A method, apparatus, device, and storage medium for simulating amplicons of a primer on a genome

Abstract

The application relates to a method, device, equipment and storage medium for simulating amplicons of primers on a genome. The application designs a novel method for simulating amplicons of primers on a genome, focuses on supporting high-degeneracy primers, can accurately cope with complex primer conditions, allows flexible setting of mismatch number parameters, thereby effectively improving the accuracy and reliability of simulated amplification, can significantly improve the running efficiency by means of multi-thread technology, can cope with large-scale genome set processing tasks, is developed based on the Go language, can stably run in mainstream systems such as Linux and Windows, realizes perfect balance between running speed and stability, fully compensates for the deficiencies of the prior art, and provides strong technical support and guarantee for primer simulation amplification work related to targeted sequencing in the field of gene detection.

Description

Technical Field

[0001] This invention belongs to the field of bioinformatics technology and relates to a method, apparatus, device and storage medium for simulating primers to amplify genomes. Background Technology

[0002] In the field of gene sequencing, targeted sequencing is widely used in viral Sanger typing, qPCR quantification, ddPCR quantification, and tNGS pathogen detection. For primer design during sequencing, inclusion characteristics are particularly crucial. Degenerate primers are typically used to improve the sensitivity of microbial amplification, allowing primers to cover more genomes within a wider range of types or subtypes. Primer amplicon simulation refers to using computer software to simulate the amplification of the target DNA fragment, optimizing the efficiency and specificity of PCR or other amplification techniques. For example, before performing wet experiments, computer simulations can predict inclusion (i.e., coverage), eliminating unsuitable primers in advance, thereby reducing the number of wet experiment reactions and saving time and money.

[0003] Currently, software for primer amplicon simulation, such as SnapGene, seqkit amplicon, and isPCR, can extract potential target region sequences for amplification based on the positions of upstream and downstream primers on the genome. However, these software programs also have some shortcomings. For example, seqkit amplicon suffers a significant drop in amplification accuracy under high mismatch parameter settings. When a pair of primers has multiple matching sites on the genome, the software only outputs the longest amplicon. However, according to the principle of competitive amplification, short amplicon is the main primer consumer, which is obviously contrary to the actual amplification situation. isPCR does not support degenerate primers. Given the high mutation frequency of proviruses, degenerate primers are widely used, and isPCR cannot meet the needs of use under complex primer conditions. SnapGene software is a Windows desktop version, which is inadequate when dealing with genome sets of hundreds or thousands of genomes. Furthermore, its closed-source nature limits further functional expansion and optimization, which is not conducive to widespread application and collaborative development.

[0004] Given the many shortcomings of existing simulated amplicon software, developing a simulated amplicon method that allows for flexible selection of mismatch parameters, supports degenerate primers, and enables high-throughput processing is of great significance to the field of primer design. Summary of the Invention

[0005] To address the shortcomings of existing technologies and practical needs, this invention provides a method, apparatus, device, and storage medium for simulating primers to amplify genomes, effectively improving the accuracy, reliability, and processing efficiency of simulated amplification.

[0006] To achieve this objective, the present invention adopts the following technical solution:

[0007] In a first aspect, the present invention provides a method for simulating primers to amplify genomes, the method comprising the following steps:

[0008] (1) Obtain the primer sequence to be simulated and the target genome sequence; if the primer to be simulated is a degenerate primer, extend the degenerate primer into all primer sequences without degenerate bases according to the degenerate base composition (replace the degenerate bases with the corresponding nucleic acid bases);

[0009] (2) Sliding window cutting of the target genome sequence to obtain the sequence within the window;

[0010] (3) Calculate the edit distance between the primer sequence to be simulated and the sequence in each window, and obtain the position of the sequence in the genome in the window whose edit distance is not greater than the mismatch number threshold;

[0011] (4) Write the positions on the genome obtained in step (3) into the lists of upstream primers and downstream primers respectively. The starting position of the sliding window on the genome is the upstream primer, and the ending position is the downstream primer.

[0012] (5) Based on the upstream and downstream primers obtained in step (4), select the two closest positions of the upstream and downstream primers as the final amplicon positions and extract the amplicon sequence.

