Black grid callus induction and regeneration seedling method

Abstract

The invention belongs to the technical field of plant cultivation, and particularly relates to a method for inducing and regenerating calluses of black galls. Comprising the following steps: performing callus induction on black germs, performing regeneration induction culture on the callus to obtain regenerated buds, and further performing subculture and rooting culture to obtain seedlings. According to the method, the callus regeneration induction rate is increased.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant cultivation, and particularly relates to a method for inducing callus of Archidendron lucidum and regenerating seedlings therefrom. Background Art

[0002] The description of the background art of the present invention belongs to the related art related to the present invention, and is only used to illustrate and facilitate the understanding of the content of the present invention. It should not be understood that the applicant clearly believes or presumes that the applicant believes it to be the prior art on the filing date of the first application of the present invention.

[0003] Archidendron lucidum, also known as Albizia odoratissima, is one of the native broad-leaved timber tree species in Guangxi. The economic value, ecological value and medicinal value of Albizia odoratissima are all worthy of people's attention. Albizia odoratissima is generally propagated by sowing, lacking mature and stable asexual tissue culture propagation technology, which restricts the large-scale breeding of excellent seedlings of Archidendron lucidum.

[0004] The transgenic and gene editing breeding of Archidendron lucidum has not been carried out all the time. The main bottleneck lies in the lack of genetic transformation technology. The present invention further improves the existing technology to solve the existing problems. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for inducing callus of Archidendron lucidum and regenerating seedlings therefrom to solve the deficiencies in the prior art.

[0006] A method for inducing callus of Archidendron lucidum and regenerating seedlings therefrom includes the following steps: inducing callus of Archidendron lucidum, then inducing the callus to regenerate to obtain regenerated buds, and further obtaining seedlings through subculture and rooting culture.

[0007] Further, the callus induction adopts a callus induction medium; the hypocotyl of the seedlings obtained by aseptic sowing of Archidendron lucidum is used as the explant.

[0008] Further, the explant is processed through the following steps:

[0009] The hypocotyl obtained by aseptic sowing of Archidendron lucidum seeds is cut into segments of 0.3 - 0.6 cm, the segments are longitudinally cut again, and the cut surface is inoculated downward in the callus induction medium for callus induction;

[0010] The callus induction medium is prepared from the following components by weight: 383 - 565 parts of potassium nitrate, 302 - 430 parts of ammonium nitrate, 32 - 44 parts of potassium dihydrogen phosphate, 56 - 96 parts of magnesium sulfate heptahydrate, 49 - 147 parts of calcium chloride dihydrate, 0.05 - 0.25 parts of potassium iodide, 0.74 - 2.21 parts of boric acid, 3.68 - 6.38 parts of manganese sulfate tetrahydrate, 1.23 - 2.95 parts of zinc sulfate heptahydrate, 0.004 - 0.008 parts of copper sulfate pentahydrate, 7.86 - 10.56 parts of disodium ethylenediaminetetraacetate, 5.87 - 7.89 parts of ferrous sulfate heptahydrate, 12.27 - 31.91 parts of inositol, 0.25 - 0.74 parts of glycine, 0.017 - 0.032 parts of thiamine hydrochloride, 0.025 - 0.049 parts of nicotinic acid, 6137 - 8592 parts of sucrose, 1350 - 1841 parts of agar, 0.001 - 0.006 parts of naphthylacetic acid, 0.01 - 0.05 parts of N6-furfuryladenine, and 0.02 - 0.05 parts of 6-benzylaminopurine; the pH of the callus induction medium is 6.0 - 6.5; the callus induction culture conditions are: culturing for 7 - 10 days in a dark and lightless environment, and maintaining the temperature at 28 ± 2 °C in the dark environment.

