual selectable marker is the hph-tk dual selectable marker system.

[0084] The vector can contain elements that allow the vector to integrate into the genome of the host cell or to replicate autonomously in the cell independently of the genome. For integration into the genome of the host cell, the vector can rely on a polynucleotide sequence encoding the polypeptide (such as collagen) or any other element of the vector for integration into the genome by homologous or non-homologous recombination. Alternatively, the vector can contain additional polynucleotides for directing integration into the precise location in the chromosome of the host cell genome by homologous recombination. To increase the likelihood of integration at the precise location, the integration element should contain a sufficient number of nucleic acids, such as 100 to 10,000 base pairs, 400 to 10,000 base pairs, and 800 to 10,000 base pairs, which have a high sequence identity with the corresponding target sequence to enhance the probability of homologous recombination. The integration element can be any sequence homologous to the target sequence within the host cell genome. Moreover, the integration element can be a non-coding or coding polynucleotide. On the other hand, the vector can integrate into the genome of the host cell by non-homologous recombination.

[0085] For autonomous replication, the vector can further contain an origin of replication that enables the vector to replicate autonomously in the host cell under discussion. The origin of replication can be any plasmid replicon that functions in the cell to mediate autonomous replication. The term "origin of replication" or "plasmid replicon" refers to a polynucleotide that enables a plasmid or vector to replicate in vivo.

[0086] Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, and pACYC184 that allow replication in Escherichia coli, and the origins of replication of plasmids pUB110, pE194, pTA1060, and pAMβ1 that allow replication in Bacillus spp.

[0087] Examples of origins of replication for use in yeast host cells are the 2 micron origin of replication, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.

[0088] More than one copy of the polynucleotide of the present invention can be inserted into a host cell to increase the production of a polypeptide, such as collagen. An increased copy number of the polynucleotide can be obtained by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene together with the polynucleotide, wherein cells containing the amplified copy of the selectable marker gene and thus an additional copy of the polynucleotide can be selected by culturing the cells in the presence of an appropriate selective reagent.

[0089] Procedures for ligating the above-described elements to construct the recombinant expression vectors of the present invention are well known to those of ordinary skill in the art (see, for example, Sambrook et al., 1989).

[0090] Host cell The present invention also relates to recombinant host cells that comprise a polynucleotide of the present invention operably linked to one or more control sequences that direct the production of a polypeptide of the present invention, such as collagen. A construct or vector containing the polynucleotide is introduced into a host cell such that the construct or vector is maintained as a chromosomal integrant or as an autonomously replicating extrachromosomal vector, as described earlier. The term "host cell" encompasses any progeny of a parent cell that are not identical to the parent cell due to mutations that occur during replication. The choice of host cell will to a large extent depend on the gene encoding the polypeptide, such as collagen, and its source.

[0091] The host cell can be any cell useful in the recombinant production of a polypeptide of the present invention, such as collagen, e.g., a prokaryotic or eukaryotic cell.

[0092] Prokaryotic host cells can be any Gram-positive or Gram-negative bacterium. Gram-positive bacteria include, but are not limited to: Bacillus, Clostridium, Enterococcus, Geobacillus, Lactobacillus, Lactococcus, Oceanobacillus, Staphylococcus, Streptococcus, and Streptomyces. Gram-negative bacteria include, but are not limited to: Campylobacter, Escherichia coli, Flavobacterium, Fusobacterium, Helicobacter, Ilyobacter, Neisseria, Pseudomonas, Salmonella, and Ureaplasma.

[0093] The host cell can also be a eukaryote, such as a mammalian, insect, plant, or fungal cell. Plant cells herein do not include plant cells that can be regenerated into plants. Animal cells also do not include cells that can produce an animal body.

[0094] The host cell can be a fungal cell, such as a cell of Basidiomycota, Chytridiomycota, Zygomycota, and Oomycota. The fungal host cell can be a yeast cell, including ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to Fungi Imperfecti (Blastomycetes). The yeast host cell can be a cell of Candida, Hansenula, Kluyveromyces, Pichia, Saccharomyces, Schizosaccharomyces, or Yarrowia, such as Kluyveromyces lactis, Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis, Saccharomyces oviformis, or Yarrowia lipolytica cell.

[0095] Production method The present invention also relates to the production of the collagen described herein, which comprises: (1) culturing the host cell described herein under suitable culture conditions; (2) harvesting the host cell and / or culture medium containing the collagen; and (3) purifying the collagen.

[0096] The host cells are cultured in a suitable nutrient medium using methods known in the art for producing polypeptides such as collagen. For example, the cells can be cultured by shake flask culture, or by small-scale or large-scale fermentation (including continuous, batch, fed-batch, or solid state fermentation) in a laboratory or industrial fermenter. The culture is carried out in a suitable medium and under conditions that allow for the expression and / or isolation of the polypeptide such as collagen. Using procedures known in the art, the culture takes place in a suitable nutrient medium containing a carbon and nitrogen source and inorganic salts. Suitable media are available from commercial suppliers or can be prepared according to published compositions (e.g., in the catalog of the American Type Culture Collection).

[0097] Methods known in the art can be used to recover collagen. For example, the polypeptide such as collagen can be recovered from the nutrient medium by conventional procedures including, but not limited to, collection, centrifugation, filtration, extraction, spray drying, evaporation, or precipitation. In one aspect, the fermentation broth containing collagen is recovered.

[0098] Collagen can be purified by a variety of procedures known in the art, including but not limited to chromatography (e.g., ion exchange chromatography, affinity chromatography, hydrophobic chromatography, focusing chromatography, and size exclusion chromatography), electrophoretic procedures (e.g., preparative isoelectric focusing electrophoresis), differential solubility (e.g., ammonium sulfate precipitation), SDS-PAGE, or extraction, in order to obtain substantially pure collagen.

