ASGR1 nucleic acid aptamer as well as screening method and application thereof
The nucleic acid aptamers that can specifically bind to ASGR1 protein were screened through the engineered Cell-SELEX technology, which solved the problem of lack of ASGR1 targeting molecular tools in the prior art, and achieved accurate quantitative and efficient targeted treatment of ASGR1 protein.
Patent Information
- Application Number
- CN202510390426.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-06-13
AI Technical Summary
The lack of targeted molecular tools for ASGR1 in the prior art has hindered its clinical application in the treatment of liver diseases.
Nucleic acid aptamers that can specifically bind to ASGR1 protein and highly expressed cell lines were screened through the engineered Cell-SELEX technology. The ssDNA nucleic acid sequence of the nucleic acid aptamers were screened, and specific and binding force characterization was performed by flow cytometry and confocal microscopy.
Accurate quantitative and specific binding of ASGR1 protein is achieved, and targeted molecular tools for ASGR1 are provided, with high affinity and specificity, and can be used in the treatment of liver diseases.
Smart Images
Figure CN120137981A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology and relates to an ASGR1 nucleic acid aptamer, a screening method thereof, and an application thereof. Background Art
[0002] ASGR1 is a liver-specific membrane protein expressed on the surface of hepatocytes. Its main function is to recognize and bind desialylated glycoproteins, and subsequently, these glycoproteins are internalized through receptor-mediated endocytosis. Due to its unique liver specificity and physiological relevance, ASGR1 has become a potential biomolecular target for the diagnosis and targeted therapy of liver diseases.
[0003] Studies have found that ASGR1 is related to various liver-specific pathophysiological processes. For example, inhibiting ASGR1 can increase cholesterol efflux, thereby reducing cholesterol levels in the blood and reducing atherosclerosis. This study provides a new therapeutic target for hypercholesterolemia and its complications and comorbidities, indicating that ASGR1 has significant clinical application potential as a target for reducing blood cholesterol levels. At the same time, since ASGR1 is a specific receptor located on the surface of hepatocytes, this enables ligand analogs or small molecule compounds with similar structures to competitively bind to ASGR1 on the surface of hepatocytes, avoiding the possibility of causing adverse reactions in multiple organs. Therefore, molecular tools specifically targeting ASGR1 may significantly improve the therapeutic effect of liver-related diseases. Although ASGR1 has great clinical potential in the treatment of liver diseases, the lack of targeted molecular tools for ASGR1 has hindered its clinical application.
[0004] An aptamer is a single-stranded oligonucleotide molecule obtained by using the SELEX technique and can specifically bind to various targets with high specificity. Aptamers have become a class of multifunctional molecular tools in the biomedical field. Aptamers have many advantages, such as high affinity, high specificity, and low molecular weight, etc. These advantages make it easier for them to enter cells and tissues and exert targeted therapeutic effects.
[0005] Cell-SELEX is a technique that directly applies living cells to aptamer screening and does not require immobilization or purification of the target molecule like the traditional SELEX technique, enabling the aptamers obtained by screening to more effectively recognize the native conformation of the target on the cell surface. Engineered Cell-SELEX technology is a further improvement of Cell-SELEX technology. A target protein is artificially induced to be produced on the cell membrane surface to construct an engineered cell model, and then aptamers are obtained through the Cell-SELEX process.
[0006] For the above reasons, aptamers against ASGR1 are screened out, providing a targeted molecular tool for the ASGR1 target, which has broad application prospects in the field of ligand recognition related to the ASGR1 biomarker. Summary of the Invention
[0007] Aiming at the deficiencies of the prior art and the actual needs, the present invention provides an ASGR1 nucleic acid aptamer, its screening method and application. The ASGR1 nucleic acid aptamer of the present invention can specifically bind to the ASGR1 protein and the ASGR1 protein highly expressed cell line, and can accurately quantify the ASGR1 protein.
[0008] To achieve the object of this invention, the following technical solutions are adopted:
[0009] In the first aspect, the present invention provides a nucleic acid aptamer, and the ssDNA nucleic acid sequence of the nucleic acid aptamer includes the sequences shown in SEQ ID No.1 to SEQ ID No.8.
