Lipase mutant with improved specific activity and application thereof
By mutation of the 110th amino acid of lipase and replacing Tyr as Ser, its specific vitality is significantly improved, the problem of insufficient vitality in the existing technology is solved, and its application potential in oil processing and other fields is enhanced.
Patent Information
- Application Number
- CN202510614482.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-14
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-05-14
AI Technical Summary
In the prior art, the lack of activity of lipase has limited its wide application in industrial fields such as oil processing.
By mutating the amino acid sequence of lipase, specifically replacing Tyr at the amino acid 110 of lipase with Ser, the resulting mutant has significantly improved specific vitality.
The mutated lipase specific activity increased by 59.7%, reaching 706 U/mg, significantly improving its application potential in oil processing and other fields.
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of genetic engineering and protein engineering modification, and particularly relates to a lipase mutant with improved specific activity and its application. Background Art
[0002] Lipase, namely triacylglycerol acylhydrolase, catalyzes the hydrolysis of natural substrate oils and fats to generate fatty acids, glycerol and glycerol monoester or diester. The basic unit of lipase is only amino acid, usually with only one polypeptide chain, and its catalytic activity depends on its protein structure. According to the differences in structure and function, lipases can be divided into acidic, neutral and alkaline lipases.
[0003] Lipases widely exist in animals, plants and microorganisms. Among plants, the seeds of oil crops such as castor seeds and rapeseeds contain more lipases. When oil seeds germinate, lipases can cooperate with other enzymes to catalyze the decomposition of oil substances to generate sugars, providing the necessary nutrients and energy for the seeds to take root and germinate; in animals, the pancreas and adipose tissues of higher animals contain more lipases, and a small amount of lipase is contained in intestinal juice to supplement the deficiency of pancreatic lipase in fat digestion. A small amount of butyrinase is contained in the gastric juice of carnivorous animals. In animals, various lipases control processes such as digestion, absorption, fat reconstruction and lipoprotein metabolism; lipases in bacteria, fungi and yeasts are more abundant. Due to the large variety, fast reproduction and easy genetic variation of microorganisms, they have a wider pH range, temperature range of action and substrate specificity than animals and plants, and lipases from microorganisms are generally secreted extracellular enzymes, which are suitable for industrial large-scale production and obtaining high-purity samples. Therefore, microbial lipases are an important source of industrial lipases.
[0004] As an efficient biocatalyst, lipase plays an important role in the fields of oil processing and fine chemicals. In oil processing, lipase catalyzes the hydrolysis reaction to decompose triglycerides into fatty acids and glycerol, providing raw materials for industries such as food and detergent; its transesterification function can improve the physical properties of oils and fats, and is applied to the production of special oils and fats such as margarine and cocoa butter substitutes. At the same time, it catalyzes the transesterification reaction of animal and vegetable oils and methanol in the preparation of biodiesel, promoting the development of green energy. In the field of fine chemicals, lipase can highly selectively synthesize food emulsifiers such as monoglycerides and sucrose esters, participate in the resolution of chiral drug intermediates, and catalyze the synthesis of high-value-added products such as perfume esters. In addition, lipase shows unique advantages in green chemical processes, can replace traditional chemical methods, reduce the use of organic solvents, improve reaction efficiency and environmental friendliness, and thus has broad application prospects in industries such as food, energy, medicine and daily chemicals. Summary of the Invention
[0005] The present invention provides a lipase mutant with improved specific activity and its applications to solve the problems of the prior art. The specific activity of the mutant is significantly improved compared to the wild type, which is beneficial to its wide application in industrial fields such as oil processing.
[0006] On the one hand, the present invention relates to a lipase mutant, which is obtained by mutating the 110th amino acid of the lipase with the amino acid sequence of SEQ ID NO:1 from Tyr to Ser.
[0007] The present invention also relates to a DNA molecule encoding the above lipase mutant.
[0008] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.
[0009] The present invention also relates to a host cell containing the above recombinant expression plasmid.
