XVII type collagen, recombinant bacteria and construction method and application of XVII type collagen and recombinant bacteria

Abstract

The invention relates to an XVII type collagen, a recombinant bacterium and a construction method and application of the XVII type collagen. The XVII type collagen comprises a polypeptide of which the amino acid sequence is as shown in SEQ ID NO. 1. In the XVII type collagen, the glycine of the polypeptide with the amino acid sequence as shown in SEQ ID NO.1 accounts for 26% or above, and the XVII type collagen is high in structural stability, easy to express and high in yield. Experiments prove that the yield of the recombinant bacteria obtained by transforming the XVII type collagen into competent cells to the XVII type collagen is as high as 4.5 g / L, and the yield of the XVII type collagen is as high as 9.3 g / L after plasmid pSB1a-mtk (Mca)-mcl (Rsp)-aceAK is transferred into the recombinant bacteria.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to type XVII collagen, recombinant bacteria, and a construction method and application thereof. Background Art

[0002] Type XVII collagen is a transmembrane protein that plays a vital role in maintaining the connection between intracellular and extracellular structural elements involved in epidermal adhesion. It is a key factor in skin aging and wound repair. It plays an important role in keeping the skin "youthful", maintaining hair follicle stem cells, and promoting wound repair. It is also related to the occurrence of many diseases, such as autoimmune blistering skin diseases, cancer, hair loss, etc. The discovery of its important physiological functions has prompted researchers to conduct in-depth research and development on it.

[0003] Type XVII collagen is present in very low amounts in humans and animals, and is a non-extracellular secretory collagen with a long amino acid chain and large molecular weight. It cannot be mass-produced through traditional collagen separation and extraction processes such as animal extraction, and it is difficult to meet market demand. Therefore, it is necessary to use advanced biotechnology to achieve its large-scale production. At present, many companies have achieved breakthroughs in the green preparation and industrial production of recombinant type XVII collagen using synthetic biology technology. Through genetic engineering and other means, an expression vector containing the type XVII collagen gene is designed and constructed, and introduced into a suitable host cell, such as Pichia pastoris, and fermented and expressed using the metabolic system of the host cell, thereby mass-producing recombinant type XVII collagen. There are few studies on Escherichia coli as a chassis strain, so the development of Escherichia coli with a short production cycle and easy transformation to mass-produce recombinant type XVII collagen can promote its application in cosmetics, medical treatment, beauty and other fields.

[0004] Under the existing expression system, the main problems in the production of recombinant collagen are: low single-batch yield of recombinant collagen, poor stability of expressed protein, and difficulty in purification, which make it difficult to mass produce. However, with the application of rare collagen in daily chemicals, skin care, health care and medical fields, the current output of type XVII collagen is difficult to match the growing market demand. Summary of the invention

[0005] Based on this, it is necessary to provide a type XVII collagen that is easy to express and has a high yield.

[0006] A type XVII collagen, comprising a polypeptide having an amino acid sequence as shown in SEQ ID NO.1.

[0007] Among the above-mentioned type XVII collagen, the polypeptide with the amino acid sequence shown in SEQ ID NO.1 has a glycine proportion of more than 26%, high structural stability, is easy to express, and has a high yield. It has been experimentally verified that the recombinant bacterium obtained by transforming type XVII collagen into competent cells has a yield of type XVII collagen as high as 4.5 g / L, and the yield of type XVII collagen is as high as 9.3 g / L after the plasmid pSB1a-mtk(Mca)-mcl(Rsp)-aceAK is further transferred into the recombinant bacterium.

[0008] In some of these embodiments, the coding sequence of the type XVII collagen is as shown in SEQ ID NO.2.

[0009] A recombinant bacterium carrying the coding sequence of the above-mentioned type XVII collagen.

[0010] In some of these embodiments, the recombinant bacterium also carries the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl.

[0011] In some of these embodiments, the malate thiokinase gene mtk is derived from Methylococcus capsulatus, and the malyl-CoA lyase gene mcl is derived from Rhodobacter sphaeroides.

[0012] In some of these embodiments, the coding sequence of the malate thiokinase gene mtk is as shown in SEQ ID NO.10, and the coding sequence of the malyl-CoA lyase gene mcl is as shown in SEQ ID NO.11;

[0013] And / or, the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl are connected by a ribosome binding site; further, the enzyme gene fragment formed by connecting the malate thiokinase gene mtk, the ribosome binding site, and the malyl-CoA lyase gene mcl has a coding sequence as shown in SEQ ID NO.3.

[0014] In some of these embodiments, the recombinant bacterium also carries the aceA gene and the aceK gene;

[0015] Further, the coding sequence of the aceA gene is as shown in SEQ ID NO.12, and the coding sequence of the aceK gene is as shown in SEQ ID NO.13.

