DNA molecule gating delivery system based on internal environment response osteogenesis and angiogenesis coupling

Abstract

The invention provides a DNA molecule gating delivery system based on internal environment response osteogenesis and angiogenesis coupling. The drug delivery system can sense bone injury, repair blood vessel microenvironment and deliver osteogenesis regulatory factors, and realizes internal environment response osteogenesis / blood vessel formation coupled synergetic drug delivery system. The system can overcome the defect that most bone biological materials cannot sense the change of the internal environment when regulating and controlling the internal environment unidirectionally at present, the biological materials are endowed with the characteristic of intelligently sensing the change of the internal environment and making functional adaptation in time, the characteristics of intelligent sensing and dynamic adaptation of the intelligent bone biological materials are really realized, the bone regeneration efficiency is remarkably improved, and the bone regeneration cost is reduced. And the method has important social and clinical significance on the research of bone repair materials.

Description

Technical field:

[0001] The invention relates to the field of bone repair materials, and in particular to a DNA molecule gated delivery system based on internal environment response osteogenesis and angiogenesis coupling. Background technology:

[0002] How to establish an intelligent drug delivery system that releases drugs responsively to the internal environment of bone trauma repair to regulate the synergistic coupling of osteogenesis and angiogenesis to promote bone formation has always been a key issue that needs to be urgently addressed in the field of bone repair materials and bone regeneration.

[0003] The mutual coordinated regulation between osteoprogenitor cells or osteoblasts and endothelial cells plays a key role in ensuring effective bone tissue repair. After fracture, vascularization occurs in the bone defect area. Blood vessels provide oxygen and nutrients to the defect area and play an important role in regulating the cells and signaling molecules involved in osteogenesis. This process, known as vascular tropism, enhances the spatial coupling between vascularization and osteogenesis and promotes effective bone repair. The osteoprogenitor cell lineage actively participates in the expansion of the endothelial vascular front and promotes angiogenesis by secreting multiple cytokines, such as vascular endothelial growth factor (VEGF) and other related factors. VEGF is a master regulator of vascular development and is essential for the effective integration of angiogenesis and osteogenesis during bone formation and postnatal bone repair. In fact, during bone regeneration, there is a balance between VEGF-induced angiogenesis, osteogenesis, and bone resorption, as overexpression of VEGF directly affects the differentiation of osteoblasts and causes a paradoxical loss of bone mass by excessive recruitment of osteoclasts. Therefore, only the precise crosstalk between angiogenesis and osteogenesis can ensure the timely conversion of angiogenesis to osteogenesis and the smooth progress of bone formation.

[0004] Currently, a large amount of research work is underway to develop delivery systems for bone morphogenetic proteins (BMPs) and vascular endothelial growth factors (VEGFs), such as BMPs and VEGF, aiming to mimic the synergistic environment of angiogenesis and osteogenesis. However, these delivery systems can only regulate the two events of osteogenesis and angiogenesis separately. Although these two events may sense each other, they lack the ability to closely coordinate their activities. This may disrupt the balance among VEGF-induced angiogenesis, osteogenesis, and bone resorption, leading to insufficient bone regeneration. The functional activity of osteoblasts is of great significance for accelerating the repair of bone defects and treating osteoporosis. Therefore, enhancing the differentiation activity of cells through drugs has become the main means of treating the above diseases. Traditional drug delivery methods mainly release bioactive molecules that promote osteogenic differentiation of cells, such as bone morphogenetic protein (BMP), parathyroid hormone (PTH), etc., through oral administration or local tissue engineering scaffolds. However, the above drugs have poor targeting: when the concentration is low, the low spatial targeting makes it difficult for the drugs to accumulate on osteoblasts to play a role; when the concentration is high, the low temporal targeting makes the drugs continuously act on enhancing osteogenesis, disrupting the body's bone homeostasis, triggering negative feedback and other mechanisms, reducing the drug efficiency, and causing toxic and side effects.

[0005] Therefore, developing a new delivery system that can precisely sense and coordinate the effective interaction between osteogenesis and angiogenesis remains a major challenge in the vascularized bone regeneration of large bone defects. Summary of the Invention:

[0006] (1) Technical problems to be solved

[0007] In view of the problem of poor drug targeting during the treatment of bone trauma repair and the lack of an effective drug delivery system to coordinately regulate osteogenesis and angiogenesis, the present invention proposes a DNA molecular gating delivery system based on the coupling of osteogenesis and angiogenesis in response to the internal environment. This delivery system can sense the vascular microenvironment of bone injury repair and deliver osteogenic regulatory factors, achieving the coupling and synergy of osteogenesis / angiogenesis in response to the internal environment.

[0008] (2) Technical solutions

[0009] To solve the above technical problems, the present invention adopts the following technical solutions:

[0010] Provide a matrix platform for the release of drug-loaded nanoparticles, and chemical functional groups are provided on the surface of the matrix platform to crosslink nucleic acid molecule F50 through chemical reactions;

[0011] Nanoparticles loaded with active drugs, the nanoparticles encapsulate osteogenic regulatory drugs, and the surface of the nanoparticles is modified with nucleic acid aptamer Aptamer 19s to target bone marrow stromal stem cells (BMSCs);

[0012] The DNA molecular switch is composed of a nucleic acid sequence comp15 modified on the surface of the nanoparticle, a nucleic acid sequence F50 on the surface of the matrix platform, and nucleolin protein.

[0013] Furthermore, the matrix platform is a small intestinal submucosa acellular matrix SIS with angiogenesis-inducing activity and a true bone ceramic TBC scaffold, abbreviated as TBC / SIS.

[0014] Furthermore, the osteogenic regulatory drug is miRNA-26a or BMP2.

[0015] Furthermore, the nucleic acid aptamer Aptamer19s and the Comp15 are connected into an integral sequence.

[0016] The present invention also provides a preparation method of a DNA molecular gating delivery system based on endo-environment-responsive osteogenesis and angiogenesis coupling, comprising the following steps:

[0017] Nanoparticle preparation: The nanoparticle selects a non-viral cationic polymer polyethyleneimine polymer PEI-SS-CL for delivering the osteogenic induction gene miRNA-26a. By introducing disulfide bonds and pH-sensitive functional groups, it is ensured that the nanoparticles can be cleaved by the acidic environment of endosomes and glutathione during intracellular transport to release the delivered drug. To improve the stability of the nanoparticle cationic polymer in serum, its surface is modified with serum albumin HSA.

[0018] S1. Preparation of the PEI-SS-CL core of the nanoparticle:

[0019] Polyethyleneimine-disulfide-crosslinker PEI-SS-CL is synthesized as follows. Dissolve 2-hydroxyethyl disulfide (16.7 mmol) and anhydrous triethylamine (34.7 mmol) in anhydrous dichloromethane (20 mL), and stir at 0 °C for 20 minutes. Then, dissolve trichlorobenzene trichloride (11.7 mmol) in dichloromethane (10 mL) and add it dropwise to the solution. After the mixture reacts at room temperature for 1 hour, terminate the reaction with diethyl ether (150 mL). After filtration and concentration, dissolve the crude product in dichloromethane (5 mL) and precipitate it with hexane (50 mL) to obtain the crosslinker, a yellow solid. Dissolve PEI 1.8K (1.5 mmol) and an appropriate amount of anhydrous triethylamine in 1 mL of anhydrous dichloromethane, and stir at 0 °C for 20 minutes. Then, dropwise add the crosslinker (1.5 mmol) dissolved in anhydrous dichloromethane. The mixture reacts at room temperature for 2 hours and then is dialyzed in deionized water for 2 days. Finally, obtain PEI-SS-CL by freeze-drying.