[0099] Step (1) can include one or more of the following steps: constructing an expression plasmid, for example, inserting a coding nucleotide sequence into the pET-28a-Trx-His expression vector to obtain a recombinant expression plasmid. The successfully constructed expression plasmid can be transformed into Escherichia coli cells (e.g., Escherichia coli competent cells BL21(DE3)). The specific process can be as follows: (1) Take the plasmid to be transformed and add it to Escherichia coli competent cells BL21(DE3); (2) Place the mixture on ice for an ice bath (e.g., 10 - 60 min, e.g., 30 min), then perform a heat shock in a water bath (e.g., at 40 - 50 °C, e.g., 42 °C, for 45 - 90 s), and after taking it out, place it on ice for an ice bath (e.g., 1 - 5 min, e.g., 2 min); (3) Add liquid LB medium and then culture (e.g., culture at 35 - 40 °C, e.g., 37 °C, at 150 - 300 rpm, e.g., 220 rpm for 40 - 80 min, e.g., 60 min); (4) Spread the bacterial solution and pick single colonies. For example, take the bacterial solution and spread it evenly on an LB plate containing sodium ampicillin, and culture the plate in an incubator at 37 °C for 15 - 17 h until colonies of uniform size grow.

[0100] Step (2) may include culturing the single colony in an LB medium containing an antibiotic stock solution (for example, at 150 - 300 rpm, such as 220 rpm, at 35 - 40 °C, such as 37 °C in a constant temperature shaker for 5 - 10 h, such as 7 h). Then cool the culture flask to 10 - 20 °C, such as 16 °C, add IPTG to induce expression for a period of time and then collect the bacterial cells (for example, by centrifugation).

[0101] Step (3) may include resuspending the bacterial cells with a balanced working solution, cooling the bacterial solution to ≤15 °C, and performing homogenization (for example, high-pressure homogenization, for example, 1 - 5 times, such as 2 times). The supernatant is separated from the homogenized bacterial solution. The balanced working solution may contain 100 - 500 mM sodium chloride, 10 - 50 mM Tris, and 10 - 50 mM imidazole, with a pH of 7 - 9. For example, the concentration of sodium chloride may be 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480 or 490 mM. The concentration of Tris may be 10, 15, 20, 25, 30, 35, 40, 45 or 50 mM. The concentration of imidazole may be 10, 15, 20, 25, 30, 35, 40, 45 or 50 mM. The pH may be 7, 7.5, 8, 8.5 or 9.

[0102] Step (3) may include purifying and enzymatically cleaving the collagen. The purification may be crude purification, including purifying the supernatant with a Ni-agarose gel column to obtain an eluate containing the target protein. The crude purification may include washing the column material, such as 2 - 10 column volumes (CV), such as 5 CV. The column material may be equilibrated with an equilibration solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), such as 2 - 10 CV, such as 5 CV. The equilibration solution may contain 100 - 500 mM sodium chloride, 10 - 50 mM Tris, and 10 - 50 mM imidazole, pH 7 - 9. For example, the concentration of sodium chloride may be 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, or 490 mM. The concentration of Tris may be 10, 15, 20, 25, 30, 35, 40, 45, or 50 mM. The concentration of imidazole may be 10, 15, 20, 25, 30, 35, 40, 45, or 50 mM. The pH may be 7, 7.5, 8, 8.5, or 9.

[0103] Step (3) may include adding the supernatant to the column material and washing the impurity proteins with a washing solution. The washing solution may contain 100 - 500 mM sodium chloride, 10 - 50 mM Tris, and 10 - 50 mM imidazole, with a pH of 7 - 9. For example, the concentration of sodium chloride may be 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, or 490 mM. The concentration of Tris may be 10, 15, 20, 25, 30, 35, 40, 45, or 50 mM. The concentration of imidazole may be 10, 15, 20, 25, 30, 35, 40, 45, or 50 mM. The pH may be 7, 7.5, 8, 8.5, or 9. Then, an elution solution may be added and the flow-through fraction may be collected. The elution solution may contain 100 - 500 mM sodium chloride, 10 - 50 mM Tris, 100 - 500 mM imidazole, with a pH of 8.0. For example, the concentration of sodium chloride may be 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, or 490 mM. The concentration of Tris may be 10, 15, 20, 25, 30, 35, 40, 45, or 50 mM. The concentration of imidazole may be 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, or 490 mM. The pH may be 7, 7.5, 8, 8.5, or 9.

[0104] The enzymatic cleavage may include adding TEV protease for cleavage (at a ratio of the total protein amount to the total amount of TEV protease of 10 - 100:1, such as 50:1, at 10 - 20 °C, such as 16 °C for 2 - 8 h, such as 4 h). Dialyze the protein solution after enzymatic cleavage, for example, put it into a dialysis bag and dialyze at 1 - 6 °C, such as 4 °C for 1 - 8 h, such as 2 h, and then transfer it to a new dialysis solution and dialyze overnight at 1 - 6 °C, such as 4 °C.

[0105] Purification may include fine purification (for example, the isoelectric point of the protein > 8.0). Preferably, fine purification includes gradient elution of the eluate containing the target protein (such as collagen) or the product after enzymatic digestion (for example, the product after enzymatic digestion and dialysis) using a strong anion exchange chromatography column (for example, the pH can be 7, 7.5, 8, 8.5, or 9). The gradient elution includes 0 - 15% solution B for 1 - 5 minutes and then holding for 1 - 5, for example, 3 column volumes, 15 - 30% solution B for 1 - 5 minutes and then holding for 1 - 5, for example, 3 column volumes, 30 - 50% solution B for 1 - 5 minutes and then holding for 1 - 5, for example, 3 column volumes, 50 - 100% solution B for 1 - 5 minutes and then holding for 1 - 5, for example, 3 column volumes. Solution B may contain 10 - 50 mM Tris, 0.5 - 5 M sodium chloride, pH 7 - 9. For example, the concentration of Tris is 15, 20, 25, 30, 35, 40, or 45 mM. The concentration of sodium chloride is 1, 2, 3, or 4 M. The pH can be 7, 7.5, 8, 8.5, or 9. Fine purification may include equilibrating the column material with solution A and loading the sample, and then gradient elution. Solution A may contain 10 - 50 mM Tris, 10 - 50 mM sodium chloride, pH 7 - 9. For example, the concentration of Tris is 15, 20, 25, 30, 35, 40, or 45 mM. The concentration of sodium chloride is 15, 20, 25, 30, 35, 40, or 45 mM. The pH can be 7, 7.5, 8, 8.5, or 9.

