Application of BpLUS1 gene in regulating and controlling white birch branch number and / or lupeol content

Abstract

The invention relates to the technical field of plant transgenosis, in particular to application of a BpLUS1 gene in regulating and controlling the number of white birch branches and / or the lupeol content. Through overexpression of the BpLUS1 gene, the number of plant branches can be increased, and the lupeol content can be increased. Results of the specific embodiment of the invention show that by regulating and controlling the expression quantity of the BpLUS1 gene through genetic engineering, the number of branches of the plant can be remarkably increased, so that the overall biomass of the plant is improved; the expression quantity of the BpLUS1 gene is regulated and controlled through genetic engineering, synthesis and accumulation of target metabolites (such as lupeol and the like) are improved, and the medicinal or commercial value of plants is improved. Moreover, the BpLUS1 gene disclosed by the invention can regulate and control a plurality of characters (branch development and metabolite synthesis) of the plant at the same time, and can better optimize the growth, development and production performance of the plant.

Description

Technical Field

[0001] The present invention relates to the technical field of plant transgenic technology, and particularly relates to the application of the BpLUS1 gene in regulating the branch number and / or lupeol content of Betula platyphylla. Background Art

[0002] Betula platyphylla Suk. (Latin scientific name), also known as birch tree, is a deciduous tree of the genus Betula in the family Betulaceae. It grows on slopes or in forests at an altitude of 400 - 4100 m, has strong adaptability, and prefers moist soil. Betula platyphylla can reach a height of 27 m; its bark is grayish white and peels off in layers; its branches are dark gray or dark brown, hairless, with resin glands that are sparse or dense or without resin glands; its twigs are dark gray or brown, hairless and without resin glands, sometimes sparsely hairy and with sparsely distributed resin glands. The fruit inflorescence is solitary, cylindrical or oblong-cylindrical, usually pendulous, 2 - 5 cm long and 6 - 14 mm in diameter; the peduncle is slender, 1 - 2.5 cm long, densely covered with short pubescence, nearly hairless after maturity, without or with resin glands that are sparse or dense. Betula platyphylla is distributed in the northeastern, northern, central, southwestern, and southeastern regions of China.

[0003] The branch number and metabolite content of plants have important effects on the yield, quality, and biological activity of crops. Although traditional breeding methods can improve the branch number and metabolite content of crops, their progress is slow and limited by genetic background, environmental factors, etc. Especially in some cash crops and medicinal plants, the metabolite content is crucial for their commercial value. Therefore, using transgenic technology to precisely regulate specific genes has become an effective way to increase the branch number and metabolite content of plants. Currently, the discovery of new genes regarding the plant type and molecular regulation of metabolites in Betula platyphylla is still lacking. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of the BpLUS1 gene in regulating the branch number and / or lupeol content of Betula platyphylla to solve the problems existing in the above-mentioned prior art. Overexpressing the BpLUS1 gene of the present invention can increase the branch number and lupeol content of Betula platyphylla.

[0005] To achieve the above purpose, the present invention provides the following solution:

[0006] The present invention provides an application of the BpLUS1 gene in regulating the branch number and / or lupeol content of Betula platyphylla, and the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0007] The present invention provides a method for increasing the branching number of Betula platyphylla and / or increasing the lupeol content, comprising the step of overexpressing the BpLUS1 gene in Betula platyphylla; the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0008] The present invention provides the application of the BpLUS1 gene in cultivating transgenic Betula platyphylla with more branches and / or a higher lupeol content, the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0009] The present invention provides a method for cultivating transgenic Betula platyphylla with more branches and / or a higher lupeol content, comprising the step of overexpressing the BpLUS1 gene in Betula platyphylla to obtain the transgenic Betula platyphylla; the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0010] The present invention provides the application of the biological material containing the BpLUS1 gene in regulating the branching number of Betula platyphylla and / or the lupeol content, the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0011] The present invention provides the application of the biological material containing the BpLUS1 gene in cultivating transgenic Betula platyphylla with more branches and / or a higher lupeol content, the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0012] The present invention provides the application of the BpLUS1 gene in regulating the plant height and / or the basal stem growth rate of Betula platyphylla, the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0013] The present invention provides a method for reducing the height of Betula platyphylla and / or reducing the basal stem growth rate of Betula platyphylla, comprising the step of overexpressing the BpLUS1 gene in Betula platyphylla; the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0014] The present invention provides the application of the biological material containing the BpLUS1 gene in regulating the plant height and / or the basal stem growth rate of Betula platyphylla, the nucleotide sequence of the BpLUS1 gene is as shown in SEQ ID NO.1.