[0011] Further, for the callus regeneration induction culture, a regeneration induction medium is used. The regeneration induction medium is prepared from the following components by weight: 383 - 565 parts of potassium nitrate, 302 - 430 parts of ammonium nitrate, 32 - 44 parts of potassium dihydrogen phosphate, 56 - 96 parts of magnesium sulfate heptahydrate, 49 - 147 parts of calcium chloride dihydrate, 0.05 - 0.25 parts of potassium iodide, 0.74 - 2.21 parts of boric acid, 3.68 - 6.38 parts of manganese sulfate tetrahydrate, 1.23 - 2.95 parts of zinc sulfate heptahydrate, 0.004 - 0.008 parts of copper sulfate pentahydrate, 7.86 - 10.56 parts of disodium ethylenediaminetetraacetate, 5.87 - 7.89 parts of ferrous sulfate heptahydrate, 12.27 - 31.91 parts of inositol, 0.25 - 0.74 parts of glycine, 0.017 - 0.032 parts of thiamine hydrochloride, 0.025 - 0.049 parts of nicotinic acid, 6137 - 8592 parts of sucrose, 1350 - 1841 parts of agar, 0.01 - 0.04 parts of naphthylacetic acid, 0.001 - 0.006 parts of N6-furfuryladenine, 0.03 - 0.07 parts of 6-benzylaminopurine, and 0.01 - 0.04 parts of indoleacetic acid; the pH of the regeneration induction medium is 6.2 - 6.4; the regeneration induction culture conditions are: culturing for 14 - 20 days in an environment with 8 h of light per day, at a temperature of 28 ± 2 °C, and a light intensity of 1500 - 2000 lx.

[0012] The specific treatment for the regeneration induction is: cutting the Heig callus into pieces, soaking them in a DNA solution of 0.5 - 2 μg / μl, taking out the callus pieces after vacuuming for 10 - 15 min, and placing the cut surface downward on the regeneration induction medium.

[0013] Further, the method for preparing the DNA solution: Based on the pCAMBIA series or pBI121 plant expression vector, a recombinant plasmid is constructed using the 35S or other plant expression promoter-driven sequence 1 and introduced into Escherichia coli. The plasmid is extracted from the overnight culture of the strain in a laminar flow hood; after the obtained plasmid is quantified by nanodrop, it is adjusted to a concentration of 0.5 - 2 μg / μl with sterile ultrapure water;

[0014] The sequence 1 is as shown in SEQ.NO1;

[0015] Further, the subculture of the regenerated buds uses a subculture medium; the subculture medium is prepared from the following components by weight: 383 - 565 parts of potassium nitrate, 302 - 430 parts of ammonium nitrate, 32 - 44 parts of potassium dihydrogen phosphate, 56 - 96 parts of magnesium sulfate heptahydrate, 49 - 147 parts of calcium chloride dihydrate, 0.05 - 0.25 parts of potassium iodide, 0.74 - 2.21 parts of boric acid, 3.68 - 6.38 parts of manganese sulfate tetrahydrate, 1.23 - 2.95 parts of zinc sulfate heptahydrate, 0.004 - 0.008 parts of copper sulfate pentahydrate, 7.86 - 10.56 parts of disodium ethylene diamine tetraacetate, 5.87 - 7.89 parts of ferrous sulfate heptahydrate, 12.27 - 31.91 parts of inositol, 0.25 - 0.74 parts of glycine, 0.017 - 0.032 parts of thiamine hydrochloride, 0.025 - 0.049 parts of nicotinic acid, 6137 - 8592 parts of sucrose, 1350 - 1841 parts of agar, 0.001 - 0.004 parts of naphthylacetic acid, 0.05 - 0.1 parts of 6-benzylaminopurine, 0.08 - 0.15 parts of indoleacetic acid;

[0016] The pH of the subculture medium is 6.0 - 6.4.

[0017] Culturing conditions: One subculture cycle is 20 - 30 days, the temperature is 28 ± 2 °C, and in the first 5 days, it is cultured in an environment with weak light of 1000 - 1500 lx for 12 h per day, and then transferred to an environment with light of 1500 - 3000 lx for 12 h per day.