[0106] Purification may include purification using a reversed nickel column (for example, the isoelectric point of the protein < 8.0). Purification using a reversed nickel column may include purifying the product after enzymatic digestion (for example, the product after dialysis) on a Ni - agarose gel column. The eluate may contain 10 - 50 mM (for example, 15, 20, 25, 30, 35, 40, or 45 mM) Tris, 10 - 50 mM (for example, 15, 20, 25, 30, 35, 40, or 45 mM) sodium chloride, 0.5 - 5 M (for example, 1, 2, 3, or 4 M) imidazole, pH 7 - 9 (for example, 7, 7.5, 8, 8.5, or 9).

[0107] This application also provides the following embodiments: Embodiment 1. Collagen, which contains one or more repeating units, directly or connected through a linker between the repeating units, and the repeating units contain the amino acid sequence shown in SEQ ID NO: 2 or 6 or a variant thereof.

[0108] Embodiment 2. The collagen according to Embodiment 1, wherein the variant is an amino acid sequence obtained by substitution, insertion, deletion, and / or addition of one or more, for example, 1-15 amino acids based on SEQ ID NO: 2 or 6; preferably, the variant includes an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with SEQ ID NO: 2 or 6.

[0109] Embodiment 3. The collagen according to Embodiment 1 or 2, wherein the repeating unit is composed of the amino acid sequence shown in any one of SEQ ID NO: 1-6; more preferably, the repeating unit is composed of the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0110] Embodiment 4. The collagen according to any one of Embodiments 1-3, wherein the plurality of repeating units is 2-50 repeating units, for example, 2-45, 2-40, 2-35, 2-30, 2-25, 2-20, 2-15, 2-10, 2-8, or 2-6 repeating units; preferably, the collagen is recombinant collagen; preferably recombinant type II collagen; preferably recombinant humanized type II collagen; preferably, the collagen has antiviral activity.

[0111] Embodiment 5. The collagen according to any one of Embodiments 1-4, which comprises the amino acid sequence shown in any one of SEQ ID NO: 7-12 or a variant thereof; the variant includes an amino acid sequence obtained by substitution, insertion, deletion, or addition of one or more amino acids based on the amino acid sequence shown in any one of SEQ ID NO: 7-12 or includes an amino acid sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity with any one of SEQ ID NO: SEQ ID NO: 7-12.

[0112] Embodiment 6. A nucleic acid encoding the collagen according to any one of Embodiments 1-5; preferably, the nucleic acid comprises a codon-optimized nucleotide sequence; preferably, the nucleic acid comprises a nucleotide sequence codon-optimized for E. coli expression; preferably, the nucleic acid comprises a nucleotide sequence shown in any one of SEQ ID NOs: 13-18, or its degenerate sequence, or a nucleotide sequence having at least 85%, 90%, 95%, 96%, 97%, 98%, 99% or more identity to any one of SEQ ID NOs: 13-18.

[0113] Embodiment 7. A vector comprising the nucleic acid according to Embodiment 6; preferably, the vector comprises an expression control element, a nucleotide of a purification tag and / or a nucleotide of a leader sequence operably linked to the nucleic acid; preferably, the expression control element is selected from a promoter, a terminator or an enhancer; preferably, the purification tag is selected from a His tag, a GST tag, an MBP tag, a SUMO tag or a NusA tag; preferably, the vector is an expression vector or a cloning vector, preferably pET-28a(+).

[0114] Embodiment 8. A host cell comprising the nucleic acid according to Embodiment 6 or the vector according to Embodiment 7; preferably, the host cell is a eukaryotic cell or a prokaryotic cell; preferably, the eukaryotic cell is a yeast cell, an animal cell and / or an insect cell; preferably, the prokaryotic cell is an E. coli cell, such as E. coli BL21.

[0115] Embodiment 9. A method for producing the collagen according to any one of Embodiments 1-5, characterized by comprising the following steps: (1) Culturing the host cell according to Embodiment 8 under suitable culture conditions; (2) Harvesting the host cell and / or the culture medium containing the collagen; and (3) Purifying the collagen.

[0116] Embodiment 10. A composition, characterized by comprising the collagen according to any one of Embodiments 1-5, the nucleic acid according to Embodiment 6, the carrier according to Embodiment 7, and / or the host cell according to Embodiment 8; preferably, the composition is a pharmaceutical composition, a medical device, a tissue engineering product, a cosmetic or a health product; preferably, the composition is one or more of a biological dressing, a human biomimetic material, a plastic and aesthetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological and obstetric biological material, a nerve repair and regeneration material, a liver tissue material and a blood vessel repair and regeneration material, a 3D printing artificial organ biological material, a cosmetic raw material, a pharmaceutical excipient and a food additive; preferably, the composition comprises a pharmaceutically and / or cosmetically acceptable carrier; Preferably, the composition is a solid, liquid or gel composition; preferably, the composition is a composition for oral and / or topical administration, preferably a smear composition; preferably, the composition is a human lubricant, a vaginal gel or a condom lubricant; preferably, the composition is a kit; preferably, the composition is a liquid formulation, which comprises the collagen according to any one of Embodiments 1-5 and a pharmaceutically and / or cosmetically acceptable carrier; preferably, the carrier is a buffer, such as D-PBS buffer or PBS buffer.

[0117] Embodiment 11. Use of the collagen according to any one of Embodiments 1-5, the nucleic acid according to Embodiment 6, the carrier according to Embodiment 7, the host cell according to Embodiment 8, and the composition according to Embodiment 10 in the preparation of a product for preventing and / or treating viral infection or a disease caused by viral infection; preferably, the product is a medical device, a pharmaceutical composition, a tissue engineering product, a cosmetic or a health product; preferably, the product is one or more of a biological dressing, a human biomimetic material, a plastic and aesthetic material, an organoid culture material, a cardiovascular stent material, a coating material, a tissue injection filling material, an ophthalmic material, a gynecological and obstetric biological material, a nerve repair and regeneration material, a liver tissue material and a blood vessel repair and regeneration material, a 3D printing artificial organ biological material, a cosmetic raw material, a pharmaceutical excipient and a food additive; preferably, the composition is a human lubricant, a vaginal gel or a condom lubricant; preferably, the virus is HPV or HIV; preferably, the HPV is of types 16, 18, 31, 33, 35, 45, 52, 58 and / or 59; preferably, the disease caused by viral infection is cervical neoplasia, condyloma acuminata or cervical cancer; preferably, the disease caused by viral infection is AIDS.