[0013] This invention develops a novel simulated amplicon method that focuses on supporting high degenerate primers, accurately handling complex primer situations, and allowing flexible setting of mismatch parameters, thereby effectively improving the accuracy and reliability of amplification. Multithreading technology significantly improves operational efficiency to handle large-scale genome processing tasks. The program can be developed and run using the Go language and runs stably on mainstream systems such as Linux and Windows, achieving a perfect balance between speed and stability. It comprehensively overcomes the shortcomings of existing technologies, providing strong technical support and assurance for primer simulation amplification work related to targeted sequencing in the field of gene detection, and promoting further development and innovation in this field.

[0014] Preferably, the method further includes repeating steps (2)-(5) on different target genome sequences to obtain simulated amplicones of the primer to be simulated on all target genome sequences.

[0015] Preferably, the length of the sliding cut is the length of the primer to be simulated, with a step size of 1 to 3 bp.

[0016] Preferably, the mismatch threshold is 3.

[0017] Preferably, the sequence alignment process can be implemented using Go language channel multithreading.

[0018] As a preferred technical solution, the method for amplifying genomes using simulated primers includes the following steps:

[0019] (1) Obtain the primer sequence to be simulated and the target genome sequence; if the primer to be simulated is a degenerate primer, then extend the degenerate primer into primer sequences with no degenerate bases according to the degenerate composition;

[0020] (2) Sliding window cutting of the target genome sequence, with the window size being the length of the primer to be simulated and the step size being 1-3 bp, to obtain the sequence within the window;

[0021] (3) Calculate the edit distance between the primer sequence and the sequence within each window, and obtain the position of the sequence within the window with an edit distance of no more than 3 on the genome;

[0022] (4) Write the positions on the genome obtained in step (3) into the lists of upstream primers and downstream primers respectively. The starting position of the sliding window on the genome is the upstream primer, and the ending position is the downstream primer.

[0023] (5) Based on the upstream and downstream primers obtained in step (4), select the two closest positions of the upstream and downstream primers as the final amplicon positions and extract the amplicon sequence;

[0024] (6) Repeat steps (2)-(5) for different target genome sequences to obtain simulated amplicon of the primer to be simulated in all target genome sequences.

[0025] In a second aspect, the present invention provides an apparatus for simulating primer amplification on the genome, the apparatus comprising:

[0026] The sequence acquisition unit is used to perform tasks including acquiring the primer sequence to be simulated and the target genome sequence; if the primer to be simulated is a degenerate primer, the degenerate primer is extended into primer sequences with all non-degenerate bases according to the degenerate composition;

[0027] The sequence cutting unit is used to perform operations including sliding window cutting of the target genome sequence to obtain the sequence within the window;

[0028] The computing unit is used to perform operations including calculating the edit distance between the primer sequence and the sequence within each window, and obtaining the position of the sequence within the window whose edit distance is not greater than the mismatch number threshold on the genome;

[0029] The matching unit is used to perform the following: writing the positions on the genome obtained by the computing unit into the lists of upstream primers and downstream primers, respectively, with the starting position of the sliding window on the genome being the upstream primer and the ending position being the downstream primer;

[0030] The extraction unit is used to perform the following: based on the upstream and downstream primers obtained in the matching unit, select the two closest positions of the upstream and downstream primers as the final amplicon positions, and extract the amplicon sequence.

[0031] Preferably, the method further includes operations on repetitive sequence cutting units, calculation units, matching units, and extraction units for different target genome sequences to obtain simulated amplicones of the primer to be simulated in all target genome sequences.

[0032] Preferably, the length of the sliding cut is the length of the primer to be simulated, with a step size of 1 to 3 bp.

[0033] Preferably, the mismatch threshold is 3.

[0034] Thirdly, the present invention provides an electronic device comprising a memory, a processor, and a computer program stored in the memory and executable on the processor, wherein the processor executes the computer program to implement the steps of the method for amplifying a genome using simulated primers as described in the first aspect.

[0035] Fourthly, the present invention provides a computer-readable storage medium storing a computer program that, when executed by a processor, implements the steps of the method for amplifying a genome using simulated primers as described in the first aspect.