[0018] Furthermore, rooting culture is carried out using a rooting medium; the rooting medium is prepared from the following components by weight: 89-148 parts of potassium nitrate, 69-78 parts of ammonium nitrate, 7-10 parts of potassium dihydrogen phosphate, 12-22 parts of magnesium sulfate heptahydrate, 12-31 parts of calcium chloride dihydrate, 0.05-0.23 parts of potassium iodide, 0.7-2.1 parts of boric acid, 3.5-6.06 parts of manganese sulfate tetrahydrate, 1.17-2.80 parts of zinc sulfate heptahydrate, 7.46-10.02 parts of disodium ethylene diamine tetraacetate, 5.58-7.49 parts of ferrous sulfate heptahydrate, 11.66-30.31 parts of inositol, 0.23-0.7 parts of glycine, 0.016-0.03 parts of thiamine hydrochloride, 0.023-0.047 parts of nicotinic acid, 2798-6061 parts of sucrose, 1399-1748 parts of agar, 0.09-0.13 parts of indoleacetic acid, 0.06-0.11 parts of indolebutyric acid; the pH of the rooting medium is 5.8-6.2;

[0019] Cultivation conditions: Cultivation is carried out in an environment with 12 hours of light per day and a light intensity of 1500-3000 lx, and the temperature is 28±2°C.

[0020] The embodiments of the present invention have the following beneficial effects:

[0021] The present invention selects the hypocotyl with strong activity for callus induction and differentiation, and realizes the plant regeneration of Hakea through the methods of Hakea callus regeneration induction, subculture and rooting. The regeneration system established by the method of the present invention lays a foundation for the genetic transformation of Hakea.

[0022] In order to improve the callus regeneration induction rate, the present invention optimizes the regeneration induction medium. Through a large number of optimization adjustments of the components of the regeneration induction medium and the adjustment of the dosage ratio of each component, the use of the regeneration induction medium can more effectively promote the regeneration induction culture of Hakea callus;

[0023] The present invention uses Sequence 1, a transcription factor sequence discovered in the study of eucalyptus callus regeneration, in the regeneration induction. Through the vacuum method, it promotes its entry into the callus and transient expression, which will promote the expression of genes related to callus regeneration and further improve the callus regeneration induction rate.

[0024] The regenerated buds obtained by the regeneration induction of the present invention can obtain a subculture propagation system with cyclic proliferation through subculture, and the rooting culture can obtain strong rooting seedlings with a rooting rate of more than 80%, which can be used for large-scale production of high-quality Hakea seedlings. Description of the Drawings

[0025] Figure 1 The induced callus;

[0026] Figure 2The regenerated buds obtained by callus induction;

[0027] Figure 3 The cluster buds obtained by subculture of the regenerated buds;

[0028] Figure 4 Rooted seedlings. Specific implementation manners

[0029] The present application will be further introduced below in conjunction with embodiments.

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, in the following description, different "one embodiment" or "embodiment" do not necessarily refer to the same embodiment. Different embodiments can be replaced or combined. For those of ordinary skill in the art, other implementation manners can also be obtained based on these embodiments without creative efforts.

[0031] A method for inducing callus of Hevea and regenerating seedlings includes the following steps: inducing callus of Hevea, then inducing the regeneration of the callus to obtain regenerated buds, and further obtaining seedlings through subculture and rooting culture.

[0032] In some embodiments of the present invention, the callus induction uses a callus induction medium; the hypocotyls of the seedlings obtained by aseptic sowing of Hevea are used as explants.

[0033] In some embodiments of the present invention, the explants are processed through the following steps:

[0034] The hypocotyls obtained by aseptic sowing of Hevea seeds are cut into segments 0.5 cm long, then longitudinally cut into two pieces, and the longitudinal cut surface is placed downward and inoculated in the callus induction medium for callus induction;

[0035] The callus induction medium is prepared from the following components by weight: potassium nitrate 396 parts, ammonium nitrate 412 parts, potassium dihydrogen phosphate 39 parts, magnesium sulfate heptahydrate 68 parts, calcium chloride dihydrate 103 parts, potassium iodide 0.1 part, boric acid 0.15 part, manganese sulfate tetrahydrate 4 parts, zinc sulfate heptahydrate 2 parts, copper sulfate pentahydrate 0.005 part, disodium ethylene diamine tetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, inositol 14 parts, glycine 0.5 part, thiamine hydrochloride 0.02 part, nicotinic acid 0.03 part, sucrose 7000 parts, agar 1700 parts, naphthylacetic acid 0.005 part, N6-furfuryladenine 0.04 part, 6-benzylaminopurine 0.03 part; the pH of the induction and differentiation medium is 6.3; the callus induction culture conditions are: culturing in a dark and lightless environment for 10 days, and the temperature in the dark environment is maintained at 28 ± 2 °C.