[0016] In some of these embodiments, the aceA gene and the aceK gene are ligated to form an aceAK gene fragment, and the coding sequence of the aceAK gene fragment is as shown in SEQ ID NO.5.

[0017] A method for constructing a recombinant bacterium, comprising the following steps:

[0018] Construct a recombinant expression vector, the recombinant expression vector carrying the coding sequence of type XVII collagen, and the type XVII collagen comprising a polypeptide having an amino acid sequence as shown in SEQ ID NO.1;

[0019] Transform the recombinant expression vector into competent cells to obtain a recombinant bacterium.

[0020] In some of these embodiments, the competent cells transformed with the recombinant expression vector are denoted as the first transformed bacteria; after the step of transforming the recombinant expression vector into competent cells, the following steps are further included:

[0021] Construct a first recombinant vector, and then digest the first recombinant vector to obtain a recombinant vector fragment; the recombinant vector fragment contains the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl;

[0022] Obtain an aceAK gene fragment by gene amplification, the aceAK gene fragment containing the aceA gene and the aceK gene;

[0023] Perform a ligation reaction on the recombinant vector fragment and the aceAK gene fragment to obtain a second recombinant vector;

[0024] Transform the second recombinant vector into the competent first transformed bacteria to obtain the recombinant bacterium.

[0025] In some of these embodiments, the step of constructing the first recombinant vector includes:

[0026] Obtain an enzyme gene fragment by gene amplification, the enzyme gene fragment containing the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl;

[0027] Assemble the vector fragment and the enzyme gene fragment to obtain the first recombinant vector, the vector corresponding to the vector fragment being vector pSB1a, and the nucleotide sequence of vector pSB1a being as shown in SEQ ID NO.4;

[0028] Further, in the step of obtaining the enzyme gene fragment by gene amplification, the base sequences of the amplification primer pair are as shown in SED ID NO.6-SED ID NO.7.

[0029] In some of these embodiments, in the step of obtaining the aceAK gene fragment by gene amplification, the base sequences of the primer pairs for amplification are as shown in SED ID NO.8 - SED ID NO.9.

[0030] The recombinant bacterium as described above, and the application of the recombinant bacterium obtained by the construction method of the recombinant bacterium as described above in the preparation of type XVII collagen.

[0031] A method for preparing type XVII collagen, comprising the following steps:

[0032] Enlarged culture of the recombinant bacterium, and then adding an inducer to continue the culture to obtain type XVII collagen, wherein the recombinant bacterium is selected from one of the recombinant bacterium as described above and the recombinant bacterium obtained by the construction method of the recombinant bacterium as described above. Description of the Drawings

[0033] Figure 1 is the vector map of C17YX6 pMAL - C5X;

[0034] Figure 2 is the growth curve of the strain in a 10L fermenter;

[0035] Figure 3 is the detection chart of the yield of recombinant type XVII collagen in a 10L fermenter;

[0036] Figure 4 is the protein electrophoresis chart obtained after the expression and purification of bEC0200 protein. Detailed Embodiments

[0037] The present application will be further described in detail below in conjunction with the embodiments and examples. It should be understood that these embodiments and examples are only used to illustrate the present application and not to limit the scope of the present application. The purpose of providing these embodiments and examples is to make the understanding of the disclosed content of the present application more thorough and comprehensive. It should also be understood that the present application can be implemented in many different forms and is not limited to the embodiments and examples described in the present application. Those skilled in the art can make various changes or modifications without departing from the connotation of the present application, and the equivalent forms obtained also fall within the protection scope of the present application. In addition, in the following description, a large number of specific details are given to provide a more thorough understanding of the present application. It should be understood that the present application can be implemented without one or more of these details.

[0038] Unless otherwise defined, all technical and scientific terms used in the present application have the same meaning as commonly understood by those skilled in the technical field to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the embodiments and examples and are not intended to limit the present application.

[0039] Terms

[0040] Unless otherwise specified or there are contradictions, the terms or phrases used in this application have the following meanings:

[0041] For the terms “and / or”, “or / and”, and “and / or” used in this application, the selection range includes any one of two or more related listed items, and also includes any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least two conjunctions selected from “and / or”, “or / and”, and “and / or” are used to connect at least three items, it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by “logical AND” and also undoubtedly includes the technical solution connected by “logical OR”. For example, “A and / or B” includes three parallel solutions: A, B, and A + B. Another example is the technical solution of “A, and / or, B, and / or, C, and / or, D”, which includes any one of A, B, C, and D (that is, the technical solution connected by “logical OR”), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution connected by “logical AND”).

[0042] In this application, “preferably”, “better”, “more preferably”, and “should preferably” are only used to describe embodiments or examples with better effects, and it should be understood that they do not constitute a limitation on the protection scope of this application.