[0010] The ASGR1 nucleic acid aptamer of the present invention can specifically bind to the ASGR1 protein and the ASGR1 protein highly expressed cell line, and can accurately quantify the ASGR1 protein.
[0011] SEQ ID No.1:
[0012] 5’-ATACCAGCTTATTCAATTGGGACGCTGAACACTATCATGGAGTGATATCTTTTTTAATAGATAGTAAGTGCAATCT-3’.
[0013] SEQ ID No.2:
[0014] 5’-ATACCAGCTTATTCAATTACCTAGATGTGAGTTTAGATTTTGAGATGATTAGTTTAGCAGATAGTAAGTGCAATCT-3’.
[0015] SEQ ID No.3:
[0016] 5’-ATACCAGCTTATTCAATTGGGACGCTGAACACCATCATGGGGTGCTATCTCTCTTAGTAGATAGTAAGTGCAATCT-3’.
[0017] SEQ ID No.4:
[0018] 5’-GCACTATCATGGAGTGATATCTTTTTTAATAGATAGTAAGTGC-3’.
[0019] SEQ ID No.5:
[0020] 5'-GCGCTGAACACTATCATGGAGTGATATCTTTTTTAATAGATAGTA AGTGC-3'.
[0021] SEQ ID No.6:
[0022] 5'-GACGCTGAACACCATCATGGGGTGCTATCTCTCTTAGTAGATAGT AAGTGCGTC-3'.
[0023] SEQ ID No.7:
[0024] 5'-TTGCACCATCATGGGGTGCTATCTCTCTTAGTAGATAGTAAGTGC AA-3'.
[0025] SEQ ID No.8:
[0026] 5'-GATTGGGACGCTGAACACCATCATGGGGTGCTATCTCTCTTAGTA GATAGTAAGTGCAATC-3'.
[0027] Preferably, the aptamer specifically recognizes the ASGR1 protein.
[0028] Preferably, the amino acid sequence of the ASGR1 protein includes the sequence shown in SEQ ID No.9.
[0029] SEQ ID No.9:
[0030] MTKEYQDLQHLDNEESDHHQLRKGPPPPQPLLQRLCSGPRLLLLSLGLSLLLLVVVCVIGSQNSQLQEELRGLRETFSNFTASTEAQVKGLSTQGGNVGRKMKSLESQLEKQQKDLSEDHSSLLLHVKQFVSDLRSLSCQMAALQGNGSERTCCPVNWVEHERSCYWFSRSGKAWADADNYCRLEDAHLVVVTSWEEQKFVQHHIGPVNTWMGLHDQNGPWKWVDGTDYETGFKNWRPEQPDDWYGHGLGGGEDCAHFTDDGRWNDDVCQRPYRWVCETELDKASQEPPLL.
[0031] Second aspect, the present invention provides a method for screening the nucleic acid aptamer described in the first aspect, the method comprising:
[0032] (1) Screening nucleic acid aptamers using the cell-SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technique, selecting a cell line with stable and high expression of ASGR1 protein as the target cell for positive screening, and selecting wild-type host CHO / K1 cells as the control cells for negative screening;
[0033] (2) Characterizing the binding affinity and specificity of the nucleic acid aptamer candidate sequences using flow cytometry and confocal microscopy to obtain the final nucleic acid aptamer sequence.
[0034] Preferably, the method for preparing the cell line with stable and high expression of ASGR1 protein in step (1) includes: packaging non-replicative virus using a three-plasmid packaging system, infecting CHO-K1 cells to obtain a cell line with stable and high expression of ASGR1 protein.
[0035] Preferably, the three-plasmid packaging system includes a pLVX-IRES-Puro vector plasmid, a pSPAX2 packaging plasmid, and a Pmd2.G envelope protein plasmid.
[0036] Preferably, the pLVX-IRES-Puro plasmid contains the ASGR1 expression gene.
[0037] The ASGR1 expression gene includes the sequence shown in SEQ ID No. 10.