[0036] In some embodiments of the present invention, callus regeneration induction culture uses a regeneration induction medium, and the regeneration medium is prepared from the following components by weight: 396 parts of potassium nitrate, 412 parts of ammonium nitrate, 39 parts of potassium dihydrogen phosphate, 68 parts of magnesium sulfate heptahydrate, 103 parts of calcium chloride dihydrate, potassium iodide 0.1 part, boric acid 0.15 part, manganese sulfate tetrahydrate 4 parts, zinc sulfate heptahydrate 2 parts, copper sulfate pentahydrate 0.005 part, disodium ethylenediaminetetraacetate 9.5 parts, ferrous sulfate heptahydrate 7.1 parts, inositol 14 parts, glycine 0.5 part, thiamine hydrochloride 0.02 part, nicotinic acid 0.03 part, sucrose 7000 parts, agar 1700 parts, naphthylacetic acid 0.02 part, N6-furfuryladenine 0.003 part, 6-benzylaminopurine 0.05 part, indoleacetic acid 0.02 part; the pH of the regeneration induction medium is 6.4;

[0037] The specific treatment for regeneration induction is as follows: Cut the callus of Heig into small pieces about 0.5 cm 3 in size, soak them in a DNA solution of 1.0 μg / μl, incubate them under vacuum for 15 min, take out the callus pieces, and place them on the regeneration induction medium with the cut surface facing down.

[0038] In some embodiments of the present invention, the specific operation of vacuum incubation is as follows: Add 10 mL of DNA solution to a sterile straight flask in a laminar flow hood, put the callus pieces into it, seal it with a sterile sealing film, and then place it in a vacuum desiccator and evacuate it for 15 min.

[0039] In some embodiments of the present invention, the method for preparing the DNA solution is as follows: Based on the pCAMBIA2300-35s plant expression vector, a recombinant plasmid is constructed using the 35S promoter-driven sequence 1 and introduced into Escherichia coli. The overnight culture of the strain is used to extract the plasmid in a laminar flow hood. The solutions used in the process are prepared under sterile conditions, and consumables such as EP tubes and pipettes are sterilized. After the obtained plasmid is quantified by nanodrop, it is adjusted to a concentration of 1.0 μg / μl with sterile ultrapure water.

[0040] The sequence 1 is as shown in SEQ.NO1:

[0041]

[0042] Culture conditions: Cultivate for 20 days in an environment with 8 hours of light per day, at a temperature of 28 ± 2°C and a light intensity of 1500 - 2000 lx.

[0043] In some embodiments of the present invention, the subculture of regenerated buds uses a subculture medium.

[0044] In some embodiments of the present invention, the subculture medium is prepared from the following components by weight: 396 parts of potassium nitrate, 412 parts of ammonium nitrate, 39 parts of potassium dihydrogen phosphate, 68 parts of magnesium sulfate heptahydrate, 103 parts of calcium chloride dihydrate, 0.1 part of potassium iodide, 0.15 part of boric acid, 4 parts of manganese sulfate tetrahydrate, 2 parts of zinc sulfate heptahydrate, 0.005 part of copper sulfate pentahydrate, 9.5 parts of disodium ethylene diamine tetraacetate, 7.1 parts of ferrous sulfate heptahydrate, 14 parts of inositol, 0.5 part of glycine, 0.02 part of thiamine hydrochloride, 0.03 part of nicotinic acid, 7000 parts of sucrose, 1700 parts of agar, 0.001 part of naphthalene acetic acid, 0.06 part of 6-benzylaminopurine, and 0.01 part of indole acetic acid. As a further technical solution: The specific treatment of the subculture is as follows: Cut the complete regenerated buds, insert them with the cut end downward on the subculture medium. After culturing for one subculture cycle, divide the obtained cluster buds into small clusters, transfer them to the next cycle for continuous culture, and obtain the subculture product by circulation.