[0043] In this application, “further”, “even further”, “especially”, etc. are used for descriptive purposes, indicating differences in content, but should not be understood as a limitation on the protection scope of this application.

[0044] In this application, “optionally”, “optional”, and “option” mean optional, that is, it means any one of two parallel solutions of “yes” or “no”. If “optional” appears in a technical solution in multiple places, without special instructions, and without contradictions or mutual restrictions, each “optional” is independent of each other.

[0045] In “the first aspect”, “the second aspect”, “the third aspect”, “the fourth aspect”, etc. in this application, the terms “first”, “second”, “third”, “fourth”, etc. are only used for descriptive purposes, and cannot be understood as indicating or implying relative importance or quantity, nor can it be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, “first”, “second”, “third”, “fourth”, etc. only serve the purpose of non-exhaustive enumerative description, and it should be understood that they do not constitute a closed limitation on quantity.

[0046] In this application, among the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, and also includes an open technical solution containing the listed features.

[0047] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0048] In this application, the nomenclature of amino acids and DNA nucleic acid sequences: Amino acid residues use the recognized IUPAC nomenclature, in the form of three-letter abbreviations or single-letter symbols. The DNA nucleic acid sequence adopts the recognized IUPAC nomenclature.

[0049] All the documents mentioned in this application are cited in this application for reference, just as if each document is cited separately for reference. Unless it conflicts with the application purpose and / or technical solution of this application, otherwise, the cited documents involved in this application are cited for all contents and all purposes. When this application involves cited documents, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited together. When this application involves cited documents, the examples and preferred methods of the relevant technical features cited can also be incorporated into this application for reference, but only to the extent that this application can be implemented. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or be amended adaptively according to the description in this application.

[0050] Under the existing expression system, the main problems currently existing in the production of recombinant collagen are: the low yield of recombinant collagen in a single batch, the poor stability of the expressed protein, and the characteristics of being difficult to purify, etc., which are difficult to mass-produce. However, with the application of rare collagens in the fields of daily chemicals, skin care, health care, and medicine, etc., the current production of type XVII collagen is difficult to match the increasingly strong market demand.

[0051] Based on this, in the first aspect of the embodiments of this application, a type XVII collagen is provided, which is characterized in that the type XVII collagen includes a polypeptide with an amino acid sequence as shown in SEQ ID NO.1.

[0052] This application selects the human type XVII collagen COL17A1 sequence for screening and optimization to obtain the above-mentioned type XVII collagen. The sequence of the human type XVII collagen COL17A1 is the NCBI reference sequence: Q9UMD9.3, specifically refer to https: / / www.ncbi.nlm.nih.gov / protein / Q9UMD9.3.

[0053] In some embodiments, the coding sequence of the type XVII collagen is as shown in SEQ ID NO.2.

[0054] In the above-mentioned type XVII collagen, the polypeptide with the amino acid sequence shown in SEQ ID NO.1 has a glycine proportion of more than 26%, high structural stability, is easy to express, and has a high yield. Through experimental verification, the recombinant bacterium obtained by transforming type XVII collagen into competent cells has a yield of type XVII collagen as high as 4.5 g / L. After transferring the plasmid pSB1a-mtk(Mca)-mcl(Rsp)-aceAK into this recombinant bacterium, the yield of type XVII collagen is as high as 9.3 g / L.

[0055] In the second aspect of the embodiments of the present application, a recombinant bacterium is provided, and this recombinant bacterium carries the coding sequence of the type XVII collagen described in the first aspect above.

[0056] By introducing the coding sequence of the above-mentioned type XVII collagen, the above-mentioned recombinant bacterium can stably express the type XVII collagen with a high yield.

[0057] In some embodiments, the recombinant bacterium also carries the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl. By introducing the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl into the recombinant bacterium, the yield of type XVII collagen can be further increased, which is more conducive to the industrial production of type XVII collagen.

[0058] Among them, the malate thiokinase gene mtk is derived from Methylococcus capsulatus, and the malyl-CoA lyase gene mcl is derived from Rhodobacter sphaeroides. Specifically, the coding sequence of the malate thiokinase gene mtk is shown in SEQ ID NO.10, and the coding sequence of the malyl-CoA lyase gene mcl is shown in SEQ ID NO.11.

[0059] Among them, the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl are connected via a ribosome binding site. Further, the malate thiokinase gene mtk, the ribosome binding site, and the enzyme gene fragment formed by connecting the malyl-CoA lyase gene mcl. Specifically, the coding sequence of the enzyme gene fragment is shown in SEQ ID NO.3.

