ADAR1 enzyme organic electrochemical transistor sensor based on poly (horseradish peroxidase) as well as preparation method and application of ADAR1 enzyme organic electrochemical transistor sensor
By using a combined probe of double-stranded RNA and poly HRP in an electrochemical transistor sensor, the specific effect of ADAR1 enzyme on RNA is solved, and the detection sensitivity and detection limit of ADAR1 enzyme in the prior art is achieved, achieving a detection effect of high sensitivity and low detection limit.
Patent Information
- Application Number
- CN202510522907.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-24
- Publication Date
- 2025-06-10
AI Technical Summary
The prior art is difficult to detect ADAR1 enzymes with high sensitivity and low detection limits, and traditional nanomaterials have problems such as high cost and general biocompatibility in biosensors.
Double-stranded RNA is used as the detection probe and coupling polyHRP as a signal amplification probe, using the specific influence of ADAR1 enzyme on double-stranded RNA, changing the stability of RNA and the catalytic ability of polyHRP, thereby improving the detection sensitivity of electrochemical transistor sensors.
The detection of high sensitivity and low detection limit for ADAR1 enzymes is achieved, with low concentration wide linear range and low detection limit performance, avoiding the cost and biocompatibility problems of traditional nanomaterials.
Smart Images

Figure CN120121689A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to a detection method combining double-stranded RNA conjugated with poly-HRP and an electrochemical transistor sensor. Specifically, it utilizes the property that the ADAR1 enzyme can specifically change the sequence of double-stranded RNA, thereby changing the catalytic ability of the conjugated poly-HRP to improve the sensitivity of the electrochemical transistor sensor for detecting the ADAR1 enzyme. Background Art
[0002] Organic Electrochemical Transistor (OECT) is a new type of highly sensitive detection platform. The performance characteristics of the organic electrochemical transistor sensor include high transconductance, low working voltage, and high sensitivity to changes in ion concentration in solution. The biosensor based on OECT is a rapidly developing field. OECT can be combined with various biorecognition elements to achieve highly sensitive and low-detection-limit detection of biomarkers such as proteins and nucleic acids, which is expected to solve the problem that it is difficult to detect many biomarkers due to their extremely low content in body fluid samples. For different detection substances, the electrode surface of the transistor sensor must be modified with different recognition molecules.
[0003] Horseradish peroxidase (HRP) is a commonly used enzyme that can catalyze the substrate to undergo an oxidation-reduction reaction and produce detectable signal changes during the reaction. Currently, the commonly used methods to enhance the enzyme signal mainly include loading HRP through nanomaterials. The high surface area of nanomaterials enables a large number of binding sites with HRP, thus playing a role in amplifying the enzyme signal. However, nanomaterials have defects for biosensors. Nanomaterials are costly, have general biocompatibility, and at the same time, due to steric hindrance, the ability to enhance the signal is not ideal. Poly-HRP is a polymer formed by connecting multiple HRP molecules together through a specific polymerization method. Poly-HRP has unique advantages compared to monomeric HRP. Its polymeric form in structure can provide more catalytic active sites, thus significantly enhancing the catalytic efficiency. In terms of performance, poly-HRP exhibits higher enzyme activity and stability and can maintain its catalytic ability under a wider range of environmental conditions.