[0118] Embodiment 12. A method for inhibiting viral infection in vitro, characterized by comprising contacting a cell with the collagen according to any one of Embodiments 1-5, or the composition according to Embodiment 10; preferably, the virus is HPV or HIV; preferably, the inhibition includes inhibiting the entry of HIV or HPV into target cells.

[0119] Embodiment 13. Use of the collagen according to any one of Embodiments 1-5, the nucleic acid according to Embodiment 6, the vector according to Embodiment 7, the host cell according to Embodiment 8, the composition according to Embodiment 10 in combination with a second therapeutic agent in the preparation of a drug for preventing and / or treating viral infection or a disease caused by viral infection; preferably, the virus is HPV or HIV; preferably, the HPV is of types 16, 18, 31, 33, 35, 45, 52, 58 and / or 59; preferably, the disease caused by viral infection is cervical neoplasia, condyloma acuminata or cervical cancer; preferably, the disease caused by viral infection is AIDS; preferably, when the virus is HPV, the second therapeutic agent is selected from one or more of fluorouracil, imiquimod, podophyllotoxin, interferon, ganciclovir, acyclovir, imiquimod and podophyllotoxin; preferably, when the virus is HIV, the second therapeutic agent is selected from one or more of lamivudine, zidovudine, tenofovir, emtricitabine, nevirapine, efavirenz, ritonavir, indinavir.

[0120] Examples The following examples are provided to illustrate the present invention. Those skilled in the art should understand that the examples are merely illustrative and not restrictive. The present invention is only limited by the scope of the appended implementation description.

[0121] Example 1 Construction, expression and screening of humanized type II collagen fragments 1.1 Large-scale functional region screening was carried out to obtain the following target gene functional regions of humanized type II collagen.

[0122] Collagen II-1 Amino acid sequence of Collagen II-1 (SEQ ID NO: 7) GEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPPGEPGLQGPAGPPGEKGEPGDDGPSGAEGPP Collagen II-1 repeat unit R1P5 (SEQ ID NO: 1) GEPGLQGPAGPPGEKGEPGDDGPSGAEGPP.

[0123] Collagen II-1 nucleotide sequence (SEQ ID NO: 13) GGTGAGCCTGGGCTCCAAGGTCCTGCTGGTCCCCCGGGTGAAAAGGGTGAACCAGGTGATGACGGTCCATCAGGTGCTGAAGGACCCCCTGGGGAGCCCGGACTTCAGGGTCCAGCTGGGCCCCCAGGAGAGAAAGGCGAGCCCGGGGATGATGGTCCATCCGGTGCTGAAGGTCCACCAGGTGAACCTGGCCTACAAGGACCCGCAGGGCCTCCAGGTGAAAAGGGTGAGCCAGGTGACGACGGTCCATCTGGTGCTGAAGGTCCACCCGGAGAGCCCGGTTTGCAAGGTCCAGCCGGTCCTCCCGGTGAGAAAGGGGAACCGGGGGATGACGGTCCATCTGGTGCGGAAGGTCCACCAGGCGAACCTGGTCTACAAGGTCCAGCTGGTCCTCCAGGTGAAAAGGGTGAACCTGGTGACGATGGACCATCTGGTGCTGAGGGGCCACCCGGGGAGCCCGGTCTCCAGGGGCCCGCGGGACCCCCTGGCGAAAAGGGTGAGCCGGGTGATGATGGGCCTTCCGGTGCTGAAGGTCCACCTGGGGAACCAGGTTTGCAAGGTCCAGCCGGTCCGCCTGGCGAGAAAGGTGAGCCCGGTGACGACGGGCCTAGTGGTGCCGAAGGCCCGCCAGGGGAGCCAGGCTTACAGGGACCAGCGGGCCCTCCTGGCGAAAAGGGTGAACCAGGTGACGATGGTCCTTCCGGGGCGGAAGGTCCTCCGGGAGAACCTGGACTGCAAGGTCCAGCCGGTCCACCCGGAGAAAAGGGTGAGCCTGGAGATGACGGCCCGAGCGGTGCTGAAGGTCCCCCG Collagen II-2

[0124] Amino acid sequence of Collagen II-2 (SEQ ID NO:8) GTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAKGTPGLPGVKGHRGYPGLDGAK The repeating unit of collagen II-2 is GTPGLPGVKGHRGYPGLDGAK (SEQ ID NO: 2).

[0125] The nucleotide sequence of collagen II-2 (SEQ ID NO: 14) TC2J2

[0126] Amino acid sequence of TC2J2 (SEQ ID NO: 9) GDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAE TC2J2 repeat unit (SEQ ID NO: 3) GDSGPPGRAGEPGLQGPAGPPGEKGEPGDDGPSGAE Nucleotide sequence of TC2J2 (SEQ ID NO: 15) TC2J3

[0127] Amino acid sequence of TC2J3 (SEQ ID NO: 10) GRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAEGRAGEPGLQGPAGPPGEKGEPGDDGPSGAE The repeating unit of TC2J3 is GRAGEPGLQGPAGPPGEKGEPGDDGPSGAE (SEQ ID NO: 4) Nucleotide sequence of TC2J3 (SEQ ID NO: 16) GGGAGGGCTGGAGAGCCGGGTCTCCAAGGCCCGGCTGGCCCACCGGGTGAGAAAGGTGAACCGGGCGACGACGGCCCGTCGGGTGCTGAAGGTCGTGCGGGTGAACCGGGACTGCAGGGTCCGGCGGGCCCACCGGGTGAAAAGGGCGAACCGGGTGATGATGGTCCGTCTGGCGCAGAGGGCCGTGCGGGTGAGCCGGGTTTGCAGGGTCCGGCTGGACCGCCTGGTGAGAAAGGTGAGCCGGGCGACGACGGCCCTTCCGGTGCGGAAGGTCGCGCAGGCGAACCGGGGCTGCAAGGTCCGGCAGGTCCGCCAGGCGAAAAGGGTGAACCGGGGGATGATGGTCCGAGCGGCGCAGAAGGACGTGCCGGTGAGCCGGGCTTGCAAGGTCCGGCGGGCCCACCGGGCGAGAAGGGTGAGCCGGGCGATGACGGTCCGAGCGGTGCAGAAGGTCGTGCTGGCGAGCCGGGCTTACAAGGTCCGGCAGGTCCACCGGGCGAAAAAGGCGAGCCGGGCGACGACGGTCCGAGCGGTGCGGAAGGCAGAGCCGGTGAACCGGGGCTGCAGGGTCCGGCGGGTCCACCGGGCGAAAAGGGCGAGCCGGGCGACGACGGTCCGAGCGGTGCGGAAGGTCGTGCTGGCGAGCCGGGCCTGCAGGGTCCGGCGGGCCCACCGGGCGAGAAAGGCGAGCCGGGTGACGACGGCCCGAGCGGTGCCGAGGGCCGCGCGGGTGAGCCGGGTCTGCAGGGTCCTGCTGGCCCTCCGGGCGAGAAAGGTGAGCCGGGCGATGATGGTCCGTCCGGTGCGGAAGGTCGCGCGGGAGAGCCGGGGCTGCAGGGCCCGGCGGGTCCGCCAGGTGAGAAGGGCGAACCGGGCGATGATGGCCCGTCTGGTGCCGAA TC2J4