[0045] The pH of the subculture medium is 6.4.

[0046] Culture conditions: One subculture cycle is 30 days, at a temperature of 28 ± 2°C. Among them, in the first 5 days, cultivate in an environment with weak light of 1000 - 1500 lx for 12 hours per day, and then transfer to an environment with light of 1500 - 3000 lx for 12 hours per day.

[0047] In some embodiments of the present invention, the rooting culture uses a rooting medium.

[0048] As a further technical solution: The rooting medium is prepared from the following components by weight: 101 parts of potassium nitrate, 72 parts of ammonium nitrate, 8 parts of potassium dihydrogen phosphate, 19 parts of magnesium sulfate heptahydrate, 25 parts of calcium chloride dihydrate, 0.1 part of potassium iodide, 1.5 parts of boric acid, 4.2 parts of manganese sulfate tetrahydrate, 2.3 parts of zinc sulfate heptahydrate, 0.005 part of copper sulfate pentahydrate, 9.5 parts of disodium ethylene diamine tetraacetate, 7.1 parts of ferrous sulfate heptahydrate, 15 parts of inositol, 0.5 part of glycine, 0.02 part of thiamine hydrochloride, 0.03 part of nicotinic acid, 3000 parts of sucrose, 1650 parts of agar, 0.1 part of naphthalene acetic acid, and 0.1 part of indole acetic acid.

[0049] In some embodiments of the present invention, the specific treatment of the rooting culture is as follows: Cut 1 - 3 cm of healthy single buds from the subculture cluster buds, insert them into the rooting medium, and culture for 20 days.

[0050] The pH of the rooting medium is 6.0.

[0051] Cultivation conditions: Cultivation is carried out in an environment with 12 hours of light per day and a light intensity of 1500 - 3000 lx, and the temperature is 28 ± 2 °C.

[0052] (1) Obtaining the DNA sequence

[0053] Two Eucalyptus clones with significantly different callus regeneration rates were used as experimental materials. Among them, the callus regeneration rate of the highly regenerative Eucalyptus clone 1 was 62%, and the callus regeneration rate of the difficult - to - regenerate Eucalyptus clone 2 was 11%. The callus of both was inoculated in the same Eucalyptus callus regeneration induction medium, and regeneration induction culture was carried out in parallel under the same temperature and light conditions. After 20 days of cultivation, 90 callus pieces were collected from each clone, quickly frozen in liquid nitrogen, and transported by dry ice to a biological sequencing company for transcriptome sequencing. After filtering the transcriptome sequencing data, it was assembled using Trinity software. The assembled transcripts were compared and annotated with unigene sequences using 7 databases: EuKaryotic Orthologous Groups (KOG), Swiss - Prot, NR, NT, Kyoto Encyclopedia of Genes and Genomes (KEGG), Pfam, and Gene Ontology (GO). RSEM was used for alignment calculation to obtain the gene expression levels of unigene sequences in each sample. Through analysis, the expression levels of unigene sequences in clone 1 and clone 2 were compared (partial sequence expression levels are shown in Table 1), and sequences that were specifically highly expressed in clone 1 and had a significantly higher expression level than in clone 2 were screened out, and candidate DNA sequence a was obtained. Sequence a was analyzed, and its ORF fragment was selected, and its codons were modified according to the soybean genome sequence to make it more suitable for expression in Heig. After modification, DNA sequence 1 was obtained.