[0038] SEQ ID No. 10:
[0039] ATGACCAAGGAGTATCAAGACCTTCAGCATCTGGACAATGAGGAGA GTGACCACCATCAGCTCAGAAAAGACTCCCAGCTGCAGGAGGAGCTGCGGGGCCTGAGAGAGACGTTCAGCAACTTCACAGCGAGCACGGAGGCCCAGGTCAAGGGCTTGAGCACCCAGGGAGGCAATGTGGGAAGAAAGATGAAGTCGCTAGAGTCCCAGCTGGAGAAACAGCAGAAGGACCTGAGTGAAGATCACTCCAGCCTGCTGCTCCACGTGAAGCAGTTCGTGTCTGACCTGCGGAGCCTGAGCTGTCAGATGGCGGCGCTCCAGGGCAATGGCTCAGAAAGGACCTGCTGCCCGGTCAACTGGGTGGAGCACGAGCGCAGCTGCTACTGGTTCTCTCGCTCCGGGAAGGCCTGGGCTGACGCCGACAACTACTGCCGGCTGGAGGACGCGCACCTGGTGGTGGTCACGTCCTGGGAGGAGCAGAAATTTGTCCAGCACCACATAGGCCCTGTGAACACCTGGATGGGCCTCCACGACCAAAACGGGCCCTGGAAGTGGGTGGACGGGACGGACTACGAGACGGGCTTCAAGAACTGGAGGCCGGAGCAGCCGGACGACTGGTACGGCCACGGGCTCGGAGGAGGCGAGGACTGTGCCCACTTCACCGACGACGGCCGCTGGAACGACGACGTCTGCCAGAGGCCCTACCGCTGGGTCTGCGAGACAGAGCTGGACAAGGCCAGCCAGGAGCCACCTCTCCTTTAA。
[0040] In a third aspect, the present invention provides the use of the nucleic acid aptamer described in the first aspect in the preparation of a product for detecting or assisting in the detection of the content of ASGR1 protein.
[0041] In a fourth aspect, the present invention provides a product for specifically detecting the surface protein of extracellular vesicles, and the product contains the nucleic acid aptamer described in the first aspect.
[0042] Preferably, the surface protein of the extracellular vesicles includes ASGR1 protein.
[0043] Fifth aspect, the present invention provides an application of the product for specifically detecting extracellular vesicle surface proteins described in the fourth aspect in detecting the content of ASGR1 protein or preparing a drug for treating liver diseases.
[0044] Compared with the prior art, the present invention has the following beneficial effects:
[0045] (1) The present invention provides an ASGR1 nucleic acid aptamer that can specifically bind to ASGR1 protein;
[0046] (2) In the screening process of the engineered Cell-SELEX technology of the present invention, wild-type CHO-K1 cells without engineering modification are selected as negative cells for strict negative screening control; at the same time, by gradually increasing the screening pressure, including reducing the richness of the screening library, increasing the number of negative screening cells and the binding time, etc., the affinity and specificity of the obtained aptamer for cells are further improved. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] Figure 1 It is a confocal verification diagram of the engineered overexpressing ASGR1 cell line in Example 1 of the present invention;
[0048] Figure 2 It is a schematic diagram of screening ASGR1 aptamer by the Cell-SELEX method in Example 2 of the present invention;
[0049] Figure 3a It is a flow cytometry verification diagram of the 4th, 6th, 8th, 10th, and 12th round enrichment libraries and the screening library m-Lib screened in Example 4 of the present invention interacting with the engineered cell ASGR1 cells;
[0050] Figure 3b It is a flow cytometry verification diagram of the 4th, 6th, 8th, 10th, and 12th round enrichment libraries and the screening library m-lib screened in Example 4 of the present invention interacting with the control cell CHO-K1;
[0051] Figure 4a It is a flow cytometry verification diagram of the full-length aptamer sequence and the screening library m-Lib in Example 5 of the present invention interacting with ASGR1 cells;
[0052] Figure 4b It is a flow cytometry verification diagram of the full-length aptamer sequence and the screening library m-Lib in Example 5 of the present invention interacting with CHO-K1 cells;
[0053] Figure 4c It is a flow cytometry verification diagram of the truncated aptamer sequence and the screening library m-Lib in Example 5 of the present invention interacting with ASGR1 cells;
[0054] Figure 4dFlow cytometry verification diagram of the interaction between the truncated aptamer sequence and the screening library m-Lib with CHO-K1 cells in Example 5 of the present invention;
[0055] Figure 5a Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with Hep-G2 cells in Example 6 of the present invention;
[0056] Figure 5b Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with HuH-7 cells in Example 6 of the present invention;