[0020] S2. Preparation of the pHSA shell of the nanoparticle

[0021] The human serum albumin (HSA) was modified through chemical modification and PEGylation reactions to finally obtain PEGylated HSA (pHSA). Specifically: Ethylenediamine dihydrochloride (10 g, 75 mmol) was dissolved in H2O (30 mL) and degassed by sonication for 15 minutes. Human serum albumin (HSA, 300 mg, approximately 4.5 μmol) and EDC (2.484 g, 16 mmol) were added and the reaction was carried out for 2 hours. The reaction was terminated by adding 2 mL of NaAc buffer (4 M, pH = 4.75), and then ultrafiltration was performed using NaAc buffer and water, filtering three times respectively (molecular weight cut-off: 10 KDa, 4000 rpm, 30 minutes), and cHSA was obtained by lyophilization. cHSA (0.1 g) was dissolved in urea phosphate buffer (50 mL, 20 mM phosphate buffer, pH 7.4, 5 M urea and 2 mM EDTA) and stirred at room temperature for 15 minutes. TCEP (43 mg, 0.17 mmol) was added and stirred under a nitrogen atmosphere for 30 minutes. Then HOOC-PEG-maleimide (1.2 g, 0.24 mmol) was added and the mixture was reacted for 3 hours. Subsequently, maleimide (40 mg, 0.41 mmol) was added and stirred for another 3 hours to react with the remaining thiol groups. Ultrafiltration was performed three times using Tris-HCl buffer (20 mM, pH 7.4, 150 mM NaCl, 2 mM EDTA) (molecular weight cut-off: 100 KDa, 8000 rpm, 30 minutes), washed with water, and pHSA was obtained by lyophilization.

[0022] S3. Preparation of pH-sensitive nanoparticle shell ppHSA:

[0023] pHSA (0.1 g) was dissolved in H2O (36 mL). Then the pH-sensitive molecule PEBA (0.4 g, 1.75 mmol) and EDC (0.609 g, 3.9 mmol) were added and reacted overnight at room temperature. After the reaction, ultrafiltration was performed three times using water (molecular weight cut-off: 100 KDa, 8000 rpm, 30 minutes), and the pH-sensitive nanoparticle shell ppHSA was obtained by lyophilization.

[0024] S4. Preparation of miRNA-26a-loaded nanoparticles pmHSA:

[0025] Mix PEI-SS-CLs (32 μg) and miRNA (16 μg), incubate for 1 hour at room temperature, and then add ppHSA. NHS and EDC dissolved in phosphate buffer solution (PBS) are used to activate carboxyl groups. Add H2N-APT19S-Comp15 (4 nmol) and react for 12 hours. Wash the reaction solution by ultrafiltration (molecular weight cut-off: 100 kDa, 8000 rpm, 30 minutes), wash three times with water and lyophilize to obtain pmHSA.

[0026] S5. Preparation of an endo-environment-responsive DNA molecular gating delivery system by compounding nanoparticles with TBC / SIS

[0027] Preparation of the true bone ceramic / small intestinal submucosa acellular matrix TBC / SIS scaffold: Boil the original bone and dehydrate it successively with alcohols of different concentrations. Subsequently, dry it at 70 °C for 3 days. Calcinate the dried bone for 6 hours to remove organic substances. Immerse it in diammonium hydrogen phosphate (NH4)2HPO4 (0.5 M) for 24 hours and calcinate it at 1300 °C for 1 hour to obtain the TBC scaffold. To prepare SIS, mechanically separate, defat, enzymatically digest, wash, freeze-dry and sterilize porcine small intestine successively. To prepare a 1% SIS solution, add SIS powder to an aqueous solution containing acetic acid (3%) and pepsin (0.1%) and stir for 48 hours. To prepare the TBC / SIS scaffold, immerse the TBC scaffold in the SIS solution for 5 minutes. Crosslink the TBC / SIS scaffold using N-hydroxysuccinimide / 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride NHS / EDC. After crosslinking, lyophilize the TBC / SIS scaffold and sterilize it using ethylene oxide.

[0028] To construct a ribosomal protein-reactive nanoparticle release system, add 5'-amino-modified F50 (25 μL, containing 100 pmol) to the prepared TBC / SIS scaffold in five portions successively. Use NHS and EDC for crosslinking during the process. Subsequently, lyophilize the scaffold again and add the pmHSA solution in five portions with a total volume of 25 μL (containing 60 pmol of miR-26a). After reacting for 24 hours, obtain the TSN / miR / NAPT scaffold.

[0029] To prepare the TSN, TSN / miR, and TSN / miR / APT scaffolds, load nanoparticles without miRNA and APT19S-Comp15, nanoparticles containing only miRNA, and nanoparticles containing miRNA and APT19S-Comp15 into the TBC / SIS scaffold without F50 using the same method.

[0030] The present invention also provides the application of the above DNA molecule gated delivery system in the preparation of bone repair drugs.

[0031] The present invention proposes a vascular microenvironment-responsive delivery system - a true bone ceramic / small intestinal submucosa acellular matrix scaffold delivers aptamer Aptamer19s-functionalized nanoparticles (encapsulating osteogenic-inducing miRNA-26a) through the base complementary pairing / dissociation mode of a DNA molecular switch. This molecular switch consists of the nucleic acid sequence comp15 on the nanoparticle surface, the nucleic acid sequence F50 on the scaffold surface, and the nucleolin protein secreted by vascular endothelial cells. Comp15 and the nucleolin protein competitively bind to F50 respectively. Under the condition of no vascular secretion of nucleolin, the nanoparticles are anchored on the scaffold surface due to the complementary pairing of comp15 and F50. When SIS initiates angiogenesis and promotes endothelial cells to secrete nucleolin protein, F50 can specifically recognize and bind to the nucleolin protein, triggering the dissociation of comp15 and F50 and releasing the nanoparticles, thus forming a vascular microenvironment-responsive delivery system. In addition, the modification of aptamer Aptamer19s endows the nanoparticles with specific affinity for mesenchymal stem cells (MSCs) and recruits MSCs to the perivascular region, aiming to achieve the spatial coupling between MSCs and blood vessels. Finally, delivering nanoparticles packaged with miRNA-26a can enhance osteogenic activity and promote the secretion of angiogenic factors, thus playing a "positive feedback" role, promoting the spatio-temporal coupling of vascularization-osteogenesis and promoting bone regeneration. Table 1 shows the sequences of F50 and APT19S-Comp15.

[0032] Table 1. Sequences of F50 and APT19S-Comp15

[0033]

[0034] (III) Beneficial effects

[0035] The present invention provides a novel intelligent bionic delivery system responsive to the internal environment of bone injury repair, which can sense the vascular microenvironment of bone injury repair and deliver osteogenic regulatory factors, realizing an internal environment-responsive osteogenesis / angiogenesis coupling and synergistic drug delivery system. The present invention can overcome the disadvantages of most current bone biomaterials that unidirectionally regulate the internal environment and cannot sense changes in the internal environment, endowing the biomaterials with the characteristics of intelligent sensing of internal environment changes and timely making functional adaptations, truly realizing the characteristics of intelligent bone biomaterials of intelligent sensing and dynamic adaptation, and significantly improving the bone regeneration efficiency. Description of the drawings:

[0036] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required to be used in the embodiments.