[0036] Compared with the prior art, the present invention has at least the following beneficial effects:

[0037] This invention presents a novel method for amplifying genomes using simulated primers, emphasizing support for high degenerate primers. It accurately addresses complex primer scenarios, allows for flexible setting of mismatch parameters, thereby effectively improving the accuracy and reliability of amplification. Multithreading technology significantly enhances operational efficiency to handle large-scale genome processing tasks. Developed using the Go programming language, it runs stably on mainstream systems such as Linux and Windows, achieving a perfect balance between speed and stability. This invention comprehensively addresses the shortcomings of existing technologies, providing strong technical support and assurance for primer simulation amplification related to targeted sequencing in the field of gene detection, and promoting further development and innovation in this field. Detailed Implementation

[0038] The technical solution of the present invention will be further illustrated below through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention is determined by the claims.

[0039] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased from legitimate channels.

[0040] In a specific embodiment of this invention, the seqkit amplicon software is a cross-platform, ultra-fast toolkit developed under the MIT license by Shen Wei of Chongqing Medical University, specifically for FAST / Q file operations. Amplicon is a subroutine of seqkit, whose function is to extract amplicons (or specific regions around them) using primers. When using this software, the following points should be noted:

[0041] 1. The software only outputs the longest matching position;

[0042] 2. Mismatches are allowed, and users can adjust the number of threads and the parameters for allowing mismatches as needed;

[0043] 3. The software supports degenerate bases, but does not allow their use in regular expressions.

[0044] isPCR software is a PCR simulation software developed by Jim Kent of UCSC (University of California, Santa Cruz). Using this software requires a sequence database and a primer input file containing three columns of information (name, forward primer, and reverse primer). Both software programs mentioned above are available from BIOCONDA.

[0045] Example 1

[0046] This embodiment provides a method for simulating amplicon.

[0047] (1) Parameters

[0048] Required parameters: upstream primer sequence, downstream primer sequence; reference genome set FASTA file;

[0049] Optional parameters: Maximum number of mismatches, default 3, the number of mismatches is the maximum number of different bases allowed between the primer and the template; Maximum number of concurrent threads, default 1; Output file path name.

[0050] (2) Calculation method

[0051] A multi-threaded sequence channel is enabled, and the genome is iteratively written into the sequence channel one by one. The number of extraction tasks that can be performed concurrently is allocated according to the thread limit. The extraction method is as follows:

[0052] 1) If the primers are degenerate primers, the degenerate base primers need to be extended into all primer sequences without degenerate bases according to the degenerate composition and stored in a list.

[0053] The degeneracy rule table is shown in Table 1.

[0054] Table 1

[0055]

[0056]

[0057] For example, a primer degenerate primer sequence is as follows:

[0058] CG(Y)TGGATGCG(N)TTCATGA.

[0059] The extended primer list is as follows:

[0060] CG(C)TGGATGCG(A)TTCATGA;

[0061] CG(C)TGGATGCG(T)TTCATGA;

[0062] CG(C)TGGATGCG(G)TTCATGA;

[0063] CG(C)TGGATGCG(C)TTCATGA;

[0064] CG(T)TGGATGCG(A)TTCATGA;

[0065] CG(T)TGGATGCG(T)TTCATGA;

[0066] CG(T)TGGATGCG(G)TTCATGA;

[0067] CG(T)TGGATGCG(C)TTCATGA.

[0068] 2) Sliding window cuts the genome sequence, with the window size being the primer length and the step size being 1, to obtain the sequence set within the window;

[0069] For example, the genome sequence is:

[0070] GTGAATGAAGATGGCGTCTAACGACGCTGCCACTGCGACCGCTGG;

[0071] It can be cut into:

[0072] GTGAATGAAGATGGCGTCTA

[0073] TGAATGAAGATGGCGTCTAA

[0074] GAATGAAGATGGCGTCTAAC

[0075] AATGAAGATGGCGTCTAACG

[0076] ATGAAGATGGCGTCTAACGA

[0077] ...

[0078] 3) Iterate through the primer list, align the primers with the window sequence set, calculate the edit distance between the primers and the sequence within each window, and obtain the position of the sequence within the window whose edit distance is within the mismatch threshold on the genome.