[0054] Table 1 Analysis of sequence expression levels

[0055] Sequence Expression level in Clone 1 (FPKM) Expression level in Clone 2 (FPKM) Sequence a 562.71 111.16 Sequence b 1651.41 1741.55 Sequence c 2412.38 2384.28 Sequence d 529.8 558.2

[0056] (2) Preparation of DNA sequence 1 solution

[0057] Using the cloning vector carrying DNA sequence 1 as a template, DNA sequence 1 was amplified with upstream and downstream primers F1 / R1. The sequences of F1 and R1 are shown in SEQ.NO2 and SEQ.NO3 respectively. Among them, F1 contains the KpnI restriction site sequence, and R1 contains the BamHI restriction site sequence. The PCR amplification product is the complete DNA sequence 1 with the KpnI restriction site and BamHI restriction site added to the head and tail respectively. After purification of the PCR product, it was digested with KpnI and BamHI enzymes. The digested DNA fragment was ligated with the pCAMBIA2300-35S vector backbone digested with KpnI and BamHI enzymes using T4 ligase. The ligation product was transformed into JM109 competent cells and then spread on plates. Single colonies were picked and colony PCR was performed with primers F1 / R1, and verified by electrophoresis and PCR product sequencing. The verified strains were inoculated into LB liquid medium according to the conventional method and cultured overnight. The overnight culture of the strains was used to extract plasmids in a laminar flow hood. The solutions used in the process were prepared under sterile conditions, and consumables such as EP tubes and pipettes were sterilized. After quantification of the obtained plasmid by nanodrop, it was adjusted to a concentration of 1.0 μg / μl with sterile ultrapure water.

[0058] SEQ.NO2: ggtaccatggctaggcttgtgg

[0059] SEQ.NO3: ggatccttacatgaggtgggcgt

[0060] (3) Improvement effect of DNA sequence 1 on callus regeneration rate

[0061] The Heig callus was incubated under vacuum for 15 min without special treatment, incubated under vacuum for 15 min with DNA sequence 1 solutions at different concentrations, and incubated under vacuum for 15 min with pCAMBIA2300-35S plasmid solutions at different concentrations. The concentration parameters of each treatment are shown in Table 2. 120 calli of each treatment were inoculated in parallel into the regeneration induction medium and cultured for 20 days under the conditions of 8 h of light per day, light intensity of 1500 - 2000 lx, and temperature of 28 ± 2 °C. The number of callus blocks that germinated into regenerated buds was counted. According to: regeneration induction rate = number of callus blocks that germinated into regenerated buds / number of inoculated callus blocks, the regeneration rates of different treatments were calculated, and the results are shown in Table 2. It can be seen from the results that the incubation treatment with DNA sequence 1 solution at a concentration of 0.1 μg / μl or above has a promoting effect on the Heig callus regeneration rate, and the incubation treatment with DNA sequence 1 solution at a concentration of 0.5 μg / μl or above can increase the Heig callus regeneration rate to more than 55%. However, the incubation treatment with pCAMBIA2300-35S plasmid solution without carrying DNA sequence 1 has no promoting effect on the Heig callus regeneration.

[0062] Table 2 Comparison of regeneration test treatments and regeneration rates

[0063] Test treatment method Callus regeneration rate (%) No special treatment 9.17 DNA sequence 1 solution concentration 0.01 μg / μl 8.89 DNA sequence 1 solution concentration 0.1 μg / μl 13.61 DNA sequence 1 solution concentration 0.5 μg / μl 53.89 DNA sequence 1 solution concentration 1.0 μg / μl 58.89 DNA sequence 1 solution concentration 2.0 μg / μl 55.56 DNA sequence 1 solution concentration 3.0 μg / μl 59.44 pCAMBIA2300-35S plasmid solution concentration 0.01 μg / μl 8.89 pCAMBIA2300-35S plasmid solution concentration 0.1 μg / μl 9.17 pCAMBIA2300-35S plasmid solution concentration 0.5 μg / μl 8.61 pCAMBIA2300-35S plasmid solution concentration 1.0 μg / μl 8.06 pCAMBIA2300-35S plasmid solution concentration 2.0 μg / μl 7.22 pCAMBIA2300-35S plasmid solution concentration 3.0 μg / μl 8.61

[0064] Figure 1 It is the induced callus. The obtained callus is induced from the hypocotyl tissue to dedifferentiate into callus through induction. Figure 2 It is the regenerated bud obtained by callus induction. The regenerated bud obtained by callus regeneration induction can regenerate normal and robust regenerated buds after being treated by the technology of the present invention. Figure 3 It is the cluster buds obtained by subculture of the regenerated buds. The subculture cluster buds. The regenerated buds obtained by callus regeneration grow into robust cluster buds through subculture, and the proliferation effect is good. Figure 4 It is the rooted seedling, the side photo and the bottom photo of the rooted seedling, mainly showing that the seedling can normally root, the rooting is neat, and the root system is robust.