[0037] Figure 1Schematic diagram of the positive feedback coupling of vascularization and ossification during the osteogenic repair process by the TSN / miR / NAPT composite scaffold. In the figure, TBC / SIS plays a starting role in osteogenesis and angiogenesis. The DNA nanoswitch releases nanoparticles when contacting nucleolin on the surface of neonatal vascular endothelial cells. APT19S on the surface of the nanoparticles induces the migration of BMSCs to the perivascular area and realizes the targeted delivery of miR-26a, thereby promoting the osteogenic differentiation of BMSCs and further secreting VEGF, establishing a positive feedback between vascularization and ossification;

[0038] Figure 2 Synthesis and release characteristics of pmHSA nanoparticles. Among them, A is the zeta potential diagram of HSA and its derivatives; the figure shows that the derivatives always maintain a positive potential, which is beneficial for them to enter cells. B shows that the charge of ppHSA is reversed under acidic or alkaline conditions after adding PEBA. C is the determination of the molecular weight and PDI of PEI-SS-CL by GPC, using a series of narrow-distribution PEO / PEG as standards. D is the capture efficiency of PEI-SS-CL for miR-26a, indicating that PEI-SS-CL can effectively encapsulate miR-26a. The first column is the marker, and the second to sixth columns are the mass ratios of PEI-SS-CL to miR-26a, which are 0, 0.5, 1, 2, and 3 in turn. E is the fluorescence standard curve of miR-26a, and the standard equation is F = 391.47c + 3.38, R2 = 0.997. F is the fluorescence change of miR-26a before and after being loaded into pmHSA. G is the fluorescence standard curve of APT19S-Comp15, and the standard equation is F = 34.12(100.4c - 37.00), R2 = 0.998. H is the fluorescence change of APT19S-Comp15 before and after being loaded into pmHSA. I-K are the morphological characterizations of pmHSA nanoparticles: among them, the representative TEM image (I) shows uniformly round pmHSA particles. The SEM image (J) shows spherical pmHSA structures. (K) DLS characterization shows that the size of pmHSA nanoparticles is 297 ± 4 nm. L and M are the release characteristics of pmHSA: among them, the TEM image (L) of pmHSA nanoparticles treated with pH 5.29 and 5 mM GSH shows structural collapse; the TEM image (M) of pmHSA nanoparticles treated with pH 7.4 shows stable structures under neutral conditions. N is the SEM image of the TBC substrate, O is the SEM image of the TBC / SIS composite substrate, and P is the SEM image of the TBC / SIS / pmHSA composite material.

[0039] Figure 3For the loading, release and cell transfection of nanoparticles in scaffolds. Among them, A is the confocal microscopy image of nanoparticle loading in the scaffold; B is the Calcein-AM staining of BMSCs co-cultured with different groups of scaffolds on the 1st, 3rd and 5th days; C is the release curve of Cy3-miRNA complex from the hydrogel; D is the cell viability of BMSCs co-cultured with different groups of scaffolds on the 3rd and 5th days; E is the representative image of miRNA transfection in BMSCs co-cultured with the scaffold; F is the flow cytometry analysis of miRNA transfection in BMSCs.

[0040] Figure 4 For the proliferation, adhesion and osteogenic differentiation of BMSCs on scaffolds. Among them, A is the schematic diagram of cell proliferation, adhesion and osteogenic induction. B is the two-dimensional and three-dimensional confocal images of the cytoskeleton of BMSCs seeded on different scaffold surfaces. C is the two-dimensional and three-dimensional confocal images of the proliferation of BMSCs seeded on different scaffold surfaces. D is the representative image of ALP staining of BMSCs. E is the representative image of ARS of BMSCs. F is the quantitative analysis of ALP staining in BMSCs. G is the quantitative analysis of ARS in BMSCs. H is the Transwell migration experiment showing the effect of the scaffold on BMSCs. I is the quantitative analysis of the Transwell migration experiment.

[0041] Figure 5 For the effects of different scaffolds on the expression of osteogenic differentiation-related proteins. Among them, A is the immunofluorescence staining of OCN in different groups of BMSCs after 14 days of osteogenic differentiation. B is the immunofluorescence staining of RUNX2 in different groups of BMSCs after 14 days of osteogenic differentiation. C is the quantitative analysis of the OCN immunofluorescence image. D is the quantitative analysis of the RUNX2 immunofluorescence image. E is the RT-PCR analysis of the osteogenic gene expression level in BMSCs co-cultured with the scaffold.

[0042] Figure 6 For the composite scaffold to stimulate angiogenesis by promoting BMSCs to secrete VEGF. Among them, A is the schematic diagram of the composite scaffold stimulating angiogenesis. B is the ELISA detection of VEGF secreted by BMSCs derived from different groups of composite scaffolds. C is the detection of the cell migration ability of HUVECs by the Transwell experiment, D is the Transwell experiment to detect the cell migration of HUVECs and analyze the number of migrated cells. E is the image of the scratch assay of HUVECs cultured with conditioned medium, F and G are the quantitative analysis results of the scratch assay of HUVECs at 12 hours (F) and 24 hours (G). H is the tube formation assay of HUVECs treated with conditioned medium from different BMSC groups. H-K are the analysis of the number of connections (H), segments (I) and total segment length (K) of the HUVEC group, respectively.

[0043] Figure 7 To evaluate the effect of the composite scaffold on promoting bone defect repair in vivo. Among them, A shows the Micro-CT visualization results at 4 and 8 weeks after surgery. Red indicates thicker areas, and blue indicates thinner areas. B and C are semi-quantitative Micro-CT analyses at 4 and 8 weeks after surgery based on (BV / TV) (B) and BMD (C).

[0044] Figure 8 To perform histological staining to observe the osteogenic and angiogenic effects of the composite scaffold in vivo. Among them, A shows that at 4 and 8 weeks after surgery, tissue sections were stained with H&E and Masson's trichrome respectively. B is the quantitative analysis of the newly formed bone area. C is the quantitative analysis of the vascular density.

[0045] Figure 9 It is the SDS-PAGE result diagram of HSA and its derivatives. The results show that the molecular weights of the derivatives gradually increase, indicating the successful modification of each functional molecule.

[0046] Figure 10 It is the 1H NMR spectrum of the pH-responsive molecule. 1H NMR (400 MHz, CDCl3) δ 9.17 (s, 1H), 4.31 (t, J = 5.5 Hz, 2H), 2.92 (t, J = 5.5 Hz, 2H), 2.80 (s, 4H), 2.55 (m, J = 5.7, 3.6 Hz, 4H), 1.73 (m, J = 11.2, 5.6 Hz, 4H), 1.51 (d, J = 4.4 Hz, 2H)

[0047] Figure 11 It is the mass spectrum of the pH-responsive molecule.

[0048] Figure 12 It is the 1H NMR spectrum of PEI-SS-CL. The signal at chemical shift δ 4.08 is related to the proton (Ha, -NHCOOCH2CH2SS-) on the carbamate bond. The protons of PEI overlap with the protons of Hb (-NHCOOCH2CH2SS-) and appear at δ 2.39 - 2.55

[0049] Figure 13 It is the FT-IR spectra of PEI-SS-CL and PEI-1800. A stretching vibration peak appears at 1651 cm -1 which is attributed to the stretching vibration of the carbamate carbonyl in PEI-SS-CL. In PEI-1800, the characteristic infrared absorption peaks of amino groups are at 3309 cm -1 and 3369 cm -1 while in PEI-SS-CL, these two absorption peaks are shifted to 3286 cm -1 and 3375 cm -1, becoming the characteristic peak of the amide bond. Specific implementation manners:

[0050] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0051] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and the test materials used in the following embodiments are all commercially available through conventional commercial channels unless otherwise specified.

[0052] I. Experimental method:

[0053] (1) Establishment of cranial defect model

[0054] Rats were anesthetized by intraperitoneal injection of sodium pentobarbital, and the head hair was shaved and disinfected. The skin and subcutaneous tissues were incised layer by layer until the skull was exposed. The defect location was determined on the skull, and a full-thickness defect was created on both sides of the midline of the skull using a trephine with a diameter of 5 mm. During the operation, the area was continuously irrigated with normal saline to avoid overheating damage to the surrounding bone tissue. Subsequently, composite scaffolds of different groups were implanted into the defect area according to the predetermined design. The subcutaneous tissue and skin were sutured layer by layer and disinfected again. The animals were monitored until the anesthesia was completely recovered. Throughout the process, special attention was paid to animal welfare to minimize any potential harm or discomfort.