[0004] ADAR1 is a multifunctional RNA editing enzyme that regulates sequence diversity at the RNA level by catalyzing the deamination of adenosine to inosine in double-stranded RNA, affecting processes such as RNA stability, splicing, and translation, and thus participating in biological functions such as embryonic development, cell differentiation, immune regulation, and stem cell fate determination; its abnormality is closely related to cancer (overexpression promotes immune escape), autoimmune diseases (dysregulated activity triggers inflammation), and cellular senescence (non-editing-dependent pathway regulates p16INK4a). Mechanistically, it has both editing-dependent (changing the coding sequence) and editing-independent (RNA binding regulates gene expression) dual modes. As a hub molecule for RNA editing and immune regulation, ADAR1 has become a potential target for cancer immunotherapy by negatively regulating the innate immune pathway (ADAR1-dsRNA-MDA5 axis) and affecting the sensitivity of tumor immunotherapy. Its multifunctionality and disease relevance provide new directions for developing precise intervention strategies for cancer, autoimmune diseases, and aging-related diseases. However, there are currently few ways to detect ADAR1. Summary of the Invention
[0005] The technical solution adopted by the present invention to solve the above-mentioned problems is as follows:
[0006] In a first aspect, the present invention provides an ADAR1 enzyme organic electrochemical transistor sensor based on polyhorseradish peroxidase, comprising: a substrate, a drain electrode, a source electrode, a gate electrode, and an n-type organic semiconductor material layer, wherein the drain electrode, the source electrode, and the gate electrode are disposed on the substrate, and the n-type organic semiconductor material layer is disposed above the drain electrode and the source electrode and on the channel therebetween. A double-stranded RNA is fixed on the surface of the gate electrode, and poly-HRP is connected to the double-stranded RNA.
[0007] Preferably, the drain electrode, the source electrode, and the gate electrode independently comprise a titanium layer and a gold layer, and the titanium layer is located between the substrate and the gold layer. The thickness of the titanium layer is preferably controlled at 1-10 nm, and the thickness of the gold layer is preferably controlled at 30-100 nm.
[0008] Preferably, the material of the substrate is glass.
[0009] According to an embodiment of the present invention, the material of the n-type organic semiconductor material layer is P(NDIDTYM-TT), and the structural formula of the P(NDIDTYM-TT) is as follows:
[0010]
[0011] Preferably, the double-stranded RNA is fixed on the surface of the gate electrode through thiol modification.
[0012] Preferably, the 3'-end of the double-stranded RNA is modified with a thiol group, and the 5'-end is modified with biotin. The nucleotide sequence of the double-stranded RNA is 5’GAGCCUGCCCUCUGAUCUCUGCCUGUUCCUCUGUCCCACAG GGGGCAAAGGCUACGGGUCAGAGAGCGGGGAGGACUU3’; the poly-HRP is linked to the double-stranded RNA through streptavidin.
[0013] The double-stranded RNA can couple poly-HRP through the binding of biotin and streptavidin.
[0014] For the organic electrochemical transistor sensor of ADAR1 enzyme based on poly-horseradish peroxidase of the present invention, the positions and sizes of the gate, source, and drain can be selected by conventional methods, which do not affect the detection of ADAR1 enzyme.
[0015] In a second aspect, the present invention provides a method for preparing the ADAR1 enzyme organic electrochemical transistor based on poly-horseradish peroxidase described in the first aspect, comprising the following steps:
[0016] (1) Prepare a gate, a source, and a drain on the surface of a substrate so that there is a channel between the source and the drain;
[0017] (2) Deposit an n-type organic semiconductor material on a) the channel or b) the source, the drain, and the channel to form an n-type organic semiconductor material layer;
[0018] (3) Fix the double-stranded RNA on the surface of the gate and link poly-HRP to the double-stranded RNA.
[0019] Preferably, the preparation of the gate, the source, and the drain in step (1) includes: sequentially depositing a titanium layer and a gold layer on the surface of the glass. Both titanium plating and gold plating can adopt methods such as evaporation coating; among them, the adhesion between metal titanium and glass is good, preferably titanium is plated on the surface of the glass, and then gold is plated on the titanium layer.
[0020] Preferably, the method for forming the n-type organic semiconductor material layer in step (2) includes: drop-casting P(NDIDTYM-TT) at a) the channel or b) the source, the drain, and the channel under a nitrogen atmosphere and annealing at 160 °C for 30 minutes to obtain the n-type organic semiconductor material layer.
[0021] Preferably, the operation process of step (3) includes:
[0022] S11, drop a certain concentration of double-stranded RNA solution on the gate and incubate at 4 °C for 12 h;
[0023] S12, drop MCH (mercaptohexanol) and BSA (bovine serum albumin) solutions on the gate and block at room temperature for 1 hour;
[0024] S13. Drop a solution of streptavidin-poly-HRP80 conjugate at a certain concentration onto the gate and incubate at room temperature for 2 h to achieve conjugation with double-stranded RNA.