[0065] It should be noted that the above embodiments can be freely combined according to needs. The above introduction is only the preferred embodiment of the present invention and is not used to limit the present invention. For those skilled in the art, the present invention can have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A method for inducing callus and regenerating seedlings of black locust, characterized in that: The method comprises the following steps: inducing callus tissue of black germination, culturing the callus tissue regeneration induction to obtain regenerated buds, and further performing subculture and rooting culture to obtain seedlings.

2. The method for inducing callus and regenerating seedlings of black sedge according to claim 1, characterized in that: The callus induction adopts callus induction medium; the hypocotyls of seedlings obtained by aseptic sowing of black ge aseptically are used as explants.

3. The method for inducing callus and regenerating seedlings of black stalk according to claim 2, characterized in that: The explants are processed by the following steps: The hypocotyls obtained after aseptic sowing of black germination seeds were cut into small segments of 0.3 to 0.6 cm, and the small segments were cut longitudinally and inoculated with the cut surface facing downward into callus induction medium for callus induction; The callus induction medium comprises the following components by weight: 383-565 parts of potassium nitrate, 302-430 parts of ammonium nitrate, 32-44 parts of potassium dihydrogen phosphate, 56-96 parts of magnesium sulfate heptahydrate, 49-147 parts of calcium chloride dihydrate, 0.05-0.25 parts of potassium iodide, 0.74-2.21 parts of boric acid, 3.68-6.38 parts of manganese sulfate tetrahydrate, 1.23-2.95 parts of zinc sulfate heptahydrate, 0.004-0.008 parts of copper sulfate pentahydrate, 7.86-10.56 parts of disodium ethylenediaminetetraacetate, 5.87-7.89 parts of ferrous sulfate heptahydrate, and 12.2 parts of inositol. 7-31.91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, nicotinic acid 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthaleneacetic acid 0.001-0.006 parts, N6-furanmethyladenine 0.01-0.05 parts, 6-benzylaminopurine 0.02-0.05 parts; the pH of the callus induction medium is 6.0-6.5; the callus induction culture conditions are: culturing in a dark and lightless environment for 7-10 days, and the temperature in the dark environment is maintained at 28±2°C.

4. The method for inducing callus and regenerating seedlings of black sedge according to claim 3, characterized in that: The callus regeneration induction culture uses a regeneration induction medium, which is made of the following ingredients by weight: 383-565 parts of potassium nitrate, 302-430 parts of ammonium nitrate, 32-44 parts of potassium dihydrogen phosphate, 56-96 parts of magnesium sulfate heptahydrate, 49-147 parts of calcium chloride dihydrate, 0.05-0.25 parts of potassium iodide, 0.74-2.21 parts of boric acid, 3.68-6.38 parts of manganese sulfate tetrahydrate, 1.23-2.95 parts of zinc sulfate heptahydrate, 0.004-0.008 parts of copper sulfate pentahydrate, 7.86-10.56 parts of disodium ethylenediaminetetraacetate, 5.87-7.89 parts of ferrous sulfate heptahydrate, and 12.27-31 parts of inositol. .91 parts, glycine 0.25-0.74 parts, thiamine hydrochloride 0.017-0.032 parts, niacin 0.025-0.049 parts, sucrose 6137-8592 parts, agar 1350-1841 parts, naphthaleneacetic acid 0.01-0.04 parts, N6-furanmethyladenine 0.001-0.006 parts, 6-benzylaminopurine 0.03-0.07 parts, indoleacetic acid 0.01-0.04 parts; the pH of the regeneration induction medium is 6.2-6.4; the regeneration induction culture conditions are: culturing for 14-20 days under an environment of 8 hours of light per day, the temperature is 28±2°C, and the light intensity is 1500-2000lx. The specific process of regeneration induction is: cut the black gerbera callus into pieces and soak them in a 0.5-2 μg / μl DNA solution, vacuum for 10-15 minutes, take out the small pieces of callus, and place them on the regeneration induction medium with the cut side facing downwards.