[0060] In some embodiments, the recombinant bacterium also carries the aceA gene and the aceK gene. The aceA gene is the isocitrate lyase gene, and the aceK gene is the isocitrate dehydrogenase kinase / phosphatase gene. By introducing the aceA gene and the aceK gene into the recombinant bacterium, the yield of type XVII collagen can be further increased, which is more conducive to the industrial production of type XVII collagen.

[0061] Furthermore, the coding sequence of the aceA gene is as shown in SEQ ID NO.12, and the coding sequence of the aceK gene is as shown in SEQ ID NO.13.

[0062] Among them, the aceA gene and the aceK gene are connected to form an aceAK gene fragment. Specifically, the coding sequence of the aceAK gene fragment is as shown in SEQ ID NO.5.

[0063] In a specific example, the recombinant bacterium is Escherichia coli carrying the coding gene of type XVII collagen.

[0064] By introducing the coding sequence of the above-mentioned type XVII collagen, the above-mentioned recombinant bacterium can stably express the type XVII collagen with high yield. Moreover, by simultaneously introducing the malate thiokinase gene mtk, the malyl-CoA lyase gene mcl, the aceA gene and the aceK gene into the recombinant bacterium, the product of the type XVII collagen can be further improved to meet the increasingly strong market demand.

[0065] In the third aspect of the embodiments of the present application, a method for constructing a recombinant bacterium is provided, including the following steps S110-S120:

[0066] S110. Construct a recombinant expression vector, the recombinant expression vector carries the coding sequence of type XVII collagen, and the type XVII collagen includes a polypeptide with an amino acid sequence as shown in SEQ ID NO.1.

[0067] Specifically, the specific description of type XVII collagen can be found in the introduction of the first aspect of the present application, and will not be elaborated here.

[0068] Among them, the recombinant expression vector is an Escherichia coli expression vector. Specifically, the empty vector for constructing the recombinant expression vector is the pMAL-C5X expression vector. It should be noted that the above-mentioned empty vector is not limited to the pMAL-C5X expression vector, and can also be other Escherichia coli expression vectors.

[0069] S120. Transform the recombinant expression vector into competent cells to obtain a recombinant bacterium.

[0070] Among them, the competent cells are Escherichia coli competent cells. Specifically, the competent cells are Escherichia coli competent cells BL21(DE3).

[0071] The above-mentioned recombinant bacterium can stably and abundantly express the above-mentioned type XVII collagen. Through experimental verification, the yield of type XVII collagen of the recombinant bacterium is as high as 4.5 g / L.

[0072] In some embodiments, the competent cells transformed with the recombinant expression vector are denoted as the first transformed bacteria; after the step of transforming the recombinant expression vector into the competent cells, the following steps S210 - S240 are further included:

[0073] S210. Construct a first recombinant vector, and then digest the first recombinant vector to obtain a recombinant vector fragment; the recombinant vector fragment contains the malate thiokinase gene mtk and the malyl - CoA lyase gene mcl.

[0074] Among them, in the recombinant vector fragment, the malate thiokinase gene mtk and the malyl - CoA lyase gene mcl are linked via a ribosome - binding site; further, the enzyme gene fragment formed by linking the malate thiokinase gene mtk, the ribosome - binding site, and the malyl - CoA lyase gene mcl has a coding sequence as shown in SEQ ID NO.3.

[0075] Among them, the steps of constructing the first recombinant vector include S211 - S213:

[0076] S211. Obtain an enzyme gene fragment by gene amplification, and the enzyme gene fragment contains the malate thiokinase gene mtk and the malyl - CoA lyase gene mcl.

[0077] Specifically, in the step of obtaining the enzyme gene fragment by gene amplification, the base sequences of the primer pair for amplification are as shown in SED ID NO.6 - SED ID NO.7.

[0078] S213. Assemble the vector fragment and the enzyme gene fragment to obtain the first recombinant vector.

[0079] Specifically, the vector corresponding to the vector fragment is vector pSB1a, and the nucleotide sequence of vector pSB1a is as shown in SEQ ID NO.4.

[0080] Among them, the enzymes for digesting the first recombinant vector are EcoRI and PstI.

[0081] S220. Obtain an aceAK gene fragment by gene amplification, and the aceAK gene fragment contains the aceA gene and the aceK gene.

[0082] Among them, in the step of obtaining the aceAK gene fragment by gene amplification, the base sequences of the primer pair for amplification are as shown in SED ID NO.8 - SED ID NO.9.

[0083] It should be noted that the order of S210 and S220 is not limited. It can be S210 first and then S220, or S220 first and then S210, or S210 and S220 can be carried out simultaneously.

[0084] S230. Perform a ligation reaction on the recombinant vector fragment and the aceAK gene fragment to obtain a second recombinant vector.

[0085] S240. Transform the second recombinant vector into the competent first transformant bacteria to obtain the recombinant bacteria.