[0010] After transferring the above plasmid into the host cell, the specific activity of the recombinantly expressed lipase mutant is significantly improved.
[0011] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).
[0012] The present invention also provides the application of the above lipase mutant in the field of oil processing.
[0013] Based on the wild-type lipase PSL, the present invention provides a lipase mutant containing a single-point mutation Y110S, with a 59.7% increase in specific activity, up to 706 U / mg, achieving an unexpected technical effect.
[0014] In summary, the specific activity of the lipase mutant provided by the present invention is significantly improved, which is beneficial to reducing production costs and promoting its wide application in industrial fields such as oil processing. Detailed Embodiments
[0015] The present invention uses conventional techniques and methods in the fields of genetic engineering and molecular biology, such as the methods described in MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols, and reagents in the art, without being limited to the specific embodiments of the present invention. For example, the following experimental materials and reagents can be selected for the present invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.
[0016] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification and recovery kit were purchased from Omega, and GeneMorph II Random Mutagenesis Kit was purchased from Beijing Bomes Biotechnology Co., Ltd.
[0017] Medium formulations: Escherichia coli medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0; Yeast medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose; Yeast screening medium (MD medium): 2% peptone, 2% agarose; BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.
[0018] The present invention will be further described below in conjunction with the embodiments: Example 1 Construction of expression plasmid The lipase gene derived from Burkholderia cepacia ( Burkholderia cepacia ) was codon-optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The lipase was named PSL, its amino acid sequence was SEQ ID NO: 1, and the coding nucleotide sequence was SEQ ID NO: 2.
[0019] The lipase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); simultaneously, the plasmid pPIC9K was digested with restriction endonucleases EcoR I and Not I. The digested products were purified using a gel purification kit, and the above two digested products were ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into Escherichia coli DH5α (Invitrogen) and selected with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).
[0020] The plasmid was purified from the Escherichia coli clone with correct sequencing results using a plasmid miniprep kit (Omega) to obtain one expression plasmid, which was named pPIC9K-PSL.
[0021] Example 2 Screening of high-specific-activity lipase mutants To further improve the enzymatic activity of lipase PSL, the applicant performed protein structure analysis on it. This protein is a lipase of the G11 family, and its structure is a β-jelly roll structure. The applicant screened a large number of mutations of this enzyme through directed evolution technology.
[0022] 1.1 Design PCR primers PSL-F1 and PSL-R1: PSL-F1: GGC GAATTC ATGGCTTCCAGAGATGGTCA (as shown in SEQ ID NO: 3, the underlined part is the recognition site of restriction endonuclease EcoRI); PSL-R1: ATA GCGGCCGC TTAGGCACATCTAGCTGCTCT (as shown in SEQ ID NO: 4, the underlined part is the recognition site of restriction endonuclease NotI).
[0023] Using the PSL gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers with a GeneMorph II random mutagenesis PCR kit. The PCR product was recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated with the pET21a vector digested with the same enzymes. It was transformed into Escherichia coli BL21 (DE3), spread on an LB-Amp plate, and cultured upside down at 37°C. After the transformants appeared, they were picked one by one with toothpicks into a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended with buffer, and the cell wall was broken by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing lipase.
[0024] Take 30 μL of the lysis solution into two new 96-well plates respectively; add 30 μL of the substrate to one of the 96-well plates, react at 37 °C for 30 min, and then determine the generated reducing sugar by the DNS method. Add 150 μL of Coomassie Brilliant Blue solution to the other plate, let it stand for 10 min, and determine the protein content by the Coomassie Brilliant Blue (Bradford) binding method. Calculate the enzyme activity level and protein content of different mutants respectively. Finally, the applicant screened out a single-point mutation site Y110S that significantly improved the specific activity of lipase from more than 20,000 transformants.
[0025] Based on the above wild-type lipase PSL, the present invention provides a mutant containing a single mutation site Y110S, and its amino acid sequence is shown in SEQ ID NO:5.