[0015] Preferably, the biological material includes a recombinant vector and a recombinant bacterium.

[0016] The present invention discloses the following technical effects:

[0017] 1. Increasing the branching number: By genetically engineering the expression level of the BpLUS1 gene, the branching number of plants can be significantly increased, thereby increasing the overall biomass of plants.

[0018] 2. Increase metabolite content: By genetically engineering the expression level of the BpLUS1 gene, the synthesis and accumulation of target metabolites (such as lupeol, etc.) are enhanced, improving the medicinal or commercial value of plants.

[0019] 3. Multiple target regulation: The BpLUS1 gene described in the present invention can simultaneously regulate multiple traits of plants, such as branch development and metabolite synthesis, and can better optimize the growth and production performance of plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0021] Figure 1 It is a GUS staining map of L14 and L21 plants under a stereomicroscope; among them, A is the GUS staining map of L14 plants; B and C are both GUS staining maps of L21 plants; the scale bars of A and B are both 2000μm; the scale bar of C is 500μm;

[0022] Figure 2 It is a GFP fluorescence detection map of L14 and L21 plants; among them, A is the GFP fluorescence detection map of L14 plants; B is the GFP fluorescence detection map of L21 plants; the scale bars are both 2000μm;

[0023] Figure 3 It is a statistical chart of the relative gene expression levels of different plants; among them, CK stem is a wild-type birch plant obtained by germinating seeds; L14 stem and L21 stem are transgenic plants numbered L14 stem and L21 stem obtained with the stem as the explant;

[0024] Figure 4 It is a liquid chromatography map of lupeol in different plants; among them, CK stem is a wild-type birch plant obtained by germinating seeds; L14 stem is a transgenic plant numbered L14 stem obtained with the stem as the explant;

[0025] Figure 5 It is a liquid chromatography map of lupeol in different plants; among them, CK leaf is a wild-type birch plant obtained by germinating seeds; L11 leaf is a transgenic plant numbered L11 leaf obtained with the stem as the explant;

[0026] Figure 6Statistical chart of lupeol content in different plants; among them, CK stem is a wild-type birch plant obtained by germinating seeds; L14 stem is a transgenic plant numbered L14 stem obtained using the stem as an explant.

[0027] Figure 7 Statistical chart of lupeol content in different plants; among them, CK leaf is a wild-type birch plant obtained by germinating seeds; L11 leaf is a transgenic plant numbered L11 leaf obtained using the stem as an explant.

[0028] Figure 8 Statistical chart of the number of branches of different plants; among them, CK stem is a wild-type birch plant obtained by germinating seeds; L14 and L21 are transgenic plants numbered L14 stem and L21 stem obtained using the stem as an explant.

[0029] Figure 9 Phenotype diagram of the branches of different plants; among them, A is WT; B is L14; C is L21; WT is a wild-type birch plant obtained by germinating seeds; L14 stem and L21 stem are transgenic plants numbered L14 stem and L21 stem obtained using the stem as an explant.

[0030] Figure 10 Growth rate diagram of different plants; among them, WT is a wild-type birch plant obtained by germinating seeds; L14 and L21 are transgenic plants numbered L14 stem and L21 stem obtained using the stem as an explant.