[0055] At the predetermined time points (4 weeks and 8 weeks after surgery), the animals in each group were sacrificed using an overdose of anesthetic. The cranial specimens were collected and fixed with 4% formaldehyde. The fixed specimens were scanned using a Micro-CT system (SkyScan 1176, Bruker, Germany) to obtain CT data. The CT data were analyzed and visualized using CTAn, CTvol, and CTvox software (Bruker, Germany). The specimens were decalcified with EDTA, and after decalcification, the samples were embedded in paraffin and sectioned, followed by H&E staining, Masson trichrome staining, and immunofluorescence staining.

[0056] (2) Preparation of in vivo microenvironment-responsive osteogenesis / angiogenesis coupling delivery system

[0057] 1. Preparation of PEI-SS-CL

[0058] 2-Hydroxyethyl disulfide (16.7 mmol) and anhydrous triethylamine (34.7 mmol) were dissolved in anhydrous dichloromethane (20 mL) and stirred at 0 °C for 20 minutes. Subsequently, a dichloromethane solution (10 mL) of triphosgene (11.7 mmol) was added dropwise to the solution. The mixture was reacted at room temperature for 1 hour. After the reaction was terminated, diethyl ether (150 mL) was added. After filtration and concentration, the crude product was dissolved in dichloromethane (5 mL) and precipitated with hexane (50 mL) to obtain the crosslinker as a yellow solid. PEI 1.8K (1.5 mmol) and an appropriate amount of anhydrous triethylamine were dissolved in 1 mL of anhydrous dichloromethane and stirred at 0 °C for 20 minutes. The anhydrous dichloromethane solution of the crosslinker (1.5 mmol) was added dropwise. The mixture was reacted at room temperature for 2 hours and then dialyzed in deionized water for 2 days. PEI-SS-CL was obtained by lyophilization.

[0059] 2. Preparation of cHSA

[0060] Ethylenediamine dihydrochloride (10 g, 75 mmol) was dissolved in H2O (30 mL) and degassed by sonication for 15 minutes. HSA (300 mg, ~4.5 μmol) and EDC (2.484 g, 16 mmol) were added and reacted for 2 hours. The reaction was terminated by adding 2 mL of NaAc buffer (4 M, pH = 4.75). The product was ultrafiltered three times with NaAc buffer and water each (MWCO: 10 KDa, 4000 rpm, 30 minutes) and lyophilized.

[0061] 3. Preparation of pHSA

[0062] cHSA (0.1 g) was dissolved in urea phosphate buffer (50 mL, 20 mM phosphate buffer, pH 7.4, 5 M urea and 2 mM EDTA) and stirred at room temperature for 15 minutes. TCEP (43 mg, 0.17 mmol) was added under N2 atmosphere and stirred in the dark for 30 minutes. HOOC-PEG-maleimide (1.2 g, 0.24 mmol) was added and reacted for 3 hours. Subsequently, maleimide (40 mg, 0.41 mmol) was added and stirred for 3 hours to react with the remaining thiol groups. The mixture was ultrafiltered three times with Tris-HCl buffer (20 mM; pH 7.4, 150 mM NaCl, 2 mM EDTA) (MWCO: 100 KDa, 8000 rpm, 30 minutes), washed with water and lyophilized to obtain pHSA.

[0063] 4. Preparation of ppHSA

[0064] Dissolve pHSA (0.1 g) in H2O (36 mL). Subsequently, add the pH-sensitive molecule PEBA (0.4 g, 1.75 mmol) and EDC (0.609 g, 3.9 mmol), and react overnight at room temperature. Ultrafilter three times with water (MWCO: 100 KDa, 8000 rpm, 30 minutes), and lyophilize to obtain ppHSA.

[0065] 5. Preparation of pmHSA

[0066] Prepare a complex of PEI-SS-CL (32 μg) and miRNA (16 μg), incubate at room temperature for 1 hour, and then add ppHSA. Dissolve NHS and EDC in phosphate buffer (PBS) and add to activate the carboxyl group. Add H2N-APT19S-Comp15 (4 nmol) and react for 12 hours. Ultrafilter the reaction mixture three times with water (MWCO: 100 KDa, 8000 rpm, 30 minutes), and lyophilize to obtain pmHSA.

[0067] 6. Preparation of the composite scaffold

[0068] The preparation method of the TBC / SIS scaffold is as follows: Boil the obtained raw bones and dehydrate them with alcohol of different concentrations. Subsequently, dry them at 70 °C for 3 days. The dried bones are calcined for 6 hours to remove organic substances. After soaking in (NH4)2HPO4 (0.5 M) for 24 hours, the TBC scaffold is obtained by calcining at 1300 °C for 1 hour. To prepare SIS, the porcine small intestine is mechanically separated, defatted, enzymatically digested, washed, freeze-dried, and sterilized in sequence. Add the SIS powder to an aqueous solution containing acetic acid (3%) and pepsin (0.1%), and stir for 48 hours to prepare a 1% SIS solution. Immerse the TBC scaffold in the SIS solution for 5 minutes, and use NHS / EDC to crosslink the TBC / SIS scaffold. After crosslinking, the TBC / SIS scaffold is freeze-dried and sterilized with ethylene oxide. To construct a nucleolin-responsive nanoparticle release system, 5'-amino-modified F50 (25 μL, containing 100 pmol) is added to the prepared TBC / SIS scaffold in five portions. NHS and EDC are used for crosslinking during this process. Subsequently, the scaffold is freeze-dried again, and the pmHSA solution is added dropwise in five portions with a total volume of 25 μL (containing 60 pmol miR-26a). The reaction proceeds for 24 hours to prepare the TSN / miR / NAPT scaffold. The addition amount of miR-26a and the nanoparticle dropping method are based on previously published literature. For the preparation of the TSN, TSN / miR, and TSN / miR / APT scaffolds, nanoparticles without miRNA and APT19S-Comp15, nanoparticles containing only miRNA, and nanoparticles containing both miRNA and APT19S-Comp15 are loaded into the F50-free TBC / SIS scaffold using the same method as above. The F50 and APT19S-Comp15 sequences are listed in Table 1.

[0069] To confirm the successful loading of nanoparticles onto the TBC / SIS scaffold, the prepared scaffold is freeze-dried and sputter-coated with gold (IBS / TM200S, VCR Group, Inc.). Subsequently, the loading of nanoparticles inside the scaffold is observed using SEM (Nova NanoSEM 450, FEI, Netherlands). To further observe the distribution of miRNA inside the scaffold, CY3-labeled miRNA is introduced into the nanoparticles and the scaffold using the above method. Subsequently, images are taken using a confocal microscope (FV3000, Olympus, Japan) to observe and examine the distribution of miRNA inside the scaffold.

[0070] 7. Loading and Release of Nanoparticles in the Scaffold

[0071] The composite scaffolds containing CY3-labeled miRNA were washed three times with sterile PBS to remove the nanoparticles loosely attached to the surface of the scaffolds. Subsequently, the scaffolds were immersed in sterile PBS (200 μL) or sterile PBS containing nucleolin, and cultured in the dark on a shaker at 37 °C. The amount of nucleolin added was three times the amount of F50 to ensure the complete release of the nanoparticles. The extraction medium was collected at the predetermined time points, and fresh solution was replaced for further analysis. GSH was added to the collected liquid to promote the complete release of miRNA. Quantitative analysis was performed using a multifunctional microplate reader equipped with fluorescence detection (EnSpire, PerkinElmer, USA). The fluorescence intensity of 60 pmol miRNA was used as a reference, and the results were expressed as the percentage of released miRNA.