[0086] By introducing the malate thiokinase gene mtk, malyl-CoA lyase gene mcl, aceA gene, and aceK gene into the recombinant bacteria through the steps of S210 - S240, the product of type XVII collagen can be further improved to meet the increasingly strong market demand. Through experimental verification, the recombinant bacteria introduced with the malate thiokinase gene mtk, malyl-CoA lyase gene mcl, aceA gene, and aceK gene have a type XVII collagen yield as high as 9.3 g / L.

[0087] In the fourth aspect of the embodiments of the present application, a method for preparing type XVII collagen is provided, including the following steps: expanding the culture of the recombinant bacteria, and then adding an inducer to continue the culture to obtain type XVII collagen. The recombinant bacteria are selected from one of the recombinant bacteria provided in the second aspect and the recombinant bacteria obtained by the construction method of the recombinant bacteria provided in the third aspect.

[0088] Among them, the method for preparing type XVII collagen includes the following steps: inoculating the above-mentioned recombinant bacteria into a shake flask containing a seed medium and culturing until the logarithmic phase; inoculating with an inoculation amount of 2% (V / V) into a 10 L fermenter containing a fermentation medium (so that the OD600 after inoculation is 0.2), and starting the fermentation culture. The fermentation culture conditions are as follows: the stirring speed is 200 r / min - 800 r / min, the tank pressure is 0 MPa - 0.05 MPa, the air flux is 1 vvm, and DO ≥ 30% (M / V). When the dissolved oxygen rebounds, feed medium 1 and feed medium 2 are added, and the feeding rate is maintained so that DO ≥ 30% (M / V) until OD600 grows to 37 - 42; then feed medium 1 is added at a rate of 2 g / L / h, and at the same time, the inducer IPTG is added for induction expression. Adjust the rotation speed, ventilation volume, tank pressure, and feeding rate so that DO ≤ 30%, and induce for 20 h - 32 h. When it is found that the growth of OD600 is slow, the fermentation can be terminated.

[0089] Specifically, the seed liquid medium includes 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0090] The fermentation medium comprises: 5 g / L glycerol, 20 g / L peptone, 10 g / L yeast extract, 3.5 g / L KH 2 PO 4 , 5 g / L K 2 HPO 4 , 3.5 g / L (NH 4 ) 2 HPO 4 , 1 g / L MgSO 4 , 5 g / L NaCl, 1000× trace element composition: FeCl 3 ·6H 2 O 0.162 g / L, ZnCl 2 ·4H 2 O 0.0144 g / L, CoCl·6H 2 O 0.012 g / L, Na 2 MoO 4 ·2H 2 O 0.012 g / L, CaCl 2 ·2H 2 O 0.006 g / L, CuSO 4 ·5H 2 O 1.9 g / L, H 3 BO 3 0.5 g / L.

[0091] The feeding medium 1 comprises: 50% glycerol.

[0092] The feeding medium 2 comprises: 60 g / L peptone, 30 g / L yeast extract, 2 g / L MgSO 4 .

[0093] Through the above preparation method, the yield of type XVII collagen can be increased, so as to mass-produce type XVII collagen industrially to meet the increasing market demand.

[0094] The implementation scheme of the present application will be described in detail below in conjunction with the embodiments. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. For the experimental methods without specific conditions in the following embodiments, the guidance given in the present application is preferably referred to, and it can also be carried out according to the experimental manuals or conventional conditions in the art, or according to the conditions recommended by the manufacturers, or by referring to the experimental methods known in the art.

[0095] In the following specific embodiments, for the measurement parameters of the raw material components, if there is no special description, there may be slight deviations within the weighing accuracy range. For the temperature and time parameters, acceptable deviations caused by the instrument test accuracy or operation accuracy are allowed.

[0096] Example 1: Construction of Recombinant Collagen Type XVII Strains

[0097] (1) Construction of C17YX6 Gene Expression Vector

[0098] The full-length gene sequence of human collagen C17YX6 used in Example 1 is shown as SEQ ID No.1, in which glycine has the highest proportion, accounting for 26%. This sequence has been codon-optimized for Escherichia coli.

[0099] The full length of the C17YX6 gene is 837bp. According to the optimized C17YX6 codon gene sequence SEQ ID No.2, Gene Technology (Tianjin) Co., Ltd. was commissioned to synthesize the gene fragment, and the synthesized C17YX6 gene fragment was ligated with an EK protease cleavage site and then inserted into the pMAL-C5X expression vector (purchased from Gene Technology (Tianjin) Co., Ltd.) through the cleavage sites of XmnI and PstI. The successfully constructed expression plasmid was named C17YX6 pMAL-C5X. The vector map of C17YX6 pMAL-C5X is shown in Figure 1 . The C17YX6 pMAL-C5X vector was transformed into Escherichia coli competent cells BL21(DE3) (purchased from Beijing TransGen Biotech Co., Ltd.), and the obtained recombinant bacteria were named engineering bacteria bEC0133.