5. The method for inducing callus and regenerating seedlings of black sedge according to claim 4, characterized in that: DNA solution preparation method: Based on the pCAMBIA series or pBI121 plant expression vector, use 35S or other plant expression promoter to drive sequence 1 to construct a recombinant plasmid and introduce it into Escherichia coli. The overnight culture of the strain is used to extract the plasmid in a clean bench; the obtained plasmid is quantified by nanodrop and adjusted to a concentration of 0.5-2μg / μl with sterile ultrapure water; The sequence 1 is shown as SEQ.NO1.

6. The method for inducing callus and regenerating seedlings of black locust according to claim 4, characterized in that: The subculture medium is used for the subculture of the regenerated buds; the subculture medium comprises the following components by weight: 383-565 parts of potassium nitrate, 302-430 parts of ammonium nitrate, 32-44 parts of potassium dihydrogen phosphate, 56-96 parts of magnesium sulfate heptahydrate, 49-147 parts of calcium chloride dihydrate, 0.05-0.25 parts of potassium iodide, 0.74-2.21 parts of boric acid, 3.68-6.38 parts of manganese sulfate tetrahydrate, 1.23-2.95 parts of zinc sulfate heptahydrate, and 0.004-0.008 parts of copper sulfate pentahydrate. 1-0.56 parts of ethylenediaminetetraacetic acid disodium, 5.87-7.89 parts of ferrous sulfate heptahydrate, 12.27-31.91 parts of inositol, 0.25-0.74 parts of glycine, 0.017-0.032 parts of thiamine hydrochloride, 0.025-0.049 parts of nicotinic acid, 6137-8592 parts of sucrose, 1350-1841 parts of agar, 0.001-0.004 parts of naphthaleneacetic acid, 0.05-0.1 parts of 6-benzylaminopurine, and 0.08-0.015 parts of indoleacetic acid; The pH of the subculture medium is 6.0-6.

4. Culture conditions: One subculture cycle is 20 to 30 days, the temperature is 28±2℃, and the first 5 days are cultured in an environment with 1000-1500lx weak light for 12 hours per day, and then transferred to an environment with 1500-3000lx light for 12 hours per day.

7. The method for inducing callus and regenerating seedlings of black locust according to claim 5, characterized in that: The rooting culture medium is used; the rooting culture medium comprises the following components by weight: 89-148 parts of potassium nitrate, 69-78 parts of ammonium nitrate, 7-10 parts of potassium dihydrogen phosphate, 12-22 parts of magnesium sulfate heptahydrate, 12-31 parts of calcium chloride dihydrate, 0.05-0.23 parts of potassium iodide, 0.7-2.1 parts of boric acid, 3.5-6.06 parts of manganese sulfate tetrahydrate, 1.17-2.80 parts of zinc sulfate heptahydrate, and 7.46-2.60 parts of disodium ethylenediaminetetraacetate. 10.02 parts, 5.58-7.49 parts of ferrous sulfate heptahydrate, 11.66-30.31 parts of inositol, 0.23-0.7 parts of glycine, 0.016-0.03 parts of thiamine hydrochloride, 0.023-0.047 parts of nicotinic acid, 2798-6061 parts of sucrose, 1399-1748 parts of agar, 0.09-0.13 parts of indoleacetic acid, and 0.06-0.11 parts of indolebutyric acid; the pH of the rooting medium is 5.8-6.2; Culture conditions: Culture was carried out in an environment with 1500-3000lx of light intensity for 12 hours per day and a temperature of 28±2℃.

Images