Use of Trim3 gene and / or its expression product in the preparation of a medicament for treating osteoporosis

Abstract

The present invention discloses the application of Trim3 gene and / or its expression product in the preparation of drugs for treating osteoporosis. Overexpression of Trim3 can increase the bone mineral density of osteoporosis model mice, inhibit bone resorption, inhibit osteoclast differentiation and inflammatory response in vitro, and improve osteoporosis, providing a new target for the diagnosis and treatment of osteoporosis.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and particularly relates to the application of Trim3 gene and / or its expression product in the preparation of drugs for treating osteoporosis. Background Art

[0002] Bone mass loss in the elderly is associated with adverse clinical outcomes (such as falls, mobility limitation, accidental disability, and fractures), ultimately leading to a reduced quality of life and increased medical costs. Therefore, how to prevent and treat osteoporosis has become an important long-term research topic for humanity. Currently, there are no specific diagnostic and therapeutic targets and drugs for osteoporosis. Therefore, it is urgent to explore the pathogenesis and therapeutic targets of osteoporosis.

[0003] Previous studies have shown that TRIM3 (Tripartite Motif-containing Protein 3) is one of the members of the TRIM family, and its functions involve processes such as ubiquitination modification, cell cycle regulation, tumor suppression, and neurodegenerative diseases. Although there is currently no direct association found between TRIM3 and osteoporosis. Summary of the Invention

[0004] The object of the present invention is to provide a target and a drug that can accurately and effectively diagnose and treat osteoporosis for the above technical problems to be solved.

[0005] In order to achieve the above invention object, the present invention provides the application of Trim3 gene and / or its expression product in the preparation of drugs for treating osteoporosis.

[0006] On the other hand, the present invention also provides the application of a reagent for detecting the expression level of Trim3 gene in the preparation of a product for diagnosing osteoporosis.

[0007] Preferably, the product is a preparation, a chip, or a kit.

[0008] Preferably, the reagent detects the expression level of Trim3 gene by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, or chip detection.

[0009] Preferably, the reagent includes primers for specifically amplifying the Trim3 gene.

[0010] More preferably, the nucleotide sequences of the primers for specifically amplifying the Trim3 gene are as follows:

[0011] Forward primer: 5’- GCGACCTGGAGACCATTTGT -3’;

[0012] Reverse primer: 5’- GCTACTGCCGATGTGTTCCTG -3’.

[0013] On the other hand, the present invention also provides the use of a reagent for increasing the expression level of the Trim3 gene in the preparation of a drug having any one of the following functions a) to e):

[0014] a) Treating osteoporosis;

[0015] b) Increasing bone density;

[0016] c) Inhibiting bone resorption;

[0017] d) Inhibiting osteoclast differentiation;

[0018] e) Inhibiting inflammatory response.

[0019] Preferably, the reagent is an overexpression drug targeting the Trim3 gene, or an expression promoter or activator targeting the Trim3 gene.

[0020] Preferably, the overexpression drug targeting the Trim3 gene is an overexpression vector or recombinant protein targeting the Trim3 gene.

[0021] Preferably, the expression promoter or activator targeting the Trim3 gene is a small molecule compound, polypeptide, amino acid or nucleic acid.

[0022] Preferably, the osteoporosis is postmenopausal osteoporosis.

[0023] Experimental results show that there is a close relationship between the Trim3 gene and osteoporosis. Conditional knockout of Trim3 in osteoclasts can lead to osteoporosis. Overexpression of Trim3 can increase bone density in an osteoporosis model mouse, inhibit bone resorption, inhibit osteoclast differentiation and inflammatory response in vitro, and improve osteoporosis, providing a new target for the diagnosis and treatment of osteoporosis. Description of the Drawings

[0024] Figure 1 Shows that the expression level of Trim3 is negatively correlated with increased bone resorption in mouse / human bone specimens. (A) Bone density of the control group and the PMOP group; (B) mRNA expression level of Trim3 in bone tissue of the control group and the PMOP group; (C) mRNA expression level of Nfatc1 in bone tissue of the control group and the PMOP group; (D) Correlation between Trim3 and bone density; (E) Correlation between Nfatc1 and bone density; (F) Correlation between Trim3 and Nfatc1; (G) Protein expression levels of Trim3 and NFATc1 in bone tissue of the Sham group (sham operation group) and the OVX group (ovariectomy group); (H) mRNA expression level of Trim3 in bone tissue of the Sham group and the OVX group; (I) mRNA expression level of Nfatc1 in bone tissue of the Sham group and the OVX group.