[0057] Figure 5c Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with HT29 cells in Example 6 of the present invention;
[0058] Figure 5d Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with A549 cells in Example 6 of the present invention;
[0059] Figure 5e Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with MCF-7 cells in Example 6 of the present invention;
[0060] Figure 5f Flow cytometry verification diagram of the interaction between the full-length aptamer sequence and the screening library m-Lib with Hep-G2 cells in Example 6 of the present invention;
[0061] Figure 5g Flow cytometry verification diagram of the interaction between the truncated aptamer sequence and the screening library m-Lib with HuH-7 cells in Example 6 of the present invention;
[0062] Figure 5h Flow cytometry verification diagram of the interaction between the truncated aptamer sequence and the screening library m-Lib with HT29 cells in Example 6 of the present invention;
[0063] Figure 5i Flow cytometry verification diagram of the interaction between the truncated aptamer sequence and the screening library m-Lib with A549 cells in Example 6 of the present invention;
[0064] Figure 5j Flow cytometry verification diagram of the interaction between the truncated aptamer sequence and the screening library m-Lib with MCF-7 cells in Example 6 of the present invention. Detailed implementation manners
[0065] To further elaborate on the technical means and effects adopted by the present invention, the present invention will be further described below in conjunction with embodiments and drawings. It can be understood that the specific implementation manners described herein are only used to explain the present invention, rather than limiting the present invention.
[0066] For those not specifying specific techniques or conditions in the embodiments, the techniques or conditions described in the literature in this field or according to the product specifications are followed. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular commercial channels.
[0067] Example 1
[0068] In this example, an engineered cell line overexpressing ASGR1 was constructed. The specific method is as follows:
[0069] The human ASGR1 gene fragment was amplified by PCR technology. After digesting the amplified gene fragment and the pLVX-IRES-Puro vector with enzymes, the target gene sequence was ligated with the digested vector to prepare a recombinant plasmid.
[0070] The above recombinant plasmid, together with the pSPAX2 and Pmd2.G plasmids, were fully mixed with OPTI-MEM medium and then allowed to stand; 5 μL of Lipo 2000 was mixed with 150 μL of OPTI-MEM and allowed to stand, and then mixed with the above plasmids to package virus particles in 293T cells. The lentiviral particles were collected for infecting CHO-K1 cells, and puromycin was added for screening, and the cells were named ASGR1 cells.
[0071] To verify the expression of ASGR1 protein in the infected cells, ASGR1 and CHO-K1 cells were seeded in a 35 mm confocal dish and cultured overnight; the ASGR1 antibody and the cells were incubated on ice for 30 min respectively, washed three times with PBS, and then incubated with AlexaFluor 647-labeled secondary antibody, and confocal imaging was performed after washing ( Figure 1 ), and the results showed that the host cells themselves did not express ASGR1 protein and could be used as negative control cells for negative screening; the infected cells could highly express ASGR1 protein, indicating that an engineered cell line overexpressing ASGR1 was successfully constructed and could be used as target cells for positive screening.
[0072] Example 2
[0073] In this example, the engineering Cell-SELEX technology was used to screen for ASGR1 aptamers. Using ASGR1 cells as positive screening target cells and wild-type CHO-K1 cells as negative screening control cells, the specific screening steps are as follows:
[0074] (1) Positive screening
[0075] Take the ASGR1 cells cultured in a 100×20 mm culture dish and wash them twice with the washing buffer. Subsequently, add the heat-denatured pre-treated screening library m-Lib for incubation to allow the sequences to bind to the ASGR1 protein. After incubation, wash away the unbound free sequences with the washing buffer.