[0031] Figure 11 Basal stem growth diagram of different plants; among them, WT is a wild-type birch plant obtained by germinating seeds; L14 and L21 are transgenic plants numbered L14 stem and L21 stem obtained using the stem as an explant. Detailed implementation mode

[0032] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0034] Unless otherwise noted, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0035] Without departing from the scope or spirit of the present invention, various modifications and variations to the specific embodiments of the description of the present invention will be apparent to those skilled in the art. Other embodiments derived from the description of the present invention will be apparent to those skilled in the art. The description of the present invention and the examples are merely exemplary.

[0036] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0037]

[0038] Example 1

[0039] 1. Construction of transgenic recombinant vector and recombinant bacterium:

[0040] Clone the BpLUS1 gene and ligate it with plant promoter, terminator and selection marker gene to construct a transgenic recombinant vector; transform this vector into Agrobacterium to obtain a recombinant bacterium.

[0041] The specific steps are as follows:

[0042] 1.1) Amplification of BpLUS1 gene from Betula platyphylla

[0043] According to the CDS sequence of the BpLUS1 gene from Betula platyphylla (SEQ ID NO.1), design primers (F: ATGTGGAAGTTGAAGATAGCGGAAGGAGG, SEQ ID NO.2; R: TCATGCAAATAGAACTCGCCTCCGATATTCTC, SEQ ID NO.3) for amplification. The amplification template is the wild-type DNA of Betula platyphylla. Detect the PCR bands by 1% agarose gel electrophoresis to obtain the target fragment.

[0044] The PCR amplification reaction system is a 50 μL reaction system: 20 μL of water, 2 μL of upstream primer, 2 μL of downstream primer, 1 μL of template, and 25 μL of enzyme. The PCR amplification reaction program is: 94°C for 5 min; 94°C for 30 sec, 58°C for 30 sec, 72°C for 135 sec, 30 cycles; 72°C for 10 min, and keep at 4°C. The cloning result shows that the BpLUS1 gene from Betula platyphylla is successfully cloned.

[0045] 1.2) Ligation of BpLUS1 gene from Betula platyphylla with entry vector

[0046] Use the pMD TM 18-T cloning vector of TAKARA company. Prepare the reaction solution according to the following system: pMD TM 18-T 1 μL, BpLUS1 gene fragment 1 μL, ddH 2 O 1 μL, add 5 μL of Solution I; react at 16°C for 30 min to obtain the recombinant plasmid.

[0047] 1.3) Construction of plant overexpression vector of BpLUS1 gene

[0048] Prepare the reaction solution according to the following system to obtain the EGFP-pCAMBIA1301-35SN linear vector:

[0049] 2 μg of EGFP-pCAMBIA1301-35SN, 1 μL of XbaI, 1 μL of KpnI, 4 μL of 10×Buffer M, ddH 2 O 32 μL, react at 7℃ for 5 h, recover the large fragment by 1% agarose gel electrophoresis to obtain the recovered and purified vector EGFP-pCAMBIA1301-35SN; ligate the recovered and purified target gene fragment with the recovered and purified vector EGFP-pCAMBIA1301-35SN, and name the ligation product as recombinant plasmid LUS1-EGFP-pCAMBIA1301-35SN. The ligation system is as follows: 1 μL of T4 DNA Ligase, 2 μL of 5×T4 Buffer, 1 μL of EGFP-pCAMBIA1301-35SN, 6 μL of BpLUS1 gene fragment, ligate overnight at 22℃, transform the ligation product into competent E. coli cells, pick positive clones and send them to the company for sequencing.

[0050] 1.4) Transformation into Agrobacterium

[0051] Introduce the recombinant plasmid LUS1-EGFP-pCAMBIA1301-35SN into competent Agrobacterium tumefaciens LBA4404 cells by the freeze-thaw method. Plate on solid LB medium containing kanamycin and rifampicin. After 2 days, pick single colonies for PCR detection, and the positive single colonies detected are stored as engineering bacteria for infecting plants.