[0100] The specific process is as follows:

[0101] 1) Take 1 μL of this plasmid and add it to 100 μL of Escherichia coli competent cells BL21(DE3), and let it stand on ice for 30 min.

[0102] 2) Heat shock the mixture in a 42°C water bath for 90 s, and then quickly place it on ice for 2 min.

[0103] 3) Add 600 μL of antibiotic-free LB to the mixture and culture it at 37°C and 220 rpm for 1 h.

[0104] 4) Take 200 μL of this bacterial solution and evenly coat it on an LB plate containing ampicillin resistance (specific components include: 10 g / L peptone, 5 g / L yeast extract, 10 g / L sodium chloride, 15 g / L agar, 100 μg / mL ampicillin antibiotic).

[0105] 5) Invert the plate and culture it in a 37°C incubator for about 20 h until clearly visible colonies grow, name them bEC0133, and prepare the corresponding competent cells.

[0106] Example 2: Construction of High-Yield Strains

[0107] The nucleotide sequences of the malate thiokinase gene mtk derived from Methylococcus capsulatus with codon optimization and the malyl-CoA lyase gene mcl derived from Rhodobacter sphaeroides are shown in SEQ ID No.3. In the SEQ ID No.3 sequence, the coding sequence of mtk (Mca): positions 1-2088; the RBS sequence: positions 2089-2104; the coding sequence of mcl (Rsp): positions 2105-3061.

[0108] The mtk(Mca)-mcl(Rsp)-NX fragment was amplified with primers mtk(Mca)-F and mcl(Rsp)-R and subjected to Gibson assembly with the vector fragment pSB1a-NX to obtain the plasmid pSB1a-mtk(Mca)-mcl(Rsp). The nucleotide sequence of the vector pSB1a is shown in SEQ ID No.4. The base sequence of primer mtk(Mca)-F: GTAGATCTGGTACTAGTGGTGAGGAGGAATTAAATGAACATTCACGAGTAC CAGGC; the base sequence of primer mcl(Rsp)-R: CCGGCACCAGCTGCATTACGCGCTAATCATTTCCGC.

[0109] The plasmid pSB1a-mtk(Mca)-mcl(Rsp) was digested with EcoRI and PstI to obtain the large fragment pSB1a-mtk(Mca)-mcl(Rsp)-EP. Genomic DNA was extracted from Escherichia coli, and the aceAK gene fragment was amplified with primers aceA-F / aceK-R, and the RBS sequence was introduced into the primers at the same time. The aceAK fragment (nucleotide sequence shown in SEQ ID No.5) was ligated with the pSB1a-mtk(Mca)-mcl(Rsp)-EP fragment, positive clones were screened, and the obtained plasmid was named pSB1a-mtk(Mca)-mcl(Rsp)-aceAK. Its construction was verified by sequencing and then transformed into the competent cell bEC0133. It was spread on an LB plate containing 50 μg / mL kanamycin and 100 μg / mL ampicillin and cultured overnight at 37 °C. Clones were selected and named strain bEC0200.

[0110] In the SEQ ID No.5 sequence, the coding sequence of the aceA gene: positions 1-1305; the coding sequence of the aceK gene: positions 1488-3224. The base sequence of primer aceA-F: GTAGATCTGGTACTAGTGGTGAGGAGGAATTAAATGAAAACCCGTACACA ACA; the base sequence of primer aceK-R: GCCGCGCGGCACCAGCTGCATCAAAAAAGCATCTCCCCAT.

[0111] Example 3: Fermentation in a fermenter and protein purification

[0112] The constructed engineering bacteria bEC0200 were fermented in a 10 L fermenter to obtain a fermentation broth containing recombinant human type XVII collagen, achieving recombinant human type XVII collagen C17YX6.

[0113] (1) Fermentation in a 10 L tank

[0114] The seed medium contains 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0115] The fermentation medium includes: 5 g / L glycerol, 20 g / L peptone, 10 g / L yeast powder, 3.5 g / L KH 2 PO 4 , 5 g / L K 2 HPO 4 , 3.5 g / L (NH 4 ) 2 HPO 4 , 1 g / L MgSO 4 , 5 g / L NaCl, 1000× trace elements composition: FeCl 3 ·6H 2 O 0.162 g / L, ZnCl 2 ·4H 2 O 0.0144 g / L, CoCl·6H 2 O 0.012 g / L, Na 2 MoO 4 ·2H 2 O 0.012 g / L, CaCl 2 ·2H 2 O 0.006 g / L, CuSO 4 ·5H 2 O 1.9 g / L, H 3 BO 3 0.5 g / L.