[0076] (2) Recovery and amplification of target sequences
[0077] Collect the bound sequences with a cell scraper and denature them at 95°C. Centrifuge to collect the nucleic acid sequences. Prepare single-stranded DNA by PCR amplification (95°C for 3 min, 95°C for 30 s, 60°C for 30 s, 72°C for 1 min) and alkaline denaturation method (0.1 M NaOH) for the next round of screening.
[0078] (3) Negative screening
[0079] Negative screening is introduced after the third round. Use wild-type CHO-K1 cells to remove non-specific binding sequences. By gradually increasing the screening pressure, including reducing the richness of the screening library (10 nmol - 0.2 nmol), reducing the number of target cells (100 mm×20 mm - 60 mm×15 mm), and gradually increasing the number of negative control cells (60 mm×15 mm - 100 mm×20 mm), improve the specificity and affinity of the selected nucleic acid aptamers for the ASGR1 target.
[0080] Figure 2 It is a specific schematic diagram of the above screening process.
[0081] Example 3
[0082] Use flow cytometry to examine the enrichment degree of the screening library: Incubate the 500 nM Cy5-fluorescently modified screening library with ASGR1 and CHO-K1 cells for 50 min respectively. After adding the washing buffer for washing, analyze the fluorescence signal map using a flow cytometer. Figure 3a It is the flow cytometry verification diagram of the enrichment libraries obtained in the 4th, 6th, 8th, 10th, and 12th rounds of screening in this example, as well as the screening library m-Lib and ASGR1. Figure 3b It is the flow cytometry verification diagram of the enrichment libraries in the 4th, 6th, 8th, 10th, and 12th rounds of this example, as well as the screening library m-Lib and CHO-K1. The results show that the binding affinity of the screening library to the target cells gradually increases compared with the control cells, indicating that the screening library is gradually enriched.
[0083] Example 4
[0084] After sequencing and analyzing the optimal enrichment library, three candidate aptamer sequences were selected according to their possible secondary structures (as shown in SEQ ID No.1 - SEQ ID No.3, defined as aptamers AS15, AS22, and AS28 in sequence); further, their structures were truncated and optimized to obtain the following candidate sequences (shown in SEQ ID No.4 - SEQ ID No.8, defined as aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 in sequence). The binding affinities of the screened candidate sequences to the ASGR1 cell line and the CHO-K1 cell line were detected using flow cytometry, and the specific steps are as follows:
[0085] The candidate sequences modified with Cy5 fluorescent groups were incubated with ASGR1 cells and CHO-K1 cells respectively. After centrifugation and washing, the fluorescence intensity was analyzed to evaluate the binding ability of the candidate aptamers. Meanwhile, the Cy5-labeled library (m-Lib) was used as a negative control.
[0086] Figure 4a Showed the flow cytometry results of the interaction between the full-length aptamers AS15, AS22, and AS28 and ASGR1 cells;
[0087] Figure 4b Showed the flow cytometry results of the interaction between the full-length aptamers AS15, AS22, and AS28 and CHO-K1 cells;
[0088] Figure 4c Showed the flow cytometry results of the interaction between the truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-38 and ASGR1 cells;
[0089] Figure 4d Showed the flow cytometry results of the interaction between the truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 and CHO-K1 cells;
[0090] The results showed that compared with the random sequence control group, the fluorescence intensity on the cell surface was significantly enhanced after co-incubation of the candidate aptamer sequences with ASGR1 cells, indicating that the candidate sequences could specifically recognize and bind to ASGR1 cells; while there was no obvious change in the fluorescence signal in CHO-K1 cells, and the aptamers did not show the binding ability to the control cells.
[0091] Example 5
[0092] Evaluating the binding specificity of candidate aptamers to ASGR1 using flow cytometry: The binding ability of the candidate aptamer sequences to cell lines with different ASGR1 protein expression levels was investigated, and the specific implementation method was the same as that in Example 3 and Example 4 above.