[0025] Figure 2 It is shown that Trim3 knockout promotes osteoclast differentiation and bone loss. (A) TRAP staining results of bone marrow-derived macrophages from WT and CKO mice; scale bar = 200 μm; (B) Quantitative analysis results of TRAP staining of bone marrow-derived macrophages from WT and CKO mice; (C) Expression levels of osteoclast marker genes in bone marrow-derived macrophages from WT and CKO mice; (D) Representative Micro-CT images of WT and CKO mice; scale bar = 500 μm; (E) Micro-CT bone tissue-related parameters of WT and CKO mice; (F) TRAP staining results of small bone trabeculae from WT and CKO mice; scale bar = 100 μm; (G) Quantitative analysis results of TRAP staining of small bone trabeculae from WT and CKO mice; (H) Content of TRACP-5b in the serum of WT and CKO mice.

[0026] Figure 3 It is shown that Trim3 overexpression inhibits osteoclast differentiation and increases bone mass. (A) TRAP staining results of bone marrow-derived macrophages from WT and CKI mice; scale bar = 200 μm; (B) Quantitative analysis results of TRAP staining of bone marrow-derived macrophages from WT and CKI mice; (C) Expression levels of osteoclast marker genes in bone marrow-derived macrophages from WT and CKI mice; (D) Representative Micro-CT images of WT and CKI mice; scale bar = 500 μm; (E) Micro-CT bone tissue-related parameters of WT and CKI mice; (F) TRAP staining results of small bone trabeculae from WT and CKI mice; scale bar = 100 μm; (G) Quantitative analysis results of TRAP staining of small bone trabeculae from WT and CKI mice; (H) Content of TRACP-5b in the serum of WT and CKI mice.

[0027] Figure 4It is shown that NF-κB p65 signaling is crucial for Trim3-mediated osteoclast differentiation. (A) Expression of NF-κB p65 protein in the nuclei of bone marrow-derived macrophages from WT and CKI group mice; (B) NF-κB activity in bone marrow-derived macrophages from WT and CKI group mice; (C) mRNA expression of TNF-α in bone marrow-derived macrophages from WT and CKI group mice; (D) mRNA expression of IL-1 in bone marrow-derived macrophages from WT and CKI group mice; (E) Expression of NF-κB p65 protein in the nuclei of bone marrow-derived macrophages from WT and CKO group mice; (F) NF-κB activity in bone marrow-derived macrophages from WT and CKO group mice; (G) mRNA expression of TNF-α in bone marrow-derived macrophages from WT and CKO group mice; (H) mRNA expression of IL-1 in bone marrow-derived macrophages from WT and CKO group mice; (I) Co-immunoprecipitation analysis of the interaction between Trim3 and p65 in 293T cells; (J) Co-immunoprecipitation analysis of the interaction between Trim3 and p65 in bone marrow-derived macrophages; (K) Treatment with the proteasome inhibitor MG132 reverses the degradation of NF-κB p65 by Trim3; (L) Fluorescence co-localization analysis of the positional relationship between Trim3 and p65; Scale bar = 20 μm.