[0072] 8. Cell culture

[0073] The isolation of rat bone marrow mesenchymal stem cells (BMSCs) is a conventional technique and will not be elaborated here. This study was approved by the Teaching and Research Ethics Committee of Huazhong University of Science and Technology. SD rats aged 3 to 4 weeks were used. After sacrifice, the femurs were collected. The femurs were washed with α-minimum essential medium (α-MEM) to isolate BMSCs. The collected BMSCs were cultured in α-MEM containing 10% fetal bovine serum (FBS) under the conditions of 37 °C and a humidified environment of 5% CO2. To simulate the neovascular environment, nucleolin was added to the culture medium. BMSCs of passages 3 to 5 were used in the experiment. Human umbilical vein endothelial cells (HUVECs) were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences. These cells were cultured in DMEM containing 10% FBS under the conditions of 37 °C and a humidified environment of 5% CO2.

[0074] 9. Cell viability assay

[0075] To determine the effect of different scaffolds on cell viability, BMSCs were seeded into a well plate, and different composite scaffolds were placed in the upper chamber of a Transwell plate (Costar, Cambridge, MA, USA). At the predetermined time points, the cells were treated with Cell Counting Kit-8 reagent (Beyotime C0038, China), and the supernatant was collected and the absorbance was measured using a microplate reader. For Calcein-AM and propidium iodide staining, the cells were stained at the predetermined time points according to the kit instructions. Subsequently, images were taken using a fluorescence microscope (Leica, Germany).

[0076] 10. Proliferation and adhesion of BMSCs on the surface of the scaffolds

[0077] To study the growth and adhesion of BMSCs on the surface of the scaffold, BMSCs were seeded onto the prepared composite scaffolds. After 5 days of culture, the cells were stained with Calcein-AM and propidium iodide according to the kit instructions. Phalloidin (Proteintech Group) was used for cell staining. These staining methods were used to evaluate the proliferation and adhesion of BMSCs on the surface of the scaffold. After staining, the cells were imaged using a laser scanning confocal microscope (FV3000, Olympus) to further analyze and visualize the growth and adhesion behavior of the cells on the scaffold.

[0078] 11. Cell uptake

[0079] The nanoparticle delivery ability of the composite scaffolds was evaluated using a confocal microscope and a flow cytometer (Guava easyCyte; Merck). Sterile composite scaffolds from different groups were immersed in medium containing nucleolin for 5 days to prepare the corresponding extraction medium. After culture, the extraction medium was collected and used to culture BMSCs for 8 hours. After reaching the predetermined culture time, the cells were stained for the cell nucleus and cytoskeleton for imaging by confocal microscopy. Alternatively, the cells were digested with trypsin for flow cytometry analysis.

[0080] 12. Cell migration ability

[0081] To evaluate the effect of the composite scaffolds on the migration of BMSCs, BMSCs were seeded in the upper chamber of a Transwell, and composite scaffolds from different groups were placed in the lower chamber to establish co-culture. After 24 hours of BMSC culture, the cells on the upper surface of the Transwell were fixed and stained with crystal violet solution. The stained BMSCs were imaged under a microscope. The obtained images were analyzed using ImageJ software.

[0082] For the migration evaluation of HUVECs, Transwell and cell scratch assays were used. First, after co-culturing BMSCs with composite scaffolds from different groups for 5 days, the supernatant containing BMSC-secreted factors was collected and used to prepare the conditioned medium for HUVECs. For the Transwell assay, the same cell treatment was performed on HUVECs, and the cells were observed under a microscope. For the cell scratch assay, HUVECs were seeded in six-well plates at a density of 1×105 cells / well and cultured in DMEM containing 10% FBS until 90% confluence. The cells were washed twice with sterile PBS, and a linear scratch was created at the bottom of the well. Subsequently, the cells were cultured in the prepared BMSC conditioned medium. At 0, 12, and 24 hours, the cells were stained with Calcein-AM and images were taken under a fluorescence microscope. The obtained images were quantitatively analyzed using ImageJ software.

[0083] 13. Osteogenic differentiation induction

[0084] For the osteogenic differentiation induction of BMSCs, the cells were first seeded in 24-well plates and cultured in α-MEM containing 10% FBS. When the cell confluence reached 60 - 70%, the medium was changed to osteogenic differentiation induction medium, which contained 10×10-3M β-glycerophosphate, 10×10-9M dexamethasone, and 0.2×10-3M L-ascorbic acid 2-phosphate (Sigma-Aldrich, USA). Nucleolin was added to the medium to mimic the neovascularization condition. The composite scaffolds of different groups were placed in the upper chamber of Transwell, and BMSCs and the scaffolds were co-cultured in the induction medium.

[0085] 14. ALP and ARS staining

[0086] After the predetermined time of osteogenic differentiation induction (7 days for ALP and 14 days for ARS), the early and late osteogenic differentiation abilities of BMSCs were evaluated using ALP and ARS staining, respectively. For ALP staining, BMSCs were fixed with paraformaldehyde. Subsequently, ALP staining and activity analysis were performed according to the instructions of Beyotime Biotechnology Institute (China). For ARS staining, the cells were stained with 0.1% ARS solution (Solarbio, China) for 15 minutes according to the manufacturer's instructions. The stained cells were observed under a microscope. For the quantitative analysis of ARS staining intensity, the cells were incubated with 10% cetylpyridinium chloride (Sigma-Aldrich), and the supernatant was collected to detect the absorbance at 562 nm.

[0087] 15. RT-PCR

[0088] To verify the differences in gene expression levels, RT-PCR experiments were performed on BMSCs after 14 days of osteogenic differentiation induction. Total RNA of BMSCs was extracted using TRIzol, and then the total RNA was reverse-transcribed into cDNA using PrimeScript RT Master Mix reverse transcription kit (Takara Bio Inc., Japan). The obtained cDNA was quantified using RT-PCR. The primer sequences are listed in Table 2 below.

[0089] Table 2. Primers for real-time fluorescence quantitative PCR analysis

[0090] Forward primer Reverse primer β-actin CACCCGCGAGTACAACCTTC CCCATACCCACCATCACACC Alp CCTGACTGACCCTTCCCTCT CCTTTCCGATGGCCTCATCC Col-1 GACCTCAAGATGTGCCACT GAACCTTCGCTTCCATACTCG Runx-2 TTCCTGTGCTCCGTGCTG AAAGTGAAACTCTTGCCTCGTC OPN GAGGTGATAGCTTGGCTTACGG ACGCTGGGCAACTGGGAT

[0091] 16. Immunofluorescence staining

[0092] BMSCs were co-cultured with composite scaffolds of different groups for 14 days for osteogenic differentiation induction. After the induction period, immunofluorescence staining was performed to verify the differences in the expression levels of osteogenesis-related proteins. After the predetermined culture time, the cells were fixed with paraformaldehyde. Subsequently, the cells were permeabilized with 0.1% Triton X-100 PBS solution. After permeabilization, the cells were blocked with 0.5% bovine serum albumin. After blocking, the cells were incubated overnight at 4 °C with primary antibodies against OCN (Proteintech Group, China) and Runx-2 (Santa Cruz, USA). Subsequently, the cells were incubated with the appropriate secondary antibody for 1 hour. Phalloidin was used to stain the cytoskeleton and DAPI was used to stain the cell nuclei. After staining, the cells were washed with PBS and imaged using a confocal microscope. The obtained images were quantitatively analyzed using ImageJ software.

[0093] 17. ELISA

[0094] To measure VEGF secreted by BMSCs, BMSCs were co-cultured with composite scaffolds for 8 hours. After co-culture, the composite scaffolds were removed and the medium was replaced with fresh growth medium containing 5.0% serum replacement Nu-Serum (BD, USA). After incubation for 72 hours, the supernatant was collected. The concentration of VEGF in the supernatant was measured using a commercial ELISA kit (R&D Systems, USA) according to the manufacturer's instructions.