[0093] Figure 5a The flow cytometry results showing the interaction of full-length aptamers AS15, AS22, and AS28 with Hep-G2 cells are presented;
[0094] Figure 5b The flow cytometry results showing the interaction of full-length aptamers AS15, AS22, and AS28 with HuH-7 cells are presented;
[0095] Figure 5c The flow cytometry results showing the interaction of full-length aptamers AS15, AS22, and AS28 with HT29 cells are presented;
[0096] Figure 5d The flow cytometry results showing the interaction of full-length aptamers AS15, AS22, and AS28 with A549 cells are presented;
[0097] Figure 5e The flow cytometry results showing the interaction of full-length aptamers AS15, AS22, and AS28 with MCF-7 cells are presented;
[0098] Figure 5f The flow cytometry results showing the interaction of truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 with Hep-G2 cells are presented;
[0099] Figure 5g The flow cytometry results showing the interaction of truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 with HuH-7 cells are presented;
[0100] Figure 5h The flow cytometry results showing the interaction of truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 with HT29 cells are presented;
[0101] Figure 5i The flow cytometry results showing the interaction of truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2, and AS28-3 with A549 cells are presented;
[0102] Figure 5jShow the flow cytometry results of the interaction between truncated aptamers AS15-1, AS15-2, AS28-1, AS28-2 and AS28-3 and MCF-7 cells;
[0103] The results showed that all candidate aptamers had varying degrees of binding to the ASGR1-positive cancer cell lines HuH-7 and Hep-G2, and no binding to the ASGR1-negative cancer cell lines HT29, A549 and MCF-7, indicating their targeted binding ability to ASGR1-positive cells.
[0104] In summary, the present invention provides an ASGR1 nucleic acid aptamer that can specifically bind to the ASGR1 protein and can accurately quantify the ASGR1 protein.
[0105] The applicant declares that the present invention uses the above embodiments to illustrate the detailed method of the present invention, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, the equivalent replacement of each raw material of the product of the present invention, the addition of auxiliary components, and the selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.
Claims
1. A nucleic acid aptamer, characterized in that: The ssDNA nucleic acid sequence of the nucleic acid aptamer includes a sequence as shown in any one of SEQ ID No. 1 to SEQ ID No.
8.
2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid aptamer specifically recognizes the ASGR1 protein.
3. The nucleic acid aptamer according to claim 2, characterized in that The amino acid sequence of the ASGR1 protein includes the sequence shown in SEQ ID No.
9.
4. A method for screening the nucleic acid aptamer according to any one of claims 1 to 3, characterized in that: The method comprises: (1) Using cell index enrichment ligand system evolution technology to screen nucleic acid aptamers, cell lines with stable and high expression of ASGR1 protein were selected as target cells for positive screening, and wild-type host CHO / K1 cells were selected as control cells for negative screening; (2) Use flow cytometry and confocal microscopy to characterize the binding ability and specificity of the candidate nucleic acid aptamer sequences to obtain the final nucleic acid aptamer sequence.
5. The method according to claim 4, characterized in that The method for preparing the cell line stably and highly expressing ASGR1 protein in step (1) comprises: using a three-plasmid packaging system to package a non-replicating virus, infecting CHO-K1 cells, and obtaining a cell line stably and highly expressing ASGR1 protein.
6. The method according to claim 5, characterized in that The three-plasmid packaging system includes a pLVX-IRES-Puro vector plasmid, a pSPAX2 packaging plasmid and a Pmd2.G envelope protein plasmid; Preferably, the pLVX-IRES-Puro plasmid contains the ASGR1 expression gene.
7. Use of the nucleic acid aptamer according to any one of claims 1 to 3 in preparing a product for detecting or assisting in detecting the content of ASGR1 protein or in preparing a medicine for treating liver diseases.
8. A product for specifically detecting extracellular vesicle surface proteins, characterized in that: The product contains the nucleic acid aptamer according to any one of claims 1 to 3.
9. The product according to claim 8, characterized in that The extracellular vesicle surface proteins include ASGR1 protein.
10. Use of the product for specifically detecting extracellular vesicle surface proteins according to claim 8 or 9 in detecting ASGR1 protein content.