[0028] Figure 5 It is shown that overexpression of osteoclast Trim3 can prevent OVX-induced bone loss in mice. (A) Uterine weights of mice in each group after sham operation or ovariectomy; (B) Representative Micro-CT images of vertebral bones of mice in each group; Scale bar = 500 μm; (C) Bone tissue parameters of vertebral bones of mice in each group measured by Micro-CT; (D) TRAP staining results of vertebral bones of mice in each group; Scale bar = 200 μm; (E) Quantitative analysis results of TRAP staining of vertebral bones of mice in each group; (F) Serum TRACP-5b levels of mice in each group. Detailed implementation manners

[0029] The present invention will be further described below in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0030] For the sake of brevity, unless otherwise specified, the reagents, devices, and experimental means mentioned in the embodiments of the present invention are well-known to those skilled in the art or can be obtained through conventional commercial channels. The specific implementation process of conventional operation techniques can be referred to the conventional methods and standard procedures in the relevant field.

[0031] Processing human bone samples

[0032] This study included 10 patients with PMOP (Postmenopausal Osteoporosis) and 10 non-PMOP patients. All patients underwent spine-related surgeries and provided written informed consent. Eligible participants were patients who had suffered an acute fragility lumbar fracture within two weeks before enrollment and clearly required vertebroplasty or internal fixation. Patients diagnosed with diabetes, malignancy, or other systemic diseases within the past 5 years were not included in the study cohort.

[0033] Mouse

[0034] Female C57BL / 6 mice (wild type) were obtained from the Experimental Animal Center of Guangzhou University of Chinese Medicine. All experimental procedures were approved in advance. Eight-week-old female C57BL / 6 mice (8 mice / group) were subjected to bilateral ovariectomy by the external oblique muscle method to establish a postmenopausal osteoporosis (PMOP) model. After measuring body weight, the animals were anesthetized intraperitoneally (60 μL PBS containing 25% ketamine [100 mg / mL] and 25% promethazine [20 mg / mL]). The sham operation control group underwent the same laparotomy but without ovariectomy. All subjects were housed under standardized conditions with controlled temperature, lighting, and food supply. At the 4-week postoperative time point, uterine atrophy was quantified, and then the spine was collected for micro-CT scanning and bone histomorphometric analysis.

[0035] To establish an osteoclast-specific Trim3 gene knockout model, Trim3 flox / flox mice (C57BL / 6 strain) were crossed with Ctsk-Cre transgenic mice (C57BL / 6 strain) expressing Cre recombinase under the cathepsin K promoter to achieve conditional knockout of the Trim3 gene. Trim3 flox / flox mice carry the Trim3 gene (NCBI geneID: 55992) flanked by loxP sites (flox indicates loxP sites recognizable by Cre recombinase), and the Trim3 gene is normally expressed. The Cre recombinase in Ctsk-Cre transgenic animals is expressed in specific cells or tissues expressing cathepsin K under the drive of the cathepsin K gene promoter. When these two types of mice are crossed, in the individuals of the offspring carrying both Trim3 flox / flox and Ctsk-Cre genes, the Cre recombinase will recognize and cleave the loxP sites in the cells or tissues expressing cathepsin K, resulting in knockout of the Trim3 gene in these specific cells or tissues, thus enabling functional studies of the Trim3 gene in specific cells or tissues. The mice with the Trim3 gene knocked out are called "CKO mice".

[0036] The control groups in all experiments consisted of Ctsk-Cre-carrying Trim3+ / + pups (referred to as "WT").

[0037] Meanwhile, referring to relevant literature (Li D, Liu J, Guo B, et al. Osteoclast-derived exosomal miR-214-3p inhibits osteoblastic bone formation[J]. Nature Communications, 2016, 7(1): 10872.; Wang Y, Gan Y, Dong Y, et al. Tax1 binding protein 3 regulates osteogenic and adipogenic differentiation through inactivating wnt / β‐catenin signalling[J]. Journal of Cellular and Molecular Medicine, 2023, 27(7): 950-961.), a Cre-dependent Trim3 gene overexpression model was constructed by directing the integration of the Trim3 expression module (NCBI gene ID: 55992) into the H11 locus. This engineered construct has a constitutive CAG promoter followed by a loxP-stop-loxP (LSL) regulatory element for Cre-mediated activation. Downstream of the LSL sequence, the Trim3 coding region is fused to an mCherry reporter via an IRES, allowing for simultaneous fluorescent tracking of Trim3-expressing cells. Precise genome editing was achieved by microinjecting a targeting vector carrying the sgRNA / Cas9 components into fertilized oocytes. Subsequently, heterozygous CKI / WT offspring were obtained.