[0025] In step S11, the 3'-end of the double-stranded RNA is modified with a thiol group and the 5'-end is modified with biotin. The nucleotide sequence of the double-stranded RNA is 5’GAGCCUGCCCUCUGAUCUCUGCCUGUUCCUCUGUCCCACAGG GGGCAAAGGCUACGGGUCAGAGAGCGGGGAGGACUU3’.
[0026] As an example, in step S11, a double-stranded RNA solution with a concentration of 0.1 μM - 10 μM is prepared using a 10 mM TBS buffer solution containing 1 mM EDTA (ethylenediaminetetraacetic acid) and 1 mM TCEP (tris(2-carboxyethyl)phosphine hydrochloride).
[0027] As an example, in step S13, a solution of streptavidin-poly-HRP80 conjugate with a concentration of 0.1 μg / ml - 5 μg / ml is prepared using a 0.01 M PBS solution.
[0028] Preferably, after each step of S11 - S12, the gate electrode is rinsed three times. Preferably, the rinsing solution is a TBST solution containing 0.05% Tween-20.
[0029] More specifically, the operation process of step (3) includes:
[0030] Dissolve the double-stranded RNA with a 10 mM TBS buffer solution containing 1 mM EDTA and 1 mM TCEP, then drop it onto the gate and incubate at 4 °C for 12 h; the concentration of the double-stranded RNA is 0.1 μM - 10 μM, and the dropping volume of the solution is 5 μL - 10 μL;
[0031] Rinse the electrode three times with the TBS buffer solution, then dry it with nitrogen and drop a mixed solution of MCH and BSA to block at room temperature for 1 h; the mixed solution of MCH and BSA is prepared with ultrapure water, with a concentration of 1 mM MCH and 1 wt% BSA, and the dropping volume is 5 μL - 10 μL;
[0032] Rinse the electrode three times with the TBS buffer solution, then dry it with nitrogen and drop a solution of streptavidin-poly-HRP conjugate; the solution of streptavidin-poly-HRP conjugate is prepared with a PBS buffer solution, with a concentration of 0.1 μg / ml - 5 μg / ml, and the dropping volume is 5 μL - 10 μL.
[0033] In a third aspect, the present invention provides an application of the ADAR1 enzyme organic electrochemical transistor sensor based on polyhorseradish peroxidase described in the first aspect, and the sensor is used to detect the ADAR1 enzyme.
[0034] According to an embodiment of the present invention, a method for detecting the ADAR1 enzyme using the sensor described in the first aspect includes the following steps:
[0035] S21, drop 100 μL of 0.01 M PBS solution and 100 μL of single-component TMB (3,3',5,5'-tetramethylbenzidine) chromogenic solution to cover the gate and the channel, and then detect the channel current value at equilibrium;
[0036] S22, drop different concentrations of ADAR1 enzyme solution onto the gate and react at room temperature for 1 h, test the channel current of the reacted sensor, and obtain the channel current value;
[0037] S23, take the channel current value as the ordinate and the logarithm of the ADAR1 enzyme concentration as the abscissa to establish the working curve or linear equation for the sensor to detect the ADAR1 enzyme, and further realize the quantitative analysis and detection of the ADAR1 enzyme in the test solution.
[0038] Optionally, the ADAR1 enzyme solution is prepared using TBS solution.
[0039] Preferably, in step S22, the concentration of the ADAR1 enzyme solution is 10 fM - 100 nM, and the dropping amount is 5 μL - 10 μL.
[0040] The low-concentration linear range of the detection method is 10 fM to 1 nM, and the detection limit is 6.6 fM.