[0128] Amino acid sequence of TC2J4 (SEQ ID NO: 11) GEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAEGEPGLQGPAGPPGEKGEPGDDGPSGAE The repeating unit of TC2J4 is GEPGLQGPAGPPGEKGEPGDDGPSGAE (SEQ ID NO: 5). The nucleotide sequence of TC2J4 (SEQ ID NO: 17) GGAGAACCCGGGTTGCAAGGTCCGGCGGGTCCGCCTGGCGAGAAAGGTGAGCCGGGTGACGATGGTCCGAGCGGTGCTGAGGGCGAGCCGGGCCTGCAAGGTCCGGCAGGTCCCCCGGGAGAGAAGGGTGAACCGGGTGACGATGGTCCGTCTGGTGCGGAAGGTGAACCGGGCCTGCAGGGTCCGGCGGGTCCGCCGGGTGAAAAGGGCGAACCGGGTGATGATGGTCCGTCCGGTGCCGAAGGTGAACCGGGCTTACAAGGTCCGGCAGGCCCACCGGGAGAGAAGGGTGAGCCGGGTGACGACGGTCCGTCCGGCGCGGAAGGCGAGCCGGGTCTGCAGGGTCCGGCAGGCCCGCCGGGTGAGAAAGGCGAACCGGGAGATGATGGTCCGAGCGGCGCGGAAGGTGAACCGGGCCTGCAGGGCCCGGCTGGCCCGCCAGGCGAAAAAGGCGAGCCAGGCGATGATGGTCCGAGCGGTGCGGAAGGTGAACCGGGTCTGCAGGGTCCGGCGGGCCCACCGGGCGAGAAGGGTGAGCCGGGTGACGACGGTCCGAGTGGCGCTGAGGGCGAGCCGGGCCTCCAGGGCCCGGCAGGCCCACCGGGAGAAAAAGGCGAGCCGGGCGACGACGGTCCGAGCGGTGCCGAAGGTGAGCCGGGCTTGCAAGGGCCAGCGGGTCCGCCTGGCGAGAAGGGCGAGCCGGGAGACGACGGCCCGTCGGGTGCCGAAGGTGAGCCGGGTTTGCAGGGTCCGGCTGGCCCGCCGGGTGAGAAAGGTGAACCGGGCGACGACGGCCCGAGCGGTGCGGAAGGCGAGCCGGGTCTGCAGGGTCCAGCGGGTCCTCCTGGCGAAAAGGGTGAGCCGGGTGACGATGGCCCGAGCGGCGCGGAGGGCGAACCGGGCCTGCAAGGCCCGGCTGGTCCACCGGGCGAGAAAGGCGAACCGGGTGATGATGGCCCGTCTGGCGCGGAA TC2J5

[0129] The amino acid sequence of TC2J5 (SEQ ID NO: 12) GPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAEGPAGPPGEKGEPGDDGPSGAE The repeating unit of TC2J5 is GPAGPPGEKGEPGDDGPSGAE (SEQ ID NO: 6) The nucleotide sequence of TC2J5 is shown in SEQ ID NO: 18 1.2 Construction of Recombinant Escherichia coli Strain The nucleotide sequence of humanized type II collagen was cloned into an expression vector, and then the expression vector was introduced into an Escherichia coli expression strain to screen for a recombinant Escherichia coli strain.

[0130] Specifically, according to the amino acid sequences of Collagen II-1 (SEQ ID NO: 7), Collagen II-2 (SEQ ID NO: 8), TC2J2 (SEQ ID NO: 9), TC2J3 (SEQ ID NO: 10), TC2J4 (SEQ ID NO: 11), and TC2J5 (SEQ ID NO: 12), the codon genes preferred by Escherichia coli (SEQ ID NO: 13-18) were optimized and selected. The synthesized nucleotide sequence. The humanized type II collagen gene fragment was inserted into the pET-32a expression vector (Beijing Liuhe Huada Gene Technology Co., Ltd.) through the restriction enzyme sites of Kpn I (product number of NEB: R0136L) and Xho I (product number of NEB: R0146L) to construct the pET-32a expression vector. The expression vector was introduced into Escherichia coli BL21(DE3), and a positive recombinant Escherichia coli strain was screened. The above operations were entrusted to Beijing Liuhe Huada Gene Technology Co., Ltd.

[0131] 1.3 Fermentation Culture of Recombinant Escherichia coli Strain The successfully constructed expression plasmid was transformed into Escherichia coli competent cell BL21(DE3). The specific process is as follows: (1). Take Escherichia coli competent cell BL21(DE3) out of the ultra-low temperature refrigerator and place it on ice. Take 2 μl of the plasmid to be transformed and add it to the competent cell BL21(DE3), and mix gently 2-3 times.

[0132] (2). Place the mixture on ice for 30 min, then perform heat shock in a 42 °C water bath for 45-90 s, take it out and place it on ice for 2 min.

[0133] (3). Transfer it to a biosafety cabinet, add 700 μl of liquid LB medium, and then culture it at 37 °C and 220 rpm for 60 min.