[0038] Cell culture

[0039] Bone marrow cells were cultured with M-CSF (macrophage colony-stimulating factor) (100 ng / mL) for two days to recruit macrophages, and then RANKL (50 ng / mL) was added to induce osteoclast differentiation. Bone marrow cells were extracted from the femurs using α-MEM (Sail Biotechnology, G4554). The cell suspension was centrifuged and then resuspended in α-MEM containing 10% (v / v) fetal bovine serum (FBS), 100 mg / mL streptomycin, and penicillin. After five days, bone marrow-derived macrophages (BMMs) were stained for TRAP. Cells that were TRAP-positive and had more than three nuclei were classified as osteoclasts.

[0040] qRT-PCR

[0041] RNA was extracted from bone tissue and BMM. 1 μg of total RNA was reverse transcribed into cDNA in a 20 μL reaction using a cDNA synthesis kit (Aikerui Co., Ltd., AG11706). Genes related to periauricular / auricular remodeling, including Trim3, Nfatc1, Gapdh, Ctsk, c-Fos, c-Src, Trap, Tnf-α, IL-1, Runx2, Sp7, Alp, Ocn, and Col1a1, were analyzed using a real-time PCR instrument and 20 μL of SYBR Green qPCR SuperMix. Specific amplification primers were designed (Table 1) and synthesized by Shanghai Sangon Biotech Co., Ltd.

[0042] PCR reaction procedure: 95 °C for 30 seconds; 95 °C for 5 seconds, 60 °C for 30 seconds, 40 cycles.

[0043] The gene expression level was determined using the 2 -ΔΔCt method.

[0044] Table 1. qRT-PCR primer sequences

[0045]

[0046] Western blot (protein blotting assay)

[0047] Cells were lysed with RIPA lysis buffer, and protease inhibitor (New Cell & Molecular Biotech Co., Ltd., P001) was added to the lysate at a volume ratio of 1:100. The concentration of protein samples was determined using a BCA Protein Assay Kit produced by Beingmate Co., Ltd. in China. 20 μg of total protein was separated by 10% SDS-PAGE gel and transferred to a polyvinylidene difluoride membrane, which was blocked with 5 wt% non-fat milk buffer for 2 hours. The following primary antibodies were incubated overnight at 4°C: Trim3 and NF-κB p65 (1:1000, Santa Cruz Biotechnology), NFATc1 (1:1000, Proteintech), GAPDH (1:10000, Santa Cruz Biotechnology), and Lamin B (1:10000, Santa Cruz Biotechnology). The membrane was washed three times with TBST (Tris-Buffered Saline with Tween-20), and then incubated with HRP (horseradish peroxidase)-labeled secondary antibody (Santa Cruz Biotechnology) for 1.5 hours at room temperature. Enhanced chemiluminescence was used to determine the protein levels. Band intensities were quantified using ImageJ software.

[0048] Co-Immunoprecipitation (Co-IP)

[0049] Co-IP assays were performed according to the standard protocol. BMMs or HEK293T cell lysates (200 µg, 1 µg / µL) were incubated overnight at 4°C with NF-κB p65 and Trim3 (Abcam) or IgG with gentle shaking. The mixture was incubated with Protein A / G magnetic beads for 1 - 2 hours at room temperature. The Co-immunoprecipitation complexes were analyzed by Western blotting.

[0050] Luciferase Reporter Assay

[0051] A pCDH luciferase reporter vector (Promega, E849A) was developed by inserting the NF-κB p65 promoter binding site upstream of the luciferase gene. The luciferase vector was stably expressed in cells. Luciferase activity was evaluated using a Luciferase Assay Kit produced by Beyotime Institute of Biotechnology in Shanghai, China.