[0041] The main technical concept of the present invention is as follows: The present invention uses double-stranded RNA as a detection probe, and uses a gate coupled with poly-HRP as a signal amplification probe as a detection component. The analyte ADAR1 enzyme can specifically affect the sequence of double-stranded RNA, thereby affecting processes such as the stability and splicing of RNA. A large number of HRP units on poly-HRP can efficiently catalyze the chromogenic substrate to generate free ions and electrons. The free ions and electrons generated by the catalysis are doped into the channel under the regulation of the gate voltage, and the carrier concentration of the channel changes, and then a readable channel current signal value can be generated. When the ADAR1 enzyme makes part of the RNA ineffective, the coupled poly-HRP will also lose its ability to catalyze the substrate, resulting in a decrease in the channel current, thus showing the sensing performance for the ADAR1 enzyme.
[0042] Compared with the prior art, the beneficial effects of the present invention are:
[0043] First, the present invention detects the concentration of the analyte ADAR1 enzyme by monitoring the change in channel current. A double-stranded RNA specific to the ADAR1 enzyme is introduced as a detection probe, and a poly-HRP is conjugated as a signal amplification probe. The strong ability of poly-HRP to catalyze the substrate enables the invention to exhibit high sensitivity, low detection limit, and wide linear range at low concentrations in the detection of ADAR1 enzyme, capable of achieving the detection of ADAR1 enzyme. BRIEF DESCRIPTION OF THE DRAWINGS
[0044] Figure 1 FIG. is a cross-sectional view of the structure of an ADAR1 enzyme organic electrochemical transistor sensor based on poly-horseradish peroxidase in one embodiment.
[0045] Figure 2 FIG. is a gate modification structure diagram in one embodiment.
[0046] Figure 3 FIG. is a sensor mechanism diagram in an embodiment of the present invention.
[0047] Figure 4 FIG. shows the influence of double-stranded RNA solutions with different concentrations on the current value.
[0048] Figure 5 FIG. shows the influence of streptavidin-poly-HRP conjugate solutions with different concentrations on the current value.
[0049] Figure 6 FIG. shows the change in the transfer curve of an ADAR1 enzyme organic electrochemical transistor sensor based on poly-horseradish peroxidase after reacting with different concentrations of ADAR1 enzyme in an application example of the present invention.
[0050] Figure 7 FIG. shows the time-current curves of an ADAR1 enzyme organic electrochemical transistor sensor based on poly-horseradish peroxidase for different concentrations of ADAR1 enzyme in an application example of the present invention in a PBS buffer solution.
[0051] Figure 8 FIG. shows the working curve of an ADAR1 enzyme organic electrochemical transistor sensor based on poly-horseradish peroxidase for detecting ADAR1 enzyme in an application example of the present invention. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0052] To better understand the present invention, the following further clarifies the content of the present invention in conjunction with the drawings and embodiments, but the present invention is not limited to the following embodiments.
[0053] See Figure 1, the present invention provides an ADAR1 enzyme organic electrochemical transistor sensor based on poly horseradish peroxidase, comprising: a substrate 1, a drain 2, a source 3, a gate 4, and an n-type organic semiconductor material layer 5, wherein the drain 2, the source 3, and the gate 4 are disposed on the substrate 1, and the n-type organic semiconductor material layer 5 is disposed above the drain 2 and the source 3 and on the channel 6 therebetween, and the n-type organic semiconductor material layer 5 is in direct contact with the substrate 1. Among them, double-stranded RNA is fixed on the surface of the gate 4, and poly HRP is connected to the double-stranded RNA; the material of the n-type organic semiconductor material layer 5 is P(NDIDTYM-TT).
[0054] See Figure 2 , the gate 4 includes a titanium layer 41 and a gold layer 42, an RNA layer 43 is fixed on the gold layer 42, and a conjugate layer 44 is connected to the RNA layer 43, wherein the RNA layer 43 is composed of double-stranded RNA, and the double-stranded RNA is fixed on the surface of the gold layer 42 by thiol modification, and the conjugate layer 44 is composed of streptavidin-poly HRP conjugate. Preferably, the material of the substrate 1 is glass. After the glass is cleaned, the gate 4 is prepared on its surface, and the titanium layer 41 is directly evaporated on the surface of the cleaned glass. In the following examples, the streptavidin-poly HRP80 conjugate is purchased from Fitzgerald, model number 65R-S105PHRP.