[0026] Example 3 Expression of Lipase in Pichia pastoris 3.1 Construction of Expression Plasmid Optimize the gene sequences of lipase PSL and its mutants respectively according to the codon preference of Pichia pastoris, synthesize them by Shanghai Jierui Bio-Engineering Co., Ltd., and add two restriction enzyme sites EcoRI and NotI to the 5' and 3' ends of the synthesized sequences respectively.
[0027] According to the method described in Example 1, double-digest the synthesized gene sequences of lipase PSL and its mutants with EcoRI and NotI respectively, then ligate them overnight at 16 °C with the pPIC-9K vector digested with the same enzymes, and transform Escherichia coli DH5α, coat it on the LB-Amp plate, and culture it inverted at 37 °C. After the transformants appear, perform colony PCR (reaction system: the monoclonal picked as the template, 0.5 μL of rTaq DNA polymerase, 2.0 μL of 10× Buffer, 2.0 μL of dNTPs (2.5 mM), 0.5 μL of 5'AOX primer (10 mM), 0.5 μL of 3'AOX primer, 14.5 μL of ddH 2 O, reaction program: pre-denaturation at 95 °C for 5 min, 30 cycles: 94 °C for 30 sec, 55 °C for 30 sec, 72 °C for 2 min, 72 °C for 10 min). Verify the positive clones, and obtain the correct recombinant expression plasmid after sequencing verification.
[0028] 3.2 Construction of Pichia pastoris Engineering Strains 3.2.1 Preparation of Yeast Competent Cells The Pichia pastoris GS115 strain was activated on a YPD plate. After culturing at 30 °C for 48 h, the activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. It was cultured at 30 °C and 220 rpm for about 12 h, and then the bacterial liquid was transferred to a triangular flask containing 30 mL of YPD liquid medium and cultured at 30 °C and 220 rpm for about 5 h. After detecting its cell density with an ultraviolet spectrophotometer, when the OD600 value was in the range of 1.1–1.3, 4 mL of cells were collected by centrifugation at 4 °C and 9000 rpm for 2 min into a sterilized EP tube. The supernatant was gently discarded, and after drying the residual supernatant with a sterilized filter paper, the cells were resuspended with 1 mL of pre-cooled sterilized water. After centrifugation at 4 °C and 9000 rpm for 2 min, the supernatant was gently discarded. After repeating the washing with 1 mL of sterilized water once, centrifugation was carried out at 4 °C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were resuspended with 1 mL of pre-cooled sorbitol (1 mol / L); after centrifugation at 4 °C and 9000 rpm for 2 min, the supernatant was gently discarded, and the cells were gently resuspended with 100 - 150 μL of pre-cooled sorbitol (1 mol / L).
[0029] 3.2.2 Transformation and screening The recombinant expression plasmids constructed in 3.1 were linearized with Sac I respectively. After purification and recovery of the linearized fragments, they were transformed into Pichia pastoris GS115 by electroporation respectively. Pichia pastoris recombinant strains were screened on MD plates, and then transformants with multiple copies were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL - 8 mg / mL).
[0030] The obtained transformants were transferred to BMGY medium respectively and cultured with shaking at 30 °C and 250 rpm for 1 d; then transferred to BMMY medium and cultured with shaking at 30 °C and 250 rpm; 0.5% methanol was added every day for 4 d of induced expression; the cells were removed by centrifugation at 9000 rpm for 10 min, and the fermentation supernatants containing lipase PSL and its single-point mutants were obtained respectively. The lipase activity and protein content in the fermentation supernatants were detected respectively according to the following methods, and the specific activity was calculated.
[0031] 1. Method for determining lipase activity (1)Definition of lipase activity unit 1 g of solid enzyme powder (or 1 mL of liquid enzyme), under certain temperature and pH conditions, hydrolyzing the substrate to produce 1 μmol of titratable fatty acid in 1 min is defined as one enzyme activity unit, expressed as u / g (u / mL).