[0052] Immunofluorescence

[0053] RAW264.7 cells (mouse monocyte macrophage leukemia cells) were treated with 4% PFA (paraformaldehyde), and then treated with Triton X-100 and blocking buffer (Beyotime Biotechnology, P0102) for 30 minutes. The cells were incubated overnight at 4°C with anti-Trimz antibody (Abcam, ab111840). After washing, the cells were incubated with a fluorescently labeled specific secondary antibody (Beyotime Biotechnology, A0423) diluted 1:500 for 45 minutes at room temperature. The cell nuclei were stained with DAPI. Images were acquired using a fluorescence microscope.

[0054] Micro-CT

[0055] Vertebral specimens (L4) of mice were collected, immersed in 4% PFA for fixation for 48 hours, and then high-resolution micro-CT scans were performed using a SkyScan 1276 system (Bruker). The imaging parameters were set as a voxel resolution of 10 μm, a voltage of 80 kV, and a current of 100 μA. The trabecular / cortical bone morphology was quantified by three-party software analysis: software CTVol v2.0 was used for three-dimensional reconstruction, CTAn v1.9 was used for structural parameter calculation, and NRecon v1.6 was used for volume rendering. The measurement indices included bone mineral density (BMD, mg / cm³), trabecular thickness (Tb.Th, mm), spacing (Tb.Sp, mm), numerical density (Tb.N, mm⁻¹), connectivity density (Conn.Dn, mm⁻³), and bone volume fraction (BV / TV, %).

[0056] Bone histomorphometric analysis

[0057] Bone histomorphometric evaluation of the L3-L5 vertebral segments was performed according to the established protocol. Femoral specimens were immersed in periodate-lysine-paraformaldehyde fixative (TIANDZ) for fixation for 24 hours. Unstained 4-μm femoral sections were prepared using a Shandon Finesse ME microtome for fluorescence microscopy to evaluate calcein double labeling. The labeling interval was determined by consecutive injections of calcein (10 μg / g, intravenously at 7 days and 2 days before euthanasia), and the mineralization parameters were calculated: mineralizing surface (MS / BS, %), bone formation rate (BFR, μm³ / μm² / day), and mineral apposition rate (MAR, μm / day).

[0058] In the aspect of vertebral body treatment, the L3-L5 segments were processed continuously: fixed in 4% PFA for 48 hours, dehydrated with ethanol (70%) for 48 hours, and decalcified in 10% EDTA for 14-21 days. Paraffin-embedded samples were cut into 4-μm thick sections and stained with hematoxylin-eosin (H&E) and TRAP. Blind quantitative analysis was performed using the OsteoMeasure system (Osteometrics, GA), including measuring osteoblast surface (Ob.S / BS, %), osteoclast count (N.Oc / B.Pm, / mm), and osteoclast surface (Oc.S / BS, %).

[0059] Enzyme-linked immunosorbent assay (ELISA)

[0060] The serum levels of TRACP-5b and osteocalcin were detected using an ELISA kit provided by R&D Systems IDS. Mice were fasted for 4 hours and blood samples were obtained by buccal pouch puncture. The absorbance of the samples was measured at a wavelength of 450 nm.

[0061] Statistical analysis

[0062] Data analysis was performed using Prism 9.0. Each in vitro experiment was independently repeated at least 3 times with consistent results. Statistical comparison between two groups was performed using two-tailed Student's t-test, while analysis involving three or more groups was performed using one-way ANOVA and Tukey's post hoc test. A P value less than or equal to 0.05 was considered statistically significant. Data were presented as mean ± SEM.

[0063] Experimental results

[0064] The experimental results are as Figures 1 to 5 shown.