[0055] To facilitate the understanding of the present invention by those skilled in the art, more specific and detailed examples are further provided herein.
[0056] Example 1
[0057] A preparation method of an ADAR1 enzyme organic electrochemical transistor sensor based on poly horseradish peroxidase comprises the following steps:
[0058] (1) The glass used as the substrate is ultrasonically washed in acetone, isopropyl alcohol, absolute ethanol, and deionized water for 10 minutes in sequence and dried with nitrogen. The electrode is cleaned by oxygen plasma at a power of 120w for two minutes and evaporated, and a channel is formed between the source and the drain; the evaporation rate is controlled at 0.5A / s. The formed drain, source, and gate each independently include a titanium layer and a gold layer, and the titanium layer is located between the substrate and the gold layer. The thickness of the titanium layer evaporated on the substrate is 10nm, and the thickness of the gold layer is 50nm.
[0059] (2) Under a nitrogen atmosphere, 4.6 μL of a 7.5 mg / ml solution of P(NDIDTYM-TT) dissolved in hexafluoroisopropanol is drop-cast on the source and the drain and on the channel therebetween. After film formation, it is placed on a hot stage at 160 °C for annealing for 30 minutes to obtain an n-type organic semiconductor material layer.
[0060] (3) Use oxygen plasma with a power of 120 w to clean the gate for 2 minutes, then drop 6 μL of a double-stranded RNA solution with a concentration of 5 μM to cover the gate and incubate at 4 °C for 12 h; wherein: a double-stranded RNA solution with a concentration of 5 μM is prepared using a 10 mM TBS buffer solution containing 1 mM EDTA (ethylenediaminetetraacetic acid) and 1 mM TCEP; the 3' end of the double-stranded RNA is modified with a thiol group, the 5' end is modified with biotin, and the nucleotide sequence of the double-stranded RNA is 5’GAGCCUGCCCUCUGAUCUCUGCCUGUUCCUCUGUCCCACAGG GGGCAAAGGCUACGGGUCAGAGAGCGGGGAGGACUU3’.
[0061] (4) After rinsing the gate obtained in step (3) three times with TBS solution, drop 6 μL of a mixed solution of 1 mM MCH and 1 wt% BSA to seal the electrode at room temperature for 1 h; wherein: the MCH and BSA mixed solution is prepared using ultrapure water.
[0062] (5) After rinsing the gate obtained in step (4) three times with TBS solution, drop 6 μL of a streptavidin-poly-HRP80 conjugate solution with a concentration of 5 μg / ml and incubate at room temperature for 2 h to achieve coupling with the double-stranded RNA; wherein: the streptavidin-poly-HRP80 conjugate solution is prepared using a PBS buffer solution.
[0063] Example 2
[0064] The difference between this example and Example 1 is that a double-stranded RNA solution with a concentration of 0.1 μM is used.
[0065] Example 3
[0066] The difference between this example and Example 1 is that a double-stranded RNA solution with a concentration of 1 μM is used.
[0067] Example 4
[0068] The difference between this example and Example 1 is that a double-stranded RNA solution with a concentration of 10 μM is used.
[0069] Example 5
[0070] The difference between this example and Example 1 is that a streptavidin-poly-HRP80 conjugate with a concentration of 0.1 μg / ml is used.
[0071] Example 6
[0072] The difference between this example and Example 1 is that a streptavidin-poly-HRP80 conjugate with a concentration of 1 μg / ml is used.
[0073] Example 7
[0074] The difference between this example and Example 1 is that a streptavidin-poly-HRP80 conjugate with a concentration of 3 μg / ml is used.
[0075] Performance Test 1
[0076] The sensors prepared in Examples 1-7 were subjected to the following tests.
[0077] The sensing mechanism is as Figure 3 shown. After rinsing the gate three times with TBS solution, 100 μL of 0.01 M PBS solution and 100 μL of single-component TMB chromogenic solution were added dropwise to cover the gate and channel of the electrochemical transistor sensor, and the channel current value I at equilibrium was detected. This current value is the signal value under different conditions.