[0116] The feeding medium 1 includes: 50% glycerol.

[0117] The feeding medium 2 includes: 60 g / L peptone, 30 g / L yeast extract, 2 g / L MgSO 4 .

[0118] Inducer: 0.5 mM IPTG.

[0119] The fed-batch culture method is adopted, with a culture temperature of 37 °C and an induction temperature of 18 °C. The constructed engineered bacterium bEC0200 is inoculated into a shake flask containing the seed medium LB. The volume of the shake flask is 500 mL, the liquid loading is 200 mL, and it is cultured at 220 rpm and 37 °C for 16 h; it is inoculated into a fermenter containing the fermentation medium at an inoculation amount of 2% (so that the OD600 after inoculation is 0.2). The volume of the fermenter is 10 L, and the fermentation culture is started. The fermentation culture conditions are as follows: the stirring speed is 200 r / min - 800 r / min, the tank pressure is 0 - 0.05 MPa, the air flow rate is 1 vvm, DO ≥ 30%, and the fed-batch medium 1 and the fed-batch medium 2 are fed backflow to maintain DO ≥ 30% at the feeding rate until OD 600 grows to 37 - 42, and the fed-batch medium 1 is fed at a rate of 2 g / L / h. At the same time, the inducer IPTG is added for induction expression, and the rotation speed, ventilation volume, tank pressure and feeding speed are adjusted to make DO ≤ 30%. After induction for 20 - 32 h, when it is found that OD 600 grows slowly, the fermentation can be terminated. The growth curve of the strain in a 10 L fermenter is as Figure 2 shown.

[0120] (2) Purification

[0121] Resuspend the cell pellet (1 L) with about 50 ml of phosphate buffer (pH 7.5) (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride). After lysing the cells using a high-pressure cell disruption instrument (Ningbo Xinzhi Biotechnology Co., Ltd.), centrifuge at 12,000 rpm for 20 min to fully separate the soluble protein from the insoluble substances.

[0122] Equilibrate the Ni-NTA (Qiagen) affinity column with 5 column volumes of binding buffer (i.e., Binding buffer, components include: 50 mM NaH 2 PO 3 , 300 mM NaCl, pH 7.5). Then add the protein supernatant and incubate at 4 °C for 1.5 - 2 h to allow the target recombinant protein to fully bind to the column material. Then use 200 mL of washing buffer (i.e., washing buffer, components include: 10 mM imidazole, 50 mM NaH 2 PO 3, rinse the miscellaneous proteins with 300 mM NaCl, pH 7.5). If the target protein with MBP tag is needed, it can be directly eluted with the elution buffer (i.e., elution buffer, the components include 50 mM imidazole, 50 mM NaH 2 PO 3 , 300 mM NaCl, pH 7.5) to elute the target protein.

[0123] Dialyze the target protein through a tangential flow filtration (TFF) membrane package (Cobetter Company) to remove inorganic salts and impurities in the target protein. The obtained target protein product is freeze-dried into a dry powder for later use.

[0124] The obtained C17YX6 protein was detected for molecular weight and purity by SDS-PAGE. The specific process is as follows: Take 40 μL of the purified protein solution, add 10 μL of 5× protein loading buffer (Beyotime Company), place it in a 100 °C metal bath and boil for 15 min, then add 10 μL per well to the SDS-PAGE protein gel, run the stacking gel at 85 V for 35 min, and then run the separating gel at 125 V for 45 min. After that, stain the protein with Coomassie Brilliant Blue Rapid Staining Solution (Seville Company) for 25 min, and then decolorize it with RO water for 30 min. The yield of recombinant type XVII collagen in a 10 L fermenter is as Figure 3 shown. The protein electrophoresis pattern of the protein obtained after purification of the bEC0200 strain is as Figure 4 shown.

[0125] From Figure 3 it can be seen that in the bEC0133 strain obtained by modifying Escherichia coli as the chassis strain, the highest yield of recombinant type XVII collagen C17YX6 is 4.5 g / L; using Escherichia coli as the chassis strain, after transforming the plasmid pSB1a-mtk(Mca)-mcl(Rsp)-aceAK, the highest yield of recombinant type XVII collagen C17YX6 of the obtained bEC0200 strain is 9.3 g / L. Figure 4 In , the electrophoretic detection molecular weight of the bEC0200 protein is about 73.2 kDa.

[0126] In the type XVII collagen provided in this application, the polypeptide with the amino acid sequence shown in SEQ ID NO.1 has a glycine proportion of more than 26%, and has high structural stability, is easy to express, and has a high yield. Introducing the coding sequence of the above type XVII collagen into the constructed recombinant bacteria can stably express the type XVII collagen with a high yield. At the same time, introducing the malate thiokinase gene mtk, the malyl-CoA lyase gene mcl, the aceA gene and the aceK gene into the recombinant bacteria can further improve the product of the type XVII collagen to meet the increasingly strong market demand.