[0095] 18. Tube formation assay

[0096] HUVECs were seeded in 96-well plates coated with Matrigel at a density of 2×104 cells / well and incubated in the conditioned medium of BMSCs of different groups. After incubation for 4 hours, the cells were stained with Calcein AM and imaged in three random fields by fluorescence microscopy. The obtained images were analyzed using ImageJ software and the cell pseudocolor was adjusted for better visualization and quantification of cell behavior.

[0097] 19. Statistical analysis

[0098] Data are expressed as mean ± standard deviation. All experiments were repeated at least three times. Statistical analysis was performed using GraphPad Prism (version 7.0), and statistical significance was set at p < 0.05. One-way ANOVA was used to determine statistical significance, followed by Tukey's multiple comparison test.

[0099] II. Experimental results

[0100] (I) Preparation and characterization of pmHSA nanoparticles

[0101] In this example, uniform and multifunctional pmHSA nanoparticles were designed. Two biodegradable polymers (disulfide-crosslinked PEI and pH-responsive HSA-derived biopolymer, abbreviated as PEI-SS-CL and ppHSA respectively) were synthesized to form the pmHSA precursor. ppHSA was prepared based on the "unfolding-refolding" strategy established in the laboratory. HSA was modified by introducing ethylenediamine to carry more amino groups, and polyethylene glycol (PEG) was added to improve the water solubility of the nanoparticles. The pH-responsive molecule 4-oxo-4-(2-(piperidin-1-yl)ethoxy)butyric acid (PEBA) (see Figure 10 , Figure 11 ) was introduced to promote charge inversion at acidic pH. The charge of the HSA derivative was inverted and remained positive, which helped to improve the transfection efficiency (as shown in A of Figure 2 ). After adding PEBA, ppHSA underwent charge inversion in both acidic and alkaline environments (as shown in B of Figure 2 ). The molecular weight of the HSA derivative gradually increased and finally reached about 250 kDa after adding PEG ( Figure 9 ), confirming the effective modification of the functional molecules. At the same time, in order to improve the loading efficiency of the gene vector, reduce its toxicity and achieve glutathione (GSH) responsiveness, PEI-1800 was modified by disulfide crosslinking to obtain PEI-SS-CL. The synthesized PEI-SS-CL had a molecular weight of about 287 kDa, which was about 160 times that of PEI-1800 ( Figure 2 C). Nuclear magnetic resonance (1H NMR) and infrared spectroscopy (IR) both confirmed the successful crosslinking (as shown in Figure 12 and Figure 13 ). PEI-SS-CL encapsulated miR-26a at a weight ratio of 1:1 to form a stable complex ( Figure 2 D), and this complex could interact with ppHSA through nanoprecipitation to generate nanoparticle intermediates. The loaded miR-26a concentration was 0.43 μmol / L ( Figure 2 E, F). APT19S-Comp15 was attached to the outer layer to recruit a large number of BMSCs for homing and regulate the entry of nanoparticles into stem cells during angiogenesis. By detecting the fluorescence absorption of FAM-APT19S-Comp15, its loading concentration was shown to be 1.71 μmol / L ( Figure 2 G, H). Finally, pmHSA nanoparticles were formed by adding APT19S-Comp15. The final size of pmHSA was 297 nm, with a uniform spherical morphology ( Figure 2 I-K). Transmission electron microscope (TEM) images showed that the nanoparticles collapsed under the conditions of pH 5.29 and 5 mM GSH ( Figure 2L), stable in neutral buffer solution Figure 2 M).

[0102] (II) Synthesis and characterization of composite scaffolds

[0103] The TBC / SIS / nanoparticle scaffold (TSN) was prepared by adding SIS to the TBC scaffold and then loading pmHSA into the SIS. According to the composition of the nanoparticles, the subgroups were named TBC / SIS / nanoparticle / miR-26a (TSN / miR), TBC / SIS / nanoparticle / miR-26a / APT-19S (TSN / miR / APT), and TBC / SIS / nanoparticle / miR-26a / APT-19S / nucleolin-responsive (TSN / miR / NAPT). The surface morphology of the TSN / miR / NAPT scaffold was observed using scanning electron microscopy (SEM), and the results are shown in Figure 2 Figure P. SIS completely covered the TBC scaffold, and a large number of nanoparticles loaded in the SIS were observed. To observe the loading of miRNA in the scaffold, confocal microscopy was used to image the scaffolds of different groups, and the results are shown in Figure 3 Figure A. No fluorescence was observed in the TSN group without miRNA, while red fluorescence indicating miRNA was shown in the remaining three groups. Figure 3 Figures B and D show the growth of BMSCs after co-culture with the scaffold for a period of time. BMSCs in all groups did not show obvious cell death or enhanced proliferation, indicating that the substances released by the scaffold had no obvious cytotoxicity to BMSCs.

[0104] Nucleolin is a surface marker of vascular endothelial cells. Nanoparticles were attached to the scaffold using a nucleolin-responsive sequence to construct a DNA nanoswitch, enabling it to release in response to nucleolin on the surface of newly formed vascular endothelial cells. The release curve of miRNA on the scaffold surface is shown in Figure 3 Figure C. In the TSN / miR / NAPT group without nucleolin, a slight decrease in the miRNA release rate was observed, while after adding nucleolin, miRNA was rapidly released. During bone regeneration, new blood vessels continuously grow from the periphery of the defect towards the inside of the defect. This responsive release property of the TSN / miR / NAPT scaffold provides a basis for achieving spatiotemporal "positive feedback" angiogenesis-ossification coupling. Angiogenesis reaches its peak 3-7 days after bone defect. Therefore, the immersion experiment was selected to be carried out 5 days after the scaffold was immersed to simulate the period when angiogenesis develops fastest Figure 3E, F). TSN / miR / NAPT showed the highest transfection efficiency. The possible reason is that the addition of nucleolin caused TSN / miR / NAPT to release more nanoparticles than other groups. The transfection efficiency of TSN / miR / APT was also higher than that of TSN / miR, which was attributed to the modification of APT19S to improve its ability to target BMSCs. The combination of nucleolin-responsive release of nanoparticles in the composite scaffold and targeted delivery to BMSCs laid the foundation for achieving the spatiotemporal coupling of vascularization and ossification during bone regeneration.

[0105] 3. In vitro osteogenic capacity assessment

[0106] Proper cell adhesion is a basic requirement for bone implants. To observe the adhesion of BMSCs on the scaffold surface, confocal microscopy was used to obtain two-dimensional and three-dimensional images of the BMSCs cytoskeleton on the scaffold surface after 5 days of culture. The BMSCs on the surface and inside the scaffold showed a typical polygonal shape, indicating that they were able to adhere properly to the scaffold ( Figure 4 B). To evaluate the growth of BMSCs on the scaffold surface, calcein-AM staining was performed ( Figure 4 C). After 5 days of culture, the surface and interior of the scaffold were covered with BMSCs, indicating that the scaffold had good biocompatibility. Utilizing material-cell interactions and mobilizing appropriate stem / progenitor cells at the site of bone defect helps promote endogenous bone repair, a process known as stem cell homing. APT19S can specifically recognize and recruit BMSCs. To evaluate whether the nanoparticles released from the scaffolds can promote the migration of BMSCs under neovascularization conditions, BMSCs were co-cultured with different scaffolds and nucleolin ( Figure 4 H, I). TSN and TSN / miR groups did not show significant induction of BMSCs migration, while TSN / miR / APT and TSN / miR / NAPT groups showed improved migration ability, with the latter being relatively higher, which may be attributed to the promotion of nanoparticle release by nucleolin. The ability of the composite scaffold to promote BMSCs migration, adhesion, and biocompatibility provides the possibility of achieving better osteogenic differentiation of BMSCs.