[0032] (2)Method for determining lipase activity Take two 100 mL Erlenmeyer flasks, add 4.00 mL of substrate solution and 5.00 mL of phosphate buffer into the blank flask (A) and the sample flask (B) respectively. Then add 15.00 mL of 95% ethanol into flask A, preheat it in a water bath at 40 °C ± 0.2 °C for 5 min. Then add 1.00 mL of the enzyme solution to be tested into both flasks A and B, mix immediately and start timing. After reacting accurately for 15 min, immediately add 15.00 mL of 95% ethanol to flask B to terminate the reaction, and take it out; add two drops of phenolphthalein indicator solution to both the blank and sample solutions, titrate with sodium hydroxide standard solution until it turns slightly red and remains for 30 s without fading as the titration end point, and record the volume of sodium hydroxide standard solution consumed.
[0033] The calculation formula for lipase enzyme activity is: X1 = [(V1–V2)×C×50×n] / 0.05×1 / 15.
[0034] Where: X1—the enzyme activity of the sample, u / g; V 1 —the volume of sodium hydroxide standard solution consumed when titrating the sample, mL; V 2 —the volume of sodium hydroxide standard solution consumed when titrating the blank, mL; c—the concentration of sodium hydroxide standard solution, mol / L; 50—1.00 mL of 0.05 mol / L sodium hydroxide solution is equivalent to 50 μmol of fatty acid; n—the dilution factor of the enzyme solution; 0.05—the conversion coefficient of sodium hydroxide standard solution concentration; 1 / 15—the reaction time is 15 min, calculated as 1 min; The obtained experimental results are expressed as integers.
[0035] The absolute difference between two independent determination results obtained under repeated conditions shall not exceed 2% of the arithmetic mean.
[0036] 2. Protein content determination method The Bradford method for determining protein content is a composite method combining colorimetry and pigment method. Coomassie Brilliant Blue G-250 is brownish red in acidic solution and turns blue when combined with protein, and conforms to Beer's law within a certain protein concentration range, and can be colorimetrically determined at 595 nm. A large amount of absorption occurs within 3 - 5 minutes and is stable for at least 1 hour. Within the range of 10 - 1000 μg / mL, the absorbance value is proportional to the protein concentration.
[0037] Mix according to the volume ratio of enzyme solution to Coomassie Brilliant Blue solution of 1:5, let it stand for 10 min, and determine the protein content by the Bradford method 3. Specific Activity Calculation "Specific Activity" refers to the number of enzyme activity units in a unit weight of protein, generally expressed as U / mg protein.
[0038] Specific Activity calculation formula: Specific Activity (U / mg) = Enzyme Activity (U / mL) / Protein Content (mg / mL).
[0039] The specific results are shown in Table 1.
[0040] Table 1 Comparison of Specific Activities of Lipase Mutants Lipase Specific activity (U / mg) Wild-type PSL 442 Y110S single-point mutant 706 It can be seen from the results in Table 1 that compared with the wild-type lipase PSL, the specific activity of the lipase mutant containing the single-point mutation Y110S provided by the present invention has increased by 59.7%, achieving an unexpected technical effect.
[0041] In summary, the specific activity of the lipase mutant provided by the present invention has been significantly improved, which is beneficial to reducing the production cost of the enzyme and promoting its wide application in the fields of oil processing and the like.
Claims
1. A lipase mutant, characterized in that: The mutant is obtained by mutating the 110th amino acid of the lipase with the amino acid sequence of SEQ ID NO: 1 from Tyr to Ser.
2. A DNA molecule encoding the lipase mutant according to claim 1.
3. A recombinant expression plasmid comprising the DNA molecule of claim 2.
4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.
5. The host cell according to claim 4, characterized in that The host cell is Pichia pastoris ( Pichia pastoris ).
Citation Information
Patent Citations
Lipase mutant with high specific activity and application thereof
CN118755697A
Lipase mutant and application thereof in grease processing
CN118773166A
Mutant of Burkholderia lipase as well as recombinant expression vector and application thereof
CN119639718A
Novel lipase and uses of the same
US20210214696A1