[0134] (4). Take 200 μl of the bacterial solution and spread it evenly on an LB plate containing sodium ampicillin.

[0135] (5). Incubate the plate in an incubator at 37 °C for 15-17 h until colonies of uniform size grow.

[0136] (6). Pick 5 - 6 single colonies from the transformed LB plates into a shake flask containing LB medium with antibiotic stock solution, and incubate in a constant temperature shaker at 220 rpm and 37 °C for 7 h. Then cool the shake flask after incubation to 16 °C, add IPTG for induction expression for a period of time, aliquot the bacterial solution into centrifuge bottles, centrifuge at 8000 rpm and 4 °C for 10 min, collect the bacterial cells, record the weight of the bacterial cells, and take samples for electrophoresis detection.

[0137] (7). Resuspend the collected bacterial cells with the equilibration working solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), cool the bacterial solution to ≤15 °C, and perform homogenization, homogenize twice under high pressure, and collect the bacterial solution after completion. Aliquot the homogenized bacterial solution into centrifuge bottles, centrifuge at 17000 rpm and 4 °C for 30 min, collect the supernatant, take the supernatant and the precipitate for electrophoresis detection, and the humanized type II collagen is located in the supernatant.

[0138] (8) Purify and digest the humanized type II collagen obtained in step (7). The specific process is as follows: (1) Coarse purification: a. Wash the column material (Ni6FF, Cytiva) with water, 5 column volumes (CV). b. Equilibrate the column material with the equilibration buffer (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole, pH 8.0), 5 CV. c. Loading: Add the supernatant after centrifugation to the column material. After the liquid has drained completely, take the flow-through for electrophoresis inspection. d. Wash away impurities: Add 25 mL of the impurity washing solution (200 mM sodium chloride, 25 mM Tris, 20 mM imidazole) until the liquid has drained completely, and take the flow-through of the impurity washing for electrophoresis inspection. e. Collect the target protein: Add 20 mL of the elution buffer (200 mM sodium chloride, 25 mM Tris, 250 mM imidazole, pH 8.0), and collect the flow-through. Detect the protein concentration, calculate the protein amount, and perform electrophoresis detection. f. Wash the column material with 1 M imidazole working solution. g. Wash the column material with purified water. (2) Digestion: Add TEV enzyme according to the ratio of the total protein amount to the total amount of TEV enzyme of 50:1, and digest at 16 °C for 4 h. Take samples for electrophoresis detection. Put the digested protein solution into a dialysis bag, dialyze at 4 °C for 2 h, and then transfer it to a new dialysis solution for overnight dialysis at 4 °C. (3) Fine purification: a. Equilibrate the column material (Ni6FF, Cytiva): Equilibrate the column material with solution A (20 mM Tris, 20 mM sodium chloride, pH 8.0) at a flow rate of 10 ml / min. b. Loading: Load at a flow rate of 5 ml / min, collect the flow-through, and perform electrophoresis detection. c. Gradient elution: Set 0-15% solution B (20 mM Tris, 1 M sodium chloride, pH 8.0) for 2 min and then hold for 3 CV, 15-30% solution B for 2 min and then hold for 3 CV, 30-50% solution B for 2 min and then hold for 3 CV, 50-100% solution B for 2 min and then hold for 3 CV. Collect the peaks and perform electrophoresis detection (for fine-purified protein). d. Wash the column material. Store the protein in an environment at 4 °C.

[0139] For accurate concentration detection, accurately measure an appropriate amount of the sample, dilute it 10-50 times with the elution buffer, and stir well with a glass rod. Measure the absorbance at 280 nm using a UV-visible spectrophotometer. According to the formula C (mg / mL) = A280 × extinction coefficient × dilution factor, calculate the protein concentration (note: the absorbance value should be between 0.1 and 1).

[0140] The specific process of electrophoresis detection is as follows: Take 40 μL of the sample solution, add 10 μL of 5× protein loading buffer (250 mM Tris-HCl (pH: 6.8), 10% SDS, 0.5% bromophenol blue, 50% glycerol, 5% β-mercaptoethanol), place it in boiling water at 100 °C for 10 min, then add 10 μl to each well of the SDS-PAGE protein gel. After running at 80 V for 2 h, perform protein staining with Coomassie Brilliant Blue staining solution (0.1% Coomassie Brilliant Blue R-250, 25% isopropanol, 10% glacial acetic acid) for 20 min, and then decolorize with protein decolorizing solution (10% acetic acid, 5% ethanol).

[0141] The experimental results are shown in Figures 1A - 1B . According to Figure 1A , it can be known that proteins with molecular weights of 24 kDa and 32 kDa are separated, which are consistent with the predicted molecular weights of 24253.14 and 32278.66 of humanized type II collagen II-1 and collagen II-2, indicating that collagen II-1 and collagen II-2 are correctly expressed. According to Figure 1B , it can be known that TC2J2, TC2J3, TC2J4, and TC2J5 are expressed, and the molecular weights are consistent with the expectations.

[0142] Example 2 Detection of the basic properties of collagen in recombinant humanized collagen 2.1 Detection of cell adhesion promoting activity (1) Add 100 μL of 0.5 mg / mL collagen II-1, collagen II-2, bovine type I collagen solution and blank PBS solution control to a 96-well plate, and let it stand at room temperature for 60 min.

[0143] (2) Add 10 5 well-grown NIH / 3T3 cells to each well and incubate at 37 °C for 60 min.

[0144] (3) Wash each well 3 times with PBS.

[0145] (4) Use an LDH detection kit (Roche product number 4744926001) to detect the absorbance at OD492nm. Taking the adhesion rate of bovine type I collagen as 1, the relative cell adhesion activity of the sample can be calculated.

[0146] The results are as Figure 2 shown. It can be seen that the cell adhesion promoting activities of recombinant humanized type II collagen II-1 and collagen II-2 are much higher than those of the control collagen.

[0147] 2.2 Detection of cell migration promoting activity (1)Pre-seed NIH / 3T3 cells in 48-well plates. After the cells reach confluence, use a 10 μL pipette tip to create uniform scratch wounds on the monolayer of cells. Wash the wounds 1-2 times with sterile PBS to ensure that there is no cell debris or residual suspended cells, which may affect subsequent experiments.