[0078] As Figure 4 shown, when the RNA concentration increased from 0.1 μM to 5 μM, the current signal increased accordingly. When the concentration of double-stranded RNA reached 10 μM, the current signal reached saturation. Considering the cost, the preferred concentration of double-stranded RNA for this sensor is 5 μM.
[0079] As Figure 5 shown, when the concentration of streptavidin-poly-HRP conjugate increased from 0.1 μg / ml to 5 μg / ml, the current signal increased accordingly. A concentration of 5 μg / ml of streptavidin-poly-HRP conjugate can already provide a strong current signal, and higher concentrations of streptavidin-poly-HRP conjugate are costly. Therefore, the preferred concentration of streptavidin-poly-HRP conjugate for this sensor is 5 μg / ml.
[0080] Performance Test 2
[0081] The sensor prepared in Example 1 was subjected to the following tests.
[0082] After rinsing the gate three times with TBS solution, 100 μL of 0.01 M PBS solution and 100 μL of single-component TMB chromogenic solution were added dropwise to cover the gate and channel of the electrochemical transistor sensor. A voltage of -0.4 to 0.5 V was applied to the gate and 0.2 V was applied to the drain, and transfer curves were measured by adding 0 M, 100 pM, and 100 nM ADAR1 enzyme solutions to the gate. The results are as Figure 6 shown. After the action of ADAR1 enzyme, the transfer curve shifted to the right, that is, the N-type doping weakened, which was in line with expectations. This was due to the weakening of channel doping caused by the decrease in the concentration of free electrons and free ions catalyzed by poly-HRP in the electrolyte.
[0083] Application Example 1
[0084] The electrochemical transistor sensor prepared in Example 1 was used to detect ADAR1 enzyme, and the detection method included the following steps:
[0085] (1) Prepare an ADAR1 enzyme solution using a TBS solution, and the concentration of the prepared ADAR1 enzyme solution is 10 fM - 100 nM.
[0086] (2) After dropping 100 μL of 0.01 M PBS solution and 100 μL of single-component TMB chromogenic solution to cover the gate and channel of the electrochemical transistor sensor, set the gate applied voltage to 0.55 V, the source and drain voltages to 0.2 V, drop different concentrations of ADAR1 enzyme solution on the gate, react at room temperature for 1 h, and record the channel current value at this time after the detection is stable.
[0087] (3) Taking the channel current value I of the electrochemical transistor sensor in different concentrations of ADAR1 enzyme solution as the ordinate and the logarithm of the ADAR1 enzyme concentration as the abscissa, establish the working curve and linear equation for the electrochemical transistor sensor to detect ADAR1 enzyme, and then realize the quantitative analysis and detection of ADAR1 enzyme in the test solution.
[0088] The results are as Figure 7 shown. It can be seen that as the concentration of ADAR1 enzyme increases, the current value shows a continuous downward trend. Linear fitting was performed on the obtained current values to obtain the working curve of the sensor for detecting ADAR1 enzyme. The working curve is as Figure 8 shown. The linear equation for 100 pM - 100 nM is I(nA) = 268.195 LgC + 922.87, R 2 = 0.975; the linear equation for 100 nM - 10 fM is I(nA) = 75.239 LgC - 995.64, R 2 = 0.991, where C is the concentration of ADAR1 enzyme, and the unit is M.
[0089] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the inventive concept of the present invention, several improvements and transformations can still be made, and these all belong to the protection scope of the present invention.
Claims
1. An ADAR1 enzyme organic electrochemical transistor sensor based on polymerized horseradish peroxidase, characterized in that: include: A substrate, a drain, a source, a gate and an n-type organic semiconductor material layer, wherein the drain, source and gate are arranged on the substrate, the n-type organic semiconductor material layer is arranged on the drain and source and on the channel between the two, and double-stranded RNA is fixed on the surface of the gate, and poly-HRP is connected to the double-stranded RNA.