[0127] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0128] The above-described embodiments only represent several implementation manners of the present invention, and their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the invention patent should be subject to the appended claims.

Claims

1. A type XVII collagen, characterized in that The type XVII collagen includes a polypeptide having an amino acid sequence as shown in SEQ ID NO.

1.

2. The type XVII collagen according to claim 1, characterized in that The coding sequence of type XVII collagen is shown in SEQ ID NO.

2.

3. A recombinant bacterium, characterized in that: The recombinant bacteria carries the coding sequence of type XVII collagen according to any one of claims 1-2.

4. The recombinant bacterium according to claim 3, characterized in that The recombinant bacteria also carry a malate thiokinase gene mtk and a malyl-CoA lyase gene mcl.

5. The recombinant bacterium according to claim 4, characterized in that The malate thiokinase gene mtk is derived from Methylococcus capsulatus, and the acyl-CoA lyase gene mcl is derived from Rhodobacter phaeroides.

6. The recombinant bacterium according to claim 4, characterized in that The coding sequence of the malate thiokinase gene mtk is shown in SEQ ID NO.10, and the coding sequence of the acyl-CoA lyase gene mcl is shown in SEQ ID NO.11; And / or, the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl are connected via a ribosome binding site; further, the malate thiokinase gene mtk, the ribosome binding site and the malyl-CoA lyase gene mcl are connected to form an enzyme gene fragment, and the coding sequence of the enzyme gene fragment is shown in SEQ ID NO.

3.

7. The recombinant bacterium according to any one of claims 4 to 6, characterized in that The recombinant bacteria also carry aceA gene and aceK gene; Furthermore, the coding sequence of the aceA gene is shown as SEQ ID NO.12, and the coding sequence of the aceK gene is shown as SEQ ID NO.

13.

8. The recombinant bacterium according to claim 7, characterized in that The aceA gene and the aceK gene are connected to form an aceAK gene fragment, and the coding sequence of the aceAK gene fragment is shown in SEQ ID NO.

5.

9. A method for constructing a recombinant bacterium, characterized in that: The steps include: Constructing a recombinant expression vector, wherein the recombinant expression vector carries a coding sequence of type XVII collagen, wherein the type XVII collagen includes a polypeptide having an amino acid sequence as shown in SEQ ID NO.1; The recombinant expression vector is transformed into competent cells to obtain recombinant bacteria.

10. The construction method according to claim 9, characterized in that: The competent cells transformed with the recombinant expression vector are recorded as the first transformed bacteria; after the step of transforming the recombinant expression vector into the competent cells, the following steps are also included: Constructing a first recombinant vector, and then digesting the first recombinant vector to obtain a recombinant vector fragment; the recombinant vector fragment contains the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl; Obtaining an aceAK gene fragment by gene amplification, wherein the aceAK gene fragment contains an aceA gene and an aceK gene; Conducting a ligation reaction between the recombinant vector fragment and the aceAK gene fragment to obtain a second recombinant vector; The second recombinant vector is transformed into the first transformant bacteria in a competent state to obtain the recombinant bacteria.

11. The construction method according to claim 10, characterized in that: The steps of constructing the first recombinant vector include: Obtaining an enzyme gene fragment by gene amplification, wherein the enzyme gene fragment contains the malate thiokinase gene mtk and the malyl-CoA lyase gene mcl; Assembling the vector fragment and the enzyme gene fragment to obtain the first recombinant vector, wherein the vector corresponding to the vector fragment is vector pSB1a, and the nucleotide sequence of the vector pSB1a is shown in SEQ ID NO.4; Furthermore, in the step of obtaining the enzyme gene fragment by gene amplification, the base sequence of the primer pair for amplification is shown as SED ID NO.6-SED ID NO.

7.

12. The construction method according to claim 10, characterized in that: In the step of obtaining the aceAK gene fragment by gene amplification, the base sequences of the primer pairs used for amplification are shown as SED ID NO.8-SED ID NO.

9.

13. Use of the recombinant bacterium according to any one of claims 3 to 8, or the recombinant bacterium obtained by the method for constructing the recombinant bacterium according to any one of claims 9 to 12, in the preparation of type XVII collagen.

14. A method for preparing type XVII collagen, characterized in that: The steps include: The recombinant bacteria are expanded and cultured, and then an inducer is added to continue the culture to obtain type XVII collagen. The recombinant bacteria are selected from the recombinant bacteria described in claims 3-8 and the recombinant bacteria obtained by the construction method of the recombinant bacteria described in claims 9-12.

Images