[0107] To determine whether the composite scaffolds promote osteogenic differentiation of BMSCs, alkaline phosphatase (ALP) and alizarin red staining (ARS) were performed, and nucleolin was added to the osteogenic differentiation medium to simulate the neovascularized microenvironment. ALP is an early differentiation marker of osteoblasts, which is released into the extracellular space by osteoblasts through vesicles. It promotes the deposition of calcium ions on collagen fibers, thereby promoting biomineralization. BMSCs were stained for ALP after 7 days of culture ( Figure 4D, F). The ALP expression in the TSN / miR group was higher than that in the TSN group, which was due to the addition of miR-26a, thus improving osteogenic differentiation. In addition, compared with the TSN / miR group, the ALP expression in the TSN / miR / NAPT group was further increased. This increase was attributed to the APT19S-modified nanoparticles promoting targeted delivery to BMSCs and enhancing transfection efficiency ( Figure 3 F). Notably, when using the nucleolin-responsive release system, the TSN / miR / NAPT group showed the highest ALP expression level. The number of nanoparticles responsive to nucleotide release increased ( Figure 3 C), thus enhancing osteogenic differentiation. Meanwhile, ARS was used to detect late osteogenic differentiation. It chelated with calcium ions to form an orange-red complex, indicating biomineralization. After co-culturing for 14 days, BMSCs were stained with ARS, and the experimental results were as shown in Figure 4 E and 4G. The TSN / miR / NAPT group showed the most mineralized nodules and more obvious ARS-positive areas, indicating its stimulatory effect on extracellular matrix mineralization and calcification deposition.

[0108] To further verify the osteogenic induction effect, the expression of osteogenic differentiation-related factors was evaluated by PCR detection on the 7th day. After 7 days of osteogenic differentiation, the BMSCs in the TSN / miR / NAPT group showed the highest expression of osteogenesis-related genes ( Figure 5 E). Compared with the TSN group, the osteogenesis-related RNA expression in the TSN / miR group and the TSN / miR / APT group also increased. In addition, on the 14th day, the expression of osteogenic differentiation markers (osteocalcin [OCN] and Runt-related transcription factor 2 [RUNX2]) was evaluated by immunofluorescence staining ( Figure 5 A–D). The expression of OCN and RUNX2 was observed in all groups, and the expression level in the TSN / miR / NAPT group was the highest. The above results indicate that the nucleotide-responsive DNA nanoswitch has a higher release efficiency, and the targeted delivery of nanoparticles also improves transfection efficiency. The two work together to have a significant positive effect on osteogenic induction in the model of neovascular microenvironment.

[0109] (IV) Evaluation of in vitro angiogenesis ability

[0110] Regulating angiogenesis is a key factor in bone repair, and VEGF plays an important role in this process. 34 During osteogenic repair, BMSCs secrete VEGF to promote angiogenesis, which constitutes a bridge between osteogenesis and vascularization. When VEGF is inhibited, bone formation and invasion of the vascular system are reduced. 35 It has been reported that miR-26a promotes angiogenesis-osteogenesis coupling by upregulating VEGF expression in pre-osteoblasts / BMSCs. 36 To evaluate whether the composite scaffold promotes the secretion of VEGF by BMSCs, the level of VEGF in the supernatant was detected by enzyme-linked immunosorbent assay (ELISA) ( Figure 6 B). Compared with the TSN scaffold, other scaffolds significantly promoted the secretion of VEGF by miR-26a. The VEGF expression in the TSN / miR / APT group was significantly higher than that in the TSN / miR group. It is speculated that ATP19S may enhance the targeted delivery of miR-26a, thereby improving the transfection efficiency and further stimulating the secretion of VEGF by BMSCs. Among the groups, the VEGF level in the TSN / miR / NAPT group was the highest, indicating that the responsive release system in the TSN / miR / NAPT scaffold further promoted the secretion of VEGF by BMSCs by stimulating nucleolin. Nucleolin is expressed on the surface of endothelial cells during angiogenesis. In this way, the TSN / miR / NAPT scaffold equipped with a nucleolin-responsive release system is expected to promote angiogenesis through positive feedback.

[0111] To verify the indirect beneficial effect of the composite scaffold on angiogenesis, human umbilical vein endothelial cells (HUVECs) were cultured in conditioned media from different BMSC groups. The migration ability of HUVECs was studied by scratch wound healing assay and cell migration assay. The cell migration ability was studied using Transwell assay ( Figure 6 C, D). After 24 hours of inoculation, the number of migrated cells in the TSN / miR / NAPT group was the largest, indicating that the supernatant of BMSCs co-cultured with TSN / miR / NAPT promoted the migration of endothelial cells to the greatest extent. Figure 6 E shows the results of the scratch wound healing assay. At 12 hours and 24 hours, the exposed area and scratch length of each group decreased over time, and the scratch length in the TSN / miR / NAPT group decreased most significantly. The tube formation ability of HUVECs after co-culture was also evaluated ( Figure 6 H). The TSN / miR / NAPT group showed more honeycomb structures, and the number of connection points and segments was significantly different from that of other groups, indicating that HUVECs indirectly co-cultured with TSN / miR / NAPT exhibited stronger angiogenic potential. Therefore, it can be inferred that TSN / miR / NAPT enhances the osteogenesis-angiogenesis coupling by nucleolin-responsive release nanoparticles and targeted delivery of miR-26a to BMSCs.

[0112] (V) Evaluation of in vivo bone regeneration ability

[0113] The bone repair promoting effect of the composite scaffold was verified in a Sprague-Dawley (SD) rat cranial defect model. Specimens were taken for evaluation 4 weeks and 8 weeks after material implantation. The Micro-CT visualization results at different time points are shown in Figure 7 A as shown. From 4 weeks to 8 weeks after surgery, the new bone tissue gradually increased. The formation of new bone tissue was observed in all composite scaffolds, indicating good biocompatibility of each group of scaffolds in vivo and successful integration with the surrounding tissues. The scaffolds showed a certain degree of osteoinductive activity. The TSN / miR / NAPT group showed the strongest osteoinductive effect, resulting in the formation of a large amount of new bone at the defect site. Quantitative analysis by Micro-CT ( Figure 7 B, C as shown) showed that the bone volume fraction (BV / TV) and bone mineral density (BMD) of the TSN / miR / NAPT group were the highest at 4 weeks and 8 weeks after surgery.

[0114] The retrieved specimens were stained with hematoxylin and eosin (H&E) and Masson to further study the osteogenic and angiogenic effects of the composite scaffold in vivo. Figure 8 The staining results of tissue sections at 4 weeks and 8 weeks after surgery are shown. At all time points, no significant increase in inflammatory cells was observed in each group, indicating excellent biocompatibility of the composite scaffold. In addition, all composite scaffold groups showed good integration interfaces with the surrounding tissues. At 4 weeks after surgery, new bone formation was observed in all groups, and the new bone grew from the defect edge to the center. In particular, significant areas of new bone tissue were shown within the scaffolds in the TSN / miR / APT group and the TSN / miR / NAPT group. At 8 weeks after surgery, significant repair of the cranial defect was shown in all groups, and new bone tissue appeared at the center of the defect. The TSN / miR / APT group and the TSN / miR / NAPT group had the largest new bone area, and the TSN / miR / NAPT group had the most extensive defect repair. Quantitative analysis of blood vessels showed that the TSN / miR / APT group and the TSN / miR / NAPT group had more regenerated blood vessels, and the TSN / miR / NAPT group had more blood vessels than other groups. The observed in vivo bone defect repair indicated that the TSN / miR / NAPT scaffold exerted the greatest osteogenic repair effect.