[0052] 2. Material pre-culture:

[0053] Separate the stems and leaves of two-month-old birch seedlings (try not to leave bud points as much as possible), and place the separated stems and leaves on callus induction medium (the induction medium is: add 2% sucrose, 0.8% agar powder, 0.8 mg / L 6-BA and 0.2 mg / L NAA to IS basal medium, pH 5.5 - 6.0; the components of IS basal medium are: 680.0 mg / L ammonium nitrate (NH 4 NO 3 ), 0.8 mg / L potassium iodide (KI), 100.0 mg / L inositol, 1.0 mg / L ascorbic acid (Vc), 10.0 mg / L tyrosine, 80.0 mg / L potassium dihydrogen phosphate (KH 2 PO 4 ), 370.0 mg / L magnesium sulfate (MgSO 4 ·7H 2 O), 8.0 mg / L manganese sulfate (MnSO 4 ·4H 2 O), 0.025 mg / L copper sulfate (CuSO 4 ·5H 2 O), 9.0 mg / L zinc sulfate (ZnSO4 ·7H 2 O), 27.8 mg / L ferrous sulfate (FeSO 4 ·7H 2 O), 140.0 mg / L potassium chloride (KCl), 0.25 mg / L sodium molybdate (Na 2 MoSO 4 ·2H 2 O), 10.0 mg / L urea, 3.2 mg / L boric acid (H 3 BO 3 ), 710.0 mg / L calcium nitrate (Ca(NO 3 )) 2 ·4H 2 O), 170.0 mg / L potassium nitrate (KNO 3 ), 0.8 mg / L nicotinic acid (VB 3 ), 1.0 mg / L fumaric acid, 0.1 mg / L pyridoxine hydrochloride (VB 6 ), 0.1 mg / L thiamine hydrochloride (VB 1 ), and 37.3 mg / L disodium ethylenediaminetetraacetate (EDTANa 2 )) for pre-culture. The pre-culture condition parameters are: dark culture at 25 °C for 7 - 10 days to obtain pre-cultured explants (pre-cultured stems and pre-cultured leaves).

[0054] 3. Preparation of infection solution:

[0055] When the OD of the bacterial solution of the engineering bacteria for infecting plants is 0.6, centrifuge at 4000 rpm for 10 min, discard the supernatant, add an equal volume of sterilized water, and add 100 mg / L acetosyringone for induced culture for 30 min to obtain the infection solution.

[0056] 4. Transformation method:

[0057] Place the pre-cultured explants (pre-cultured stems and pre-cultured leaves) in the infection solution for 5 - 20 min (in this example, it is 10 min), then place them on the callus differentiation medium (the differentiation medium is: adding 2% sucrose, 0.8% agar powder, 0.5 mg / L 6 - BA, and 0.5 mg / L KT to the IS basal medium, and the components of the IS basal medium are the same as above) for co-culture. First, conduct dark culture for 48 h, decontaminate with 300 mg / L cefotaxime three times, and then culture under light at a temperature of 25 °C and a photoperiod of 16 / 8 h (day / night).

[0058] 5. Rooting culture:

[0059] When the bud height reaches 3 - 4 cm, cut the stem segments and transfer them to the rooting medium (the rooting medium is: adding 2% sucrose and 0.8% agar powder to the WPM basal medium, with a pH of 6.0 - 6.5) for cultivation. The cultivation temperature is 25°C, and the photoperiod is 16 / 8 h (day / night). Then, carry out multiplication, and after multiplication, conduct transgenic verification.

[0060] 6. Screening and verification:

[0061] Screen transgenic plants containing the target gene from the transformed plants through the antibiotic screening method and GUS staining method (using leaves as explants, obtaining transgenic plants numbered L11 leaves; using stems as explants, obtaining transgenic plants numbered L14 stems and L21 stems), and verify the expression of the target gene by real-time fluorescence quantitative PCR. The reaction system and conditions refer to the instructions of the qPCR Super Mix kit of TransGen Biotech Co., Ltd., using the internal reference gene as the internal standard reference, and the relative expression level of the target gene is calculated by 2 -ΔΔCt Calculate.