[0079] 4) The genomic locations obtained in step 3) are written into the lists of upstream and downstream primers, respectively. The starting position of the sliding window on the genome is the upstream primer, and the ending position is the downstream primer.

[0080] 5) Based on the principle of competitive PCR amplification, select the two closest positions of the upstream and downstream primers as the final simulated amplicon positions, i.e. the shortest amplicon, and extract the corresponding sequence to add to the final results list.

[0081] 6) Continue iterating over the genome set, repeating steps 2)-5) above, to simulate primer amplicones across all target genomes. This step allows you to specify the number of threads to enable concurrent channels and improve analysis speed. The final results list is then written to the results document.

[0082] Example 2

[0083] This embodiment uses the SEQ ID NO.1 sequence as an example to further verify the method of the present invention.

[0084] SEQ ID NO.1:

[0085] GTGAATGAAGATGGCGTCTAACGACGCTGCCACTGCGACCGCTGGCACTACACCTTTTGCTGTTCTAACGACGCTGCCACTGCTGGGTCTTAGACGCCAGTTGTTCTCGGTGGTATTGGCATGGTCCTTGGTTTCACCAAAGAGAGGATTGGCCGACTACTGAGCAGGATTAGATACTATGTCATTCAGCTGCGCGTAGA GCCAGGATTAGATACTATGTCAAGTGTTTCCAAGAAATGATCTACTCACT.

[0086] Viruses are highly diverse and conserved regions are difficult to find. Sometimes primers have to be designed with multiple homologous sequence positions within the genome. For example, the upstream primer sequence is: TCTAACGACGCTGCCACTGC, and the downstream primer sequence is: TGACATAGTATCTAATCCTG.

[0087] The simulated primer amplicon was performed according to the method in Example 1, and the output result is SEQ ID NO.2:

[0088] TCTAACGACGCTGCCACTGCGACCGCTGGCACTACACCTTTTGCTGTTCTAACGACGCTGCCACTGCTGGGTCTTAGACGCCAGTTGTTCTCGGTGGTATTGGCATGGTCCTTGGTTTCACCAAAGAGAGGATTGGCCGACTACTGAGCAGGATTAGATACTATGTCA.

[0089] Amplicon simulation was performed using the seqkit amplicon software. The parameters were set as follows: -P for searching only the positive strand (since all examples used single-stranded RNA viruses); -m3 for allowing a maximum of 3 mismatched bases, consistent with the method of this invention; and -j4 for using 4 threads. The output is SEQ ID NO. 3.

[0090] TCTAACGACGCTGCCACTGCGACCGCTGGCACTACACCTTTTGCTGTTCTAACGACGCTGCCACTGCTGGGTCTTAGACGCCAGTTGTTCTCGGTGGTATTGGCATGGTCCTTGGTTTCACCAAAGAGAGGATTGGCCGACTACTGAGCAGGATTAGATACTATGTCATTCAGCTGCGCGTAGAGCCAGGATTAGATACTATGTCA.

[0091] As can be seen, the method of this invention selects the final amplicon length of 168 bp based on the smallest amplicon length of the upstream and downstream primers. However, seqkit amplicon selects the longest amplicon, with a final length of 206 bp. If the middle fragment is longer, seqkit amplicon will produce a longer amplicon, which is obviously an incorrect amplification product.

[0092] Example 3

[0093] This embodiment simulates the echovirus type 11 primer amplicon.

[0094] The upstream primer sequence was: RCARTCCTCHTGYGTRYTRTGYA, and the downstream primer sequence was: CYTTYARYARYCGGACRGAGAA. In the NCBI Virus database (reference URL: https: / / www.ncbi.nlm.nih.gov / labs / virus / vssi / # / virus?SeqType_s=Nucleotide), based on species ID (taxid) "12078", genome integrity (Completeness_s) "complete", and host (HostLineage_ss) "Homo sapiens (human)", 99 complete genomes of echovirus type 11 were screened.

[0095] Amplicon extraction was performed using the method of this invention and seqkit amplicon, respectively. However, isPCR could not be used due to the presence of degenerate primers.