[0115] In summary, the DNA molecular gating delivery system based on the coupling of osteogenesis and angiogenesis in response to the internal environment provided by the present invention can sense the vascular microenvironment of bone injury repair and deliver osteogenic regulatory factors, realizing the drug delivery with the coupling and coordination of osteogenesis / angiogenesis in response to the internal environment. This system can overcome the disadvantages of most current bone biomaterials that unidirectionally regulate the internal environment and cannot sense changes in the internal environment, endowing the biomaterials with the characteristics of intelligent sensing of internal environment changes and timely making functional adaptations, truly realizing the characteristics of intelligent sensing and dynamic adaptation of intelligent bone biomaterials, significantly improving the bone regeneration efficiency, and having great social and clinical significance for the research of bone repair materials.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the present invention and do not limit the protection scope of the present invention. In addition, after reading the technical content of the present invention, those skilled in the art can make various changes, modifications or variations to the present invention, and all these equivalent forms also belong to the protection scope defined by this application.

Claims

1. A DNA molecular gated delivery system based on internal environment response osteogenic and angiogenic coupling, characterized in that: include: Providing a matrix platform for releasing drug-loaded nanoparticles, wherein the surface of the matrix platform provides chemical functional groups for cross-linking nucleic acid molecules F50 through chemical reactions; Nanoparticles loaded with active drugs, the nanoparticles encapsulate osteogenic regulatory drugs, and the surface of the nanoparticles is modified with nucleic acid aptamer Aptamer 19s to target bone marrow stromal stem cells (BMSCs); A DNA molecular switch, wherein the DNA molecular switch is composed of a nucleic acid sequence comp15 modified on the surface of the nanoparticle, a nucleic acid sequence F50 on the surface of the matrix platform, and nucleolin protein.

2. A DNA molecule gated delivery system based on internal environment response osteogenic and angiogenic coupling according to claim 1, characterized in that: The matrix platform is a small intestinal submucosal decellularized matrix SIS with vascular induction activity and a real bone ceramic TBC scaffold, abbreviated as TBC / SIS.

3. A DNA molecular gated delivery system based on internal environment response osteogenic and angiogenic coupling according to claim 1, characterized in that: The osteogenic regulatory drug is miRNA-26a or BMP2.

4. A DNA molecular gated delivery system based on internal environment response osteogenesis and angiogenesis coupling according to claim 1, characterized in that: The nucleic acid aptamer Aptamer19s and the Comp15 are connected to form an overall sequence.

5. A method for preparing a DNA molecular gated delivery system based on internal environment response osteogenic and angiogenic coupling, characterized in that: The following steps are involved: S1. Preparation of Nanoparticle Core Polyethyleneimine-Disulfide Bond-Crosslinker PEI-SS-CL Polyethyleneimine-disulfide bond-crosslinker PEI-SS-CL is synthesized by the following method: 2-hydroxyethyl disulfide and anhydrous triethylamine are dissolved in anhydrous dichloromethane, trichlorobenzene trichloride is dissolved in dichloromethane, the obtained mixture is reacted at room temperature for 1 hour, and then the reaction is terminated with ether; then after filtering and concentration, the crude product is dissolved in dichloromethane, and precipitated with hexane to obtain a crosslinker; PEI and anhydrous triethylamine are dissolved in anhydrous dichloromethane, stirred at 0°C for 20 minutes, and then the crosslinker is added dropwise and dissolved in anhydrous dichloromethane, the mixture is reacted at room temperature for 2 hours, and then dialyzed in deionized water for 2 days, and finally PEI-SS-CL is obtained by freeze-drying; S2. Preparation of pHSA Nanoparticle Shell Human serum albumin HSA was modified by chemical modification and PEGylation reaction, and PEGylated pHSA was finally obtained; S3. Preparation of pH-sensitive nanoparticle shell ppHSA pHSA was dissolved in water, and then pH-sensitive molecules PEBA and EDC were added. After reacting at room temperature, water was used for three ultrafiltrations, and the pH-sensitive nanoparticle shell ppHSA was obtained by freeze-drying; S4. Preparation of pmHSA nanoparticles loaded with miRNA-26a PEI-SS-CLs and miRNA were mixed and incubated at room temperature for 1 hour, ppHSA was added, NHS and EDC dissolved in phosphate buffer PBS were used to activate the carboxyl group, H2N-APT19S-Comp15 was added, and the reaction was continued for 12 hours. The reaction solution was cleaned by ultrafiltration, washed three times with water and freeze-dried to obtain pmHSA; S5. Preparation of DNA molecular gated delivery system responsive to internal environment by nanoparticles and TBC / SIS composites. Preparation of real bone ceramic / small intestinal submucosal decellularized matrix TBC / SIS scaffold: The original bone was boiled, dehydrated with different concentrations of alcohol in sequence, and then dried at 70°C for 3 days. The dried bone was calcined for 6 hours to remove organic matter, and then immersed in diammonium hydrogen phosphate (NH4)2HPO4 for 24 hours, and calcined at 1300°C for 1 hour to obtain the TBC scaffold; To prepare SIS, the porcine small intestine was mechanically separated, defatted, enzymatically hydrolyzed, cleaned, freeze-dried and sterilized in sequence. To prepare a 1% SIS solution, SIS powder was added to an aqueous solution containing 3% acetic acid and 0.1% pepsin and stirred for 48 hours. To prepare a TBC / SIS scaffold, the TBC scaffold was immersed in the SIS solution for 5 minutes and cross-linked with N-hydroxysuccinimide / 1-ethyl-(3-dimethylaminopropyl)carbodiimide hydrochloride NHS / EDC. After cross-linking, the TBC / SIS scaffold was freeze-dried and sterilized with ethylene oxide. In order to construct a ribosomal protein-responsive nanoparticle release system, 5'-amino-modified F50 was added to the prepared TBC / SIS scaffold in five times, and NHS and EDC were used for cross-linking during the process. Then, the scaffold was freeze-dried again, and pmHSA solution was added dropwise in five times with a total volume of 25 μL. The pmHSA solution contained 60 pmol of miR-26a. After 24 hours of reaction, the TSN / miR / NAPT scaffold was obtained.

6. The method for preparing a DNA molecular gated delivery system based on internal environment response osteogenic and angiogenic coupling according to claim 5, characterized in that: The preparation method of the nanoparticle shell pHSA in step S2 is as follows: dissolving ethylenediamine dihydrochloride in water, degassing by ultrasonic treatment for 15 minutes, adding human serum albumin HSA and EDC, reacting for 2 hours, adding NaAc buffer to terminate the reaction, and then ultrafiltration using NaAc buffer and water, filtering three times respectively, and obtaining cHSA by freeze drying; dissolving cHSA in urea phosphate buffer, the urea phosphate buffer consisting of phosphate buffer, urea with pH 7.4 and EDTA, stirring at room temperature for 15 minutes, adding TCEP, stirring for 30 minutes under a nitrogen atmosphere, and then adding HOOC-PEG-maleimide, the mixture reacting for 3 hours, then adding maleimide, stirring for another 3 hours, reacting with the remaining thiol, ultrafiltration three times using Tris-HCl buffer, the Tris-HCl buffer consisting of NaCl solution and EDTA, washing with water, and obtaining pHSA by freeze drying.

7. A DNA molecule gated delivery system based on internal environment response osteogenic and angiogenic coupling according to claim 4, characterized in that: The nucleotide sequence number of the overall sequence formed by connecting the nucleic acid aptamer Aptamer19s and the Comp15 is: 5'-ACAACCACCACCACCTTTTTTAGGTCAGATGAGGAGGGGGACTTAGGACTGGGTTTTATGACCTATGCGTG-3'.

8. Use of the DNA molecular gated delivery system according to any one of claims 1 to 7 in the preparation of bone repair drugs.

Images