2. The ADAR1 enzyme organic electrochemical transistor sensor based on polymeric horseradish peroxidase according to claim 1, characterized in that: The drain electrode, the source electrode and the gate electrode independently comprise a titanium layer and a gold layer, wherein the titanium layer is located between a substrate and the gold layer; and the material of the substrate is glass.
3. The ADAR1 enzyme organic electrochemical transistor sensor based on polymeric horseradish peroxidase according to claim 1, characterized in that: The material of the n-type organic semiconductor material layer is P(NDIDTYM-TT), and the structural formula of P(NDIDTYM-TT) is as follows:
4. The ADAR1 enzyme organic electrochemical transistor sensor based on polymeric horseradish peroxidase according to claim 1, characterized in that: The double-stranded RNA is fixed on the gate surface through thiol modification.
5. The ADAR1 enzyme organic electrochemical transistor sensor based on polymeric horseradish peroxidase according to claim 4, characterized in that: The 3' end of the double-stranded RNA is modified with thiol, the 5' end is modified with biotin, and the nucleotide sequence of the double-stranded RNA is 5'GAGCCUGCCCUCUGAUCUCUGCCUGUUCCUCUGUCCCACAG GGGGCAAAGGCUACGGGUCAGAGAGCGGGGAGGACUU3'; the poly-HRP is connected to the double-stranded RNA via streptavidin.
6. The method for preparing an ADAR1 enzyme organic electrochemical transistor based on poly horseradish peroxidase according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) preparing a gate, a source electrode and a drain electrode on the surface of a substrate so that a channel exists between the source electrode and the drain electrode; (2) depositing an n-type organic semiconductor material on a) the channel or b) the source electrode, the drain electrode and the channel to form an n-type organic semiconductor material layer; (3) Double-stranded RNA is fixed on the gate surface, and poly-HRP is linked to the double-stranded RNA.
7. The preparation method according to claim 6, characterized in that: The preparation of the gate, source and drain in step (1) comprises: coating a titanium layer and a gold layer on the glass surface in sequence.
8. The preparation method according to claim 6, characterized in that: The method for forming the n-type organic semiconductor material layer in step (2) comprises: drop casting P(NDIDTYM-TT) at a) the channel or b) the source, drain and channel in a nitrogen atmosphere, and annealing at 160° C. for 30 minutes to obtain the n-type organic semiconductor material layer.
9. The preparation method according to claim 6, characterized in that: The operation process of step (3) includes: S11, a certain concentration of double-stranded RNA solution was dripped onto the gate and incubated at 4 °C for 12 h; S12, add MCH and BSA solution dropwise onto the gate and block at room temperature for 1 hour; S13, a certain concentration of streptavidin-poly HRP80 conjugate solution was dropped onto the gate and incubated at room temperature for 2 h to achieve coupling with double-stranded RNA; In step S11, the 3' end of the double-stranded RNA is modified with a thiol group, and the 5' end is modified with biotin. The nucleotide sequence of the double-stranded RNA is 5'GAGCCUGCCCUCUGAUCUCUGCCUGUUCCUCUGUCCCACAGG GGGCAAAGGCUACGGGUCAGAGAGCGGGGAGGACUU3'.
10. The use of the ADAR1 enzyme organic electrochemical transistor sensor based on polymeric horseradish peroxidase according to any one of claims 1 to 5, characterized in that: The sensor is used to detect the ADAR1 enzyme.
11. The use according to claim 10, characterized in that: The method for detecting ADAR1 enzyme using the sensor comprises the following steps: S21, add 100 μL of 0.01 M PBS solution and 100 μL of single-component TMB colorimetric solution to cover the gate and the channel, and then detect the channel current value when equilibrium is reached; S22, dropping ADAR1 enzyme solutions of different concentrations onto the gate for reaction at room temperature for 1 hour, and testing the channel current of the sensor after the reaction to obtain the channel current value; S23, using the channel current value as the ordinate and the logarithmic value of the ADAR1 enzyme concentration as the abscissa, establishing a working curve or a linear equation for the sensor to detect the ADAR1 enzyme, thereby achieving quantitative analysis and detection of the ADAR1 enzyme in the test solution.