[0096] Sensitivity is the number of genomes successfully simulated and amplified, while accuracy is determined based on the length of the target region and the position of the BLAST alignment to the reference genome. The results are shown in Table 2, indicating that the method of the present invention has high sensitivity and accuracy.

[0097] Table 2

[0098] experimental group sensitivity accuracy the method of the invention 99(100％) 99(100％) seqkit amplicon 85(85.85％) 85(100％)

[0099] Example 4

[0100] This embodiment simulates the primer amplicon of norovirus GII.

[0101] The upstream primer sequence was: CARGARBCNATGTTYAGRTGGATGAG, and the downstream primer sequence was: CCRCCNGCATRHCCRTTRTACAT. 605 complete genomes of GII-type norovirus were screened from the NCBI Virus database based on the species ID (taxid) "122929", genome integrity (Completeness_s) "complete", and host (HostLineage_ss) "Homo sapiens (human)".

[0102] Amplicon extraction was performed using the method of this invention and seqkit amplicon, respectively. Degenerate primers were present, making isPCR unusable. The results are shown in Table 3, indicating that the method of this invention has high sensitivity and accuracy.

[0103] Table 3

[0104] experimental group sensitivity accuracy the method of the invention 605(100％) 605(100％) seqkit amplicon 575(95.04％) 575(100％)

[0105] Example 5

[0106] This embodiment simulates the primer amplicon of the novel coronavirus.

[0107] The upstream primer sequence was CCCTGTGGGTTTTACACTTAA, and the downstream primer sequence was ACGATTGTGCATCAGCTGA. 1000 complete genomes of the novel coronavirus plus the reference genome NC_045512.2 were randomly downloaded from the NCBI Virus database based on the species ID (taxid) "2697049", genome integrity (Completeness_s) "complete", and host (HostLineage_ss) Homo sapiens (human).

[0108] Amplicon extraction was performed using the method of this invention, seqkit amplicon, and isPCR (with the parameter -maxSize=2000 to allow output of amplicon sequences up to 2000bp, consistent with the method of this invention; all other parameters were default). The results are shown in Table 4, indicating that the method of this invention has high sensitivity and accuracy.

[0109] Table 4

[0110] sensitivity accuracy the method of the invention 1001(100％) 1001(100％) seqkit amplicon 1001(100％) 1001(100％) isPCR 999(99.80％) 999(100％)

[0111] Example 6

[0112] This invention provides an apparatus for simulating primer amplification on the genome, the apparatus comprising:

[0113] The sequence acquisition unit is used to perform tasks including acquiring the primer sequence to be simulated and the target genome sequence; if the primer to be simulated is a degenerate primer, the degenerate primer is extended into primer sequences with all non-degenerate bases according to the degenerate composition;

[0114] The sequence cutting unit is used to perform operations including sliding window cutting of the target genome sequence to obtain the sequence within the window;

[0115] The computing unit is used to perform operations including calculating the edit distance between the primer sequence and the sequence within each window, and obtaining the position of the sequence within the window whose edit distance is not greater than the mismatch number threshold on the genome;

[0116] The matching unit is used to perform the following: writing the positions on the genome obtained by the computing unit into the lists of upstream primers and downstream primers, respectively, with the starting position of the sliding window on the genome being the upstream primer and the ending position being the downstream primer;

[0117] The extraction unit is used to perform the following: based on the upstream and downstream primers obtained in the matching unit, select the two closest positions of the upstream and downstream primers as the final amplicon positions, and extract the amplicon sequence.

[0118] Example 7

[0119] This embodiment provides an electronic device, which includes a memory, a processor, and a computer program stored in the memory and executable on the processor. When the processor executes the computer program, it implements the steps of the method for amplifying a genome using simulated primers as described in Embodiment 1.

[0120] Those skilled in the art will understand that the device of the present invention can be obtained using various forms of hardware, software, firmware, dedicated processors, or combinations thereof.

[0121] Example 8

[0122] This embodiment provides a computer-readable storage medium storing a computer program having program code that, when run in a corresponding processor, controller, computing device, or terminal, implements the steps of the method for amplifying a genome using simulated primers as described in Embodiment 1.