[0062] The primers used for quantitative analysis of the BpLUS1 gene are as follows:

[0063] BpLUS1-F: CCACTGGCCTGGTGAATCTGCT, SEQ ID NO.4;

[0064] BpLUS1-R: CCCAGCCTCCATCTTCGTTCTGAT, SEQ ID NO.5;

[0065] The primers used for the internal reference are as follows:

[0066] Internal reference-F: GATTGAGGGGAGGGATGCTG, SEQ ID NO.6;

[0067] Internal reference-R: GGAGGACAAGGTGGAGGGTG, SEQ ID NO.7.

[0068] 7. Phenotypic analysis and performance evaluation:

[0069] Observe the changes in the number of branches of transgenic plants, and compare the branching characteristics of transgenic plants and wild-type plants; at the same time, analyze the changes in the content of target metabolites, and analyze the metabolites in transgenic plants by high-performance liquid chromatography (HPLC).

[0070] 8. Investigation of plant height and basal stem growth rate:

[0071] After that, in August of the same year, the plant height and basal stem growth rate of wild-type Betula platyphylla plants and two transgenic plants (grown for 6 months) were measured. Among them, the plant height was measured once every 7 days for a total of 5 times.

[0072] 9. Results and Analysis:

[0073] The GUS staining images are as Figure 1 shown, and the results indicate that the Agrobacterium infection was successful.

[0074] The GFP fluorescence detection images are as Figure 2 shown, and the results indicate that the Agrobacterium infection was successful.

[0075] The relative expression levels of the BpLUS1 gene are as Figure 3 shown, and the results indicate that the BpLUS1 gene in the transgenic plants of the stems numbered L14 and the stems numbered L21 is significantly higher than that in the wild-type Betula platyphylla plants (CK stems).

[0076] The chromatograms of lupeol are as Figure 4 and Figure 5 shown, and the results of the lupeol content investigation are as Figure 6 and Figure 7 shown. The results show that the content of lupeol in the transgenic plants has increased by approximately 143% compared to the wild-type Betula platyphylla plants.

[0077] The results of the branch number statistics are as Figure 8 shown, and the branch phenotypes are as Figure 9 shown. The results indicate that the number of branches of the transgenic plants has increased significantly compared to the wild-type Betula platyphylla plants.

[0078] The results of the statistical analysis of the plant height and basal stem growth rates are as Figure 10 and Figure 11 shown. The results show that the growth rates of the plant height and basal stem of the wild-type Betula platyphylla plants are higher than those of the transgenic plants, presumably related to the formation of branches.

[0079] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. Application of the BpLUS1 gene in regulating the number of birch branches and / or the content of lupeol, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

2. A method for increasing the number of birch branches and / or increasing the lupeol content, characterized in that: The method comprises the step of overexpressing the BpLUS1 gene in birch; the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO.

1.

3. The use of the BpLUS1 gene in cultivating transgenic birch with more branches and / or high lupeol content, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

4. A method for cultivating transgenic birch with more branches and / or high lupeol content, characterized in that: The method comprises the steps of overexpressing the BpLUS1 gene in birch to obtain the transgenic birch; the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO.

1.

5. Use of biological materials containing the BpLUS1 gene in regulating the number of birch branches and / or the content of lupeol, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

6. Use of biological materials containing the BpLUS1 gene in cultivating transgenic birch with more branches and / or high lupeol content, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

7. Application of the BpLUS1 gene in regulating plant height and / or base stem growth rate of birch, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

8. A method for reducing the height of birch and / or reducing the growth rate of birch base stems, characterized in that: The method comprises the step of overexpressing the BpLUS1 gene in birch; the nucleotide sequence of the BpLUS1 gene is shown as SEQ ID NO.

1.

9. Use of a biological material containing the BpLUS1 gene in regulating plant height and / or base stem growth rate of birch, characterized in that: The nucleotide sequence of the BpLUS1 gene is shown in SEQ ID NO.

1.

10. The use according to claim 5, claim 6 or claim 9, characterized in that: The biological material includes a recombinant vector and a recombinant bacterium.

Images