[0065] Figure 1 It was shown that Trim3 expression was negatively correlated with bone resorption. To explore the association between Trim3 expression level and postmenopausal osteoporosis (PMOP), bone tissues from PMOP patients and healthy controls were collected for quantitative reverse transcription PCR (qRT-PCR) analysis (A in Figure 1 )). The quantitative results showed that compared with the control group, Trim3 transcripts were significantly downregulated in PMOP patients, while the expression of the key osteoclast transcription factor Nfatc1 was upregulated (B, C in Figure 1 ). With the progressive increase in bone mineral density (BMD), the expression of Trim3 mRNA showed an increasing trend (D in Figure 1 ), while the level of Nfatc1 gradually decreased (E in Figure 1 ). Notably, in PMOP bone specimens, Trim3 and Nfatc1 showed an inverse transcriptional regulatory relationship ( Figure 1in F). In addition, the mRNA and protein expression levels of Trim3 and Nfatc1 in the vertebrae of sham-operated (Sham) and ovariectomized (OVX) mice were detected. The results showed that compared with the Sham group, the expression of Trim3 in the vertebrae of OVX mice was significantly decreased, while the expression of Nfatc1 was significantly increased ( Figure 1 in G-I). These findings suggest that Trim3 may play an important role in the pathogenesis of PMOP.

[0066] Figure 2 It is shown that Trim3 regulates bone homeostasis by inhibiting osteoclastogenesis. To explore the role of Trim3 in osteoclastogenesis and bone homeostasis, osteoclast-specific Trim3 conditional knockout mice (CKO) were constructed by crossing Trim3 flox / flox mice with Ctsk-Cre mice. In osteoclast-specific knockout BMMs, Trim3 deficiency significantly promoted osteoclast differentiation, as shown by an increase in the number of TRAP-positive multinucleated cells ( Figure 2 in A, B). Transcriptome analysis showed that the expression of osteoclast differentiation-related regulatory factors (Nfatc1, Ctsk, c-Fos, c-Src, Trap) was upregulated in BMMs derived from CKO compared with WT ( Figure 2 in C). Micro-computed tomography (micro-CT) showed that CKO mice had significant bone microstructural degradation, manifested as an increase in trabecular bone separation (Tb.Sp), a decrease in bone volume fraction (BV / TV), a decrease in trabecular bone number (Tb.N), and a decrease in three-dimensional connectivity density (Conn.Dens) ( Figure 2 in D, E). Histomorphometric analysis further confirmed that the number of osteoclasts (N.Oc / B.Pm) and osteoclast surface (Oc.S / BS) in CKO mice were significantly higher than those in the WT control group ( Figure 2 in F, G). Enzyme-linked immunosorbent assay (ELISA) showed that the serum bone resorption marker TRACP-5b level in CKO mice was significantly increased ( Figure 2 in H).

[0067] Figure 3 It is shown that overexpression of Trim3 can inhibit osteoclast differentiation and increase bone mass. Osteoclast-specific Trim3 conditional overexpression mice (CKI) were constructed. Under RANKL induction conditions, the formation of TRAP-positive multinucleated osteoclasts in CKI BMMs was significantly reduced ( Figure 3 in A, B), and the expression of osteoclast-related transcription factors (Nfatc1, Ctsk, c-Fos, c-Src, Trap) was downregulated ( Figure 3in C). Micro-CT analysis showed that CKI mice presented an obvious osteosclerotic phenotype, characterized by a significant increase in bone mass (BV / TV), trabecular bone number (Tb.N), and connectivity density (Conn-Dens), and a decrease in trabecular bone spacing (Tb.Sp) ( Figure 3 in D and E). Histological analysis indicated that the number and surface area of osteoclasts in CKI mice were lower than those in the WT control group ( Figure 3 in F and G), and the serum TRACP-5b level was significantly decreased ( Figure 3 in H). Genetic experiments showed that Trim3 played a key role in maintaining bone homeostasis by regulating osteoclastogenesis.