[0123] In summary, this invention presents a novel method for amplifying genomes using simulated primers, emphasizing support for high degenerate primers. It accurately addresses complex primer scenarios, allows for flexible setting of mismatch parameters, thereby effectively improving the accuracy and reliability of amplification. Multithreading technology significantly enhances operational efficiency to handle large-scale genome processing tasks. Developed using the Go programming language, it runs stably on mainstream systems such as Linux and Windows, achieving a perfect balance between speed and stability. This invention comprehensively addresses the shortcomings of existing technologies, providing strong technical support and assurance for primer simulation amplification related to targeted sequencing in the field of gene detection, and promoting further development and innovation in this field.

[0124] The applicant declares that the above description is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention fall within the protection and disclosure scope of the present invention.

Claims

1. A method of simulating the amplification of a primer on a genome, characterized in that, The method comprises the following steps: (1) obtaining a primer sequence to be simulated and a target genomic sequence; if the primer to be simulated is a degenerate primer, the degenerate primer is extended into all primer sequences without degenerate bases according to the degenerate base composition; (2) cutting the target genomic sequence by a sliding window to obtain a sequence within the window, the length of the sliding window cutting is the length of the primer to be simulated, and the step length is 1-3 bp; (3) calculating the edit distance between the primer sequence to be simulated and each sequence within the window, obtaining the position of the sequence within the window on the genome corresponding to the edit distance not greater than the mismatch threshold, and the mismatch threshold is 3; (4) writing the positions on the genome obtained in step (3) into the lists of upstream primers and downstream primers respectively, the starting position of the sliding window on the genome is the upstream primer, and the ending position is the downstream primer; (5) selecting the two closest positions of the upstream primer and the downstream primer as the final amplicon positions according to the upstream primer and the downstream primer obtained in step (4), and extracting the amplicon sequence.

2. The method for amplifying genomes using simulated primers according to claim 1, characterized in that, The method further comprises repeating steps (2)-(5) for different target genomic sequences to obtain the simulated amplicon of the primer to be simulated in all target genomic sequences.

3. An apparatus for simulating the amplification of a primer on a genome, characterized by, The device comprises: a sequence acquisition unit configured to perform operations comprising obtaining a primer sequence to be simulated and a target genomic sequence; if the primer to be simulated is a degenerate primer, the degenerate primer is extended into all primer sequences without degenerate bases according to the degenerate base composition; a sequence cutting unit configured to perform operations comprising cutting the target genomic sequence by a sliding window to obtain a sequence within the window; the length of the sliding window cutting is the length of the primer to be simulated, and the step length is 1-3 bp; a calculation unit configured to perform operations comprising calculating the edit distance between the primer sequence and each sequence within the window, and obtaining the position of the sequence within the window on the genome corresponding to the edit distance not greater than the mismatch threshold; the mismatch threshold is 3; a matching unit configured to perform operations comprising writing the positions on the genome obtained by the calculation unit into the lists of upstream primers and downstream primers respectively, the starting position of the sliding window on the genome is the upstream primer, and the ending position is the downstream primer; an extraction unit configured to perform operations comprising selecting the two closest positions of the upstream primer and the downstream primer as the final amplicon positions according to the upstream primer and the downstream primer obtained by the matching unit, and extracting the amplicon sequence.

4. The apparatus of claim 3, wherein the analog primers are configured to amplify a genomic target. 5 The device further comprises repeating the operations of the sequence cutting unit, the calculation unit, the matching unit, and the extraction unit for different target genomic sequences to obtain the simulated amplicon of the primer to be simulated in all target genomic sequences.

5. An electronic device comprising a memory, a processor, and a computer program stored in the memory and executable on the processor, characterized in that, The processor executes the computer program to implement the steps of the method for simulating the amplicon of the primer on the genome according to claim 1 or 2.

6. A computer-readable storage medium storing a computer program, the computer program comprising instructions that, when executed by a computer, cause the computer to perform the method of any one of claims 1 to 5. The computer program is executed by the processor to implement the steps of the method for simulating the amplicon of the primer on the genome according to claim 1 or 2.

Images