[0148] (2)Add Collagen II-1 at 1 mg / mL, Collagen II-2 at 1 mg / mL, and control collagen (commercially available type II collagen, Native Human Collagen II protein (ab134522) Application: ELISA, SDS-PAGE). Cells in the medium without drug addition are used as blank controls, and two parallel groups are set for each sample. Observe the closure of the scratch wounds at 0, 6, 12, and 24 hours.

[0149] (3)Calculate the scratch area. Obtain the percentage of the scratch closure rate through the following formula: Scratch closure rate (%) = (A0 - At) / A0 × 100%, where A0 is the scratch area at 0 h and At is the scratch area at the specified time.

[0150] Figure 3 and Figure 4 shows the scratch closure under the action of collagen. It can be seen that the scratch closure rates under the treatment of Collagen II-1 and Collagen II-2 increase with the treatment duration. At 24 h of treatment, the scratch closure rates of Collagen II-1 and Collagen II-2 are significantly higher than that of the control collagen. The results of this example indicate that Collagen II-1 and Collagen II-2 of the present invention have the ability to promote wound healing.

[0151] Example 3 Detection of antiviral activity of recombinant humanized collagen 3.1 Preparation of pseudovirus The pseudovirus system is commonly used for the evaluation of the effects of corresponding antiviral drugs. Its advantages are that it can be prepared based on transfection, the production process is relatively fast and inexpensive, and cell infectivity can be traced.

[0152] (1)One day before transfection, seed 293FT cells into a T-75 flask to make the cell density reach 70%-80%.

[0153] (2)Perform plasmid transfection according to the instructions of Lipofectamine 2000 reagent (Solarbio).

[0154] HPV pseudovirus is transfected into target cells using plasmid HPV 16 (addgene Plasmid #37320) and luciferase reporter plasmid (addgene Plasmid #37328) at a mass ratio of 1:1.

[0155] HIV pseudovirus packaging was carried out according to the mass ratio of 1:3 of the HIV envelope plasmid (addgene Plasmid#115809) and the NL4-3 (addgene Plasmid#44965) plasmid. After 12 hours, the cells were cultured in DMEM containing 2% fetal bovine serum (FBS) for another 36 hours.

[0156] (3) Collect the cells, suspend the cells in 0.5 mL of lysis buffer (Promega Madison), and incubate overnight at 37°C.

[0157] (4) Cool the lysate on ice for 15 minutes and centrifuge at 5000 rpm for 5 minutes at 4°C. The pseudovirus was purified by Optiprep gradient (Serumwerk Bernburg AG) ultracentrifugation (3.5 hours, 50000 rpm, 16°C, SW41 rotor).

[0158] (5) Store the stock solution of the pseudovirus in a siliconized microcentrifuge tube at -80°C.

[0159] 3.2 Detection of the antiviral activity of recombinant humanized collagen (1) Digest, centrifuge, and count the target cells such as Hela cells and U87 cells cultured the previous day.

[0160] (2) Inoculate 100 μL of 1×10 5 / well of Hela cells and U87 cells on a 96-well plate, and culture at 37°C, 5% CO 2 , 90% humidity for 24 hours.

[0161] (3) Observe the cell growth status and density under a microscope, and select the wells with good growth status and uniform cell distribution and density for the experiment.

[0162] (4) Continuously dilute the protein to be tested (collagen II-1, collagen II-2, control collagen) in serum-free DMEM from the initial target concentration (such as 10-0.07 mg / mL) by 2-fold dilution to a 50 μL system (such as for 2-fold dilution, pre-prepare 50 μL of serum-free DMEM in the wells except the first well, and prepare 100 μL of the drug at the target concentration in the first well. The dilution process starts from the second well, transfer 50 μL of the liquid from the previous well and mix evenly until the last well. For other dilution multiples, follow this method, and the dilution system is calculated as needed). After dilution, add an equal amount of the target pseudovirus and incubate at 37°C for 30 minutes.

[0163] (5) Add the incubation mixture in step (4) to the cells and incubate at 37°C for 16 hours.

[0164] (6) After washing with PBS, the cells were cultured in DMEM containing 2% fetal bovine serum (FBS) at 37 °C, 5% CO 2 2, 90% humidity for 72 hours.

[0165] (7) Use Promega cell lysis solution (Promega Madison) to lyse the cells according to the manufacturer's manual, and quantify the fluorescence intensity by microplate reader. Determine the infection status according to the measured values.

[0166] Figure 5 and 6 showed the virus inhibition rates of recombinant humanized collagen II-1, collagen II-2 and control collagen. The data shown in the figure indicated that collagen II-1 and collagen II-2 had typical antiviral activities, with inhibition rates higher than 90%, and there was an obvious dose-dependent effect. While the control collagen had no corresponding virus inhibition activity and no dose-dependent effect. It can be seen that the recombinant humanized collagen II-1 and collagen II-2 obtained through construction, expression and screening have the ability to block the entry of HIV and HPV into target cells.

[0167] Example 4 Recombinant humanized collagen cell incubation, washing and infection experiment Use collagen II-2 (diluted with DMEM medium) to incubate the target cells pre-cultured in a 96-well cell culture plate (10,000 cells per well, 100 μL of liquid volume per well) respectively; after incubating at 37 °C for 1 hour, discard the medium containing the sample, and wash the cells 3 times with DMEM medium; use HIV-1 pseudovirus to infect the washed cells; at the same time, use the pseudovirus premixed with collagen II-2 to infect the target cells as the control group for the conventional virus inhibition experiment; set 6 replicates for each sample, continue to culture the cells according to the conventional operation method of pseudovirus infection and calculate the virus inhibition rate. The virus inhibition rate calculation formula = [(average RLU of positive control - RLU of sample) / (average RLU of positive control - average RLU of blank control)] × 100%. The positive control is the fluorescence value of the well only infected with pseudovirus.

[0168] Collagen II-1 and collagen II-2 are basically the same in terms of mechanism. Therefore, collagen II-2 was used to verify the main action target of the expressed recombinant humanized type II collagen through Example 4, and to distinguish whether the recombinant humanized type II collagen acts on cells or on viruses. Figure 7The results showed that after incubation of collagen II-2 with cells and washing off collagen II-2, the target cells were still infected with the HIV virus, the HIV inhibition rate was less than 50% and there was no dose-dependent effect, indicating that the cells after washing off collagen II-2 could not prevent the virus from entering the cells, proving that the antiviral activity of the recombinant humanized type II collagen of the present invention mainly acts on the viral protein by a physical mechanism and does not act on the target cells.