[0068] Figure 4 It was shown that the NF-κB p65 signaling pathway was involved in Trim3-regulated osteoclast differentiation. To clarify the molecular mechanism of Trim3-regulated osteoclast differentiation, the NF-κB signaling pathway activated by RANKL was focused on. As an E3 ubiquitin ligase with an RBCC domain, Trim3 might affect osteoclast differentiation by regulating NF-κB p65. Experimental findings showed that overexpression of Trim3 significantly reduced the nuclear translocation of NF-κB p65 ( Figure 4 in A), NF-κB activity ( Figure 4 in B), and the secretion of inflammatory factors (Tnf-α, IL-1) ( Figure 4 in C and D), while Trim3 knockout had the opposite effect ( Figure 4 in E-H). Co-immunoprecipitation (Co-IP) confirmed the direct interaction between Trim3 and NF-κB p65 ( Figure 4 in I and J). Treatment with the proteasome inhibitor MG132 could reverse the degradation effect of Trim3 on NF-κB p65 ( Figure 4 in K), and immunofluorescence showed their co-localization in the cytoplasm ( Figure 4 in L). These results indicated that Trim3 promoted the degradation of NF-κB p65 through the ubiquitin-proteasome pathway, thereby inhibiting osteoclast differentiation.

[0069] Figure 5 It was shown that overexpression of osteoclast Trim3 could prevent bone loss caused by OVX in mice. To verify the potential therapeutic value of Trim3, the effect of Trim3 overexpression was evaluated in an OVX-induced osteoporosis model ( Figure 5 in A). Micro-CT showed that osteoclast-specific overexpression of Trim3 could effectively inhibit bone mass loss caused by OVX ( Figure 5B and C), improving bone microstructure parameters (BV / TV, BMD, Conn-Dens, Tb.N, Tb.Sp). Histological analysis showed that the number, surface area of osteoclasts and serum TRACP-5b level in CKI mice were comparable to those in the sham operation group ( Figure 5 D-F). This study confirmed that overexpression of Trim3 had a significant inhibitory effect on pathological bone resorption, providing a new strategy for the treatment of PMOP.

[0070] From the above experimental results, it was found that the Trim3 gene was significantly downregulated in the bone tissue of osteoporosis patients and showed a certain correlation with bone mineral density (BMD), specifically a negative correlation. By constructing mice with conditional knockout and overexpression of Trim3 in osteoclasts, it was found that after knocking out Trim3, osteoclast differentiation in mice was significantly enhanced and the mice showed very obvious osteoporosis; after overexpressing Trim3, the bone mass of the mice was significantly enhanced and osteoclast differentiation activity was weakened. By exploring the mechanism of action of Trim3 as a regulator of osteoclastogenesis, it was found that overexpression of Trim3 in osteoclasts reduced the protein level of NF-κB p65, NF-κB activity and the secretion of inflammatory cytokines. On the contrary, knockout of Trim3 in osteoclasts promoted the expression of NF-κB p65 protein, NF-κB activity and the expression of inflammatory cytokines. The results showed that Trim3 could act as an E3 ubiquitin ligase to promote the cytoplasmic degradation of the NF-κB p65 signal, thereby inhibiting osteoclast differentiation. A mouse model of osteoporosis caused by estrogen deficiency was constructed using female ovariectomized mice to evaluate the effect and mechanism of Trim3 gene overexpression on osteoporosis. The results showed that the Trim3 / NF-κB p65 signaling axis might play a crucial role in regulating osteoclast differentiation. Overexpression of Trim3 in osteoclasts could inhibit bone loss in mice caused by estrogen deficiency. The research results showed that Trim3 was a key regulator of osteoclastogenesis, highlighting its potential as a diagnostic and therapeutic target for PMOP.

Claims

1. Use of a reagent for detecting the expression level of the Trim3 gene in the preparation of a product for diagnosing osteoporosis, characterized in that, The reagent includes primers for specifically amplifying the Trim3 gene, and the nucleotide sequences of the primers for specifically amplifying the Trim3 gene are as follows: Forward primer: 5’- GCGACCTGGAGACCATTTGT -3’ Reverse primer: 5’- GCTACTGCCGATGTGTTCCTG -3’.

2. The application according to claim 1, wherein The product is a preparation, a chip or a kit.

3. The application according to claim 1, characterized in that, The reagent detects the expression level of the Trim3 gene by reverse transcription PCR, real-time quantitative PCR, in situ hybridization or chip detection.

4. The application according to claim 1, wherein The osteoporosis is postmenopausal osteoporosis.

Images