[0169] Example 5 Detection of the Inhibitory Time of Recombinant Humanized Collagen against Viruses (1) Digest, centrifuge and count the Hela cells cultured the previous day.

[0170] (2) Inoculate 100 μL of 1×10 5 / well of Hela cells on a 96-well plate and culture them at 37 °C, 5% CO 2 , 90% humidity for 24 hours.

[0171] (3) Then at 0.5, 0, 0.5, 1, 2, 4, 6, 8, 10, 12 hours after adding the HPV pseudovirus, treat the cells with an appropriate concentration of recombinant humanized collagen. 24 hours after inoculating the HPV pseudovirus, maintain the cells in DMEM containing 2% fetal bovine serum (FBS) under the conditions of (2) for another 72 hours.

[0172] (4) After 72 hours, use Promega cell lysate (Promega Madison) to lyse the cells for 30 minutes according to the manufacturer's manual, and add the substrate according to the instructions. Measure the fluorescence intensity using an ELISA reader according to the bioluminescence program.

[0173] The formula for calculating the virus inhibition rate = [(average RLU of positive control - RLU of sample) / (average RLU of positive control - average RLU of blank control)] × 100%, and the positive control is the fluorescence value of the well only infected with the pseudovirus.

[0174] Collagen II-1 and collagen II-2 are basically the same in terms of mechanism, so collagen II-2 is taken as an example for illustration. The infection of HPV is divided into the entry stage in the first 12 hours. Example 5 can show the main action time of the recombinant humanized type II collagen in virus inhibition. As Figure 8 shown, the inhibition rate of collagen II-2 decreased at 8-12 hours after infection, and this time is the main target cell entry time of the virus, indicating that the antiviral activity of the recombinant humanized type II collagen mainly acts on the virus entry stage.

[0175] HPV and HIV have distinct biochemical characteristics. HPV is an envelopeless protein-like particle virus, while HIV is a type of membrane virus. There are significant differences between them in terms of virus entry mode and infection route. However, based on the results of Examples 3 - 5, the applicant unexpectedly found that recombinant human collagen II-1 and collagen II-2 have antiviral activities against HPV and HIV that are not possessed by type II collagen of animal origin. At the same time, it was also clarified that collagen II-1 and collagen II-2 act on the virus entry stage, and the antiviral activity mainly acts on viral proteins and does not act on target cells.

[0176] Example 6 Verification of the effect of the tandem repeat expression strategy of recombinant humanized collagen To verify whether the tandem repeat expression strategy can enhance the antiviral activity, the virus inhibition experiment was carried out on collagen II-1 (SEQ ID NO: 7) and its repeat unit R1P5 (SEQ ID NO: 1) according to Example 3, and the inhibitory activities of the two against the virus were compared.

[0177] The results are as Figure 9 shown. It can be seen that the activity of collagen II-1 is about 30% higher than that of its repeat unit polypeptide, with significant statistical differences, proving that the recombinant humanized collagen with tandem repeat expression has good activity improvement.

[0178] Example 7 Verification of the antiviral activity of recombinant humanized collagen with different truncated motifs in repeated expression To verify the antiviral activity of collagen II-1 with different lengths of motifs in the same section, the recombinant collagens TC2J2, TC2J3, TC2J4, and TC2J5 constructed with collagen II-1 and different truncated motifs (SEQ ID NO: 1, 3 - 6) were used for the virus inhibition experiment by the method of Example 3, and the inhibitory activities of different recombinant collagens against the virus were compared.

[0179] From Figure 10 it can be seen that the recombinant collagens constructed with different truncated sequences containing the same section as the repeat unit all have certain virus inhibitory activities, and among them, collagen II-1 is the recombinant humanized collagen with the best activity.

Claims

1. Collagen, which consists of one or more repeating units, wherein the repeating unit consists of the amino acid sequence shown in SEQ ID NO: 6 or 2, or consists of an amino acid sequence with 1-5 Gly-XY motifs added to the N-terminus and / or C-terminus of SEQ ID NO: 6, wherein X is selected from E, L, P, D or R, and Y is selected from P, Q, S or A. 2 . The collagen according to claim 1 , wherein the repeating unit consists of the amino acid sequence shown in any one of SEQ ID NOs: 1-6. The collagen according to claim 1 , wherein the plurality of repeating units is 9-16 repeating units. 4 . The collagen according to claim 1 , which consists of the amino acid sequence shown in SEQ ID NO: 7-12.

5. A nucleic acid encoding the collagen according to any one of claims 1 to 4. A vector comprising the nucleic acid according to claim 5.

7. A host cell comprising the nucleic acid according to claim 5 or the vector according to claim 6.

8. The method for producing collagen according to any one of claims 1 to 4, characterized in that: The steps include: (1) culturing the host cell according to claim 7 under suitable culture conditions; (2) harvesting host cells and / or culture medium containing collagen; and (3) Purification of collagen.

9. A composition, characterized in that Contains the collagen according to any one of claims 1 to 4.

10. The composition according to claim 9, which is a pharmaceutical composition, a medical device, a tissue engineering product, a cosmetic or a health product.

11. The composition according to claim 9, which is a solid, liquid or gel composition.

12. The composition of claim 9, which is a personal lubricant, a vaginal gel or a condom lubricant.

13. Use of the collagen according to any one of claims 1 to 4 in the preparation of a product for preventing and / or treating viral infection or a disease caused by viral infection; the virus is HPV or HIV.

14. The use according to claim 13, wherein the product is a personal lubricant, a vaginal gel or a condom lubricant, or the product is a pharmaceutical composition.

15. The use according to claim 13 or 14, wherein the disease is cervical neoplasia, condyloma acuminatum or cervical cancer.

16. The use according to claim 13 or 14, wherein the disease is AIDS.

17. A method for inhibiting viral infection in vitro, characterized in that: The method comprises contacting cells with the collagen according to any one of claims 1 to 4, or the composition according to any one of claims 9 to 12; and the virus is HPV or HIV.

Images