Bacillus subtillis for accumulating vanillin and application of bacillus subtillis

By knocking out genomic fragments containing the yhfP gene in Bacillus subtilis, the problem of difficulty in accumulating vanillin in microorganisms is solved, and the vanillin accumulation ability and productivity are significantly improved.

CN120138015APending Publication Date: 2025-06-13BEIJING INST OF TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311715093.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-13
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

In the prior art, when vanillin is produced by microbial methods, aldehyde molecules are easily reduced or oxidized, resulting in vanillin being unable to accumulate in the microorganism in large quantities.

Method used

Through knockout of large genomic fragments, Bacillus subtilis strains with significantly reduced vanillin degradation were screened out, specifically knocking out fragments containing the yhfP gene, thereby improving the accumulation ability of vanillin.

Benefits of technology

It significantly improves the accumulation ability of vanillin, reduces the catabolism of vanillin, and improves the production capacity of vanillin and its derivatives.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138015A_ABST
    Figure CN120138015A_ABST
Patent Text Reader

Abstract

The invention relates to recombinant bacillus subtillis for chassis transformation, which can improve the vanillin accumulation capacity of the bacillus subtillis, and belongs to the technical field of metabolic engineering. According to the recombinant bacillus subtillis, the vanillin accumulation capacity is improved by knocking out a segment containing a yhfP gene on a bacillus subtillis genome, after 1g / L vanillin is added, the residual vanillin of a wild type bacillus subtillis 168 strain is 0.45 g / L 48 hours later, and 55% of vanillin is subjected to catabolism; the residual vanillin of the No.11 strain is 0.80 g / L, and 20% of the vanillin is subjected to catabolism. The strain can be applied to construction and production of vanillin / vanillin derivative production strains, the production capacity is improved, and the yield of corresponding products is increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field:

[0001] The present invention relates to a method for modifying Bacillus subtilis chassis, which can be used for the accumulation and production of vanillin in Bacillus subtilis, and belongs to the field of metabolic engineering technology. Background Art:

[0002] Aldehydes are important organic compounds with a characteristic -CHO group. Many aldehydes have aromatic odors, such as cinnamaldehyde, vanillin, etc., so aldehyde compounds are widely used in the food field and the cosmetic field. Vanillin, also known as vanilla aldehyde, is an aldehyde compound with a milky fragrance. As a broad-spectrum high-grade spice, vanillin is widely used in the food, tobacco, pharmaceutical, and chemical industries. In the food field, due to its strong sweetness and very rich creamy vanilla flavor, vanillin is used as a flavor additive with multiple functions. Vanillin is not only used to enhance the flavor of foods and beverages, but also used as a biological preservative because of its antibacterial, antioxidant, and antimutagenic activities. Synthetic vanillin is also used to manufacture many household products, such as deodorants, air fresheners, floor polishers, and herbicides, etc., and it is also used in the pharmaceutical field as a precursor of dopamine, etc.

[0003] The market demand for vanillin, known as the "king of spices", exceeds 20,000 tons. Currently, the production methods of vanillin include plant extraction method, chemical synthesis method, and microbial synthesis method. Among them, the plant extraction method mainly extracts vanillin from the pods of the vanilla plant Vanilla planifolia. Due to the long time-consuming processes of conventional cultivation, harvesting, and maintenance of vanilla plants, the yield is extremely low. The yield of naturally extracted vanillin is only less than 2,000 tons. Therefore, the price of natural vanillin obtained by the plant extraction method is high, and the supply is very limited. Vanillin produced by the microbial conversion method has high purity and the activity of natural vanillin, which can effectively solve the disadvantages of the plant extraction method such as the occupation of land area by planting plants, slow plant growth cycle, and low yield, and at the same time can avoid the pollution and toxic effects of the chemical synthesis method.

[0004] Utilizing the microbial conversion method to achieve the accumulation of vanillin in cells is an important method for the production of vanillin by the microbial method. However, since the aldehyde molecule contains a carbonyl group, it is very easy to be reduced to alcohol or oxidized to acid in cells. For example, the aldehyde dehydrogenase and alcohol dehydrogenase produced by microorganisms themselves can decompose or convert vanillin into other products such as vanillic acid or vanillyl alcohol, resulting in the inability of vanillin to accumulate in large quantities in microorganisms. Therefore, screening and obtaining microbial strains capable of accumulating aldehyde compounds is of great significance for the production of aldehyde compounds such as vanillin by the microbial method.

[0005] Bacillus subtilis is a typical model industrial microorganism, which is recognized as a host strain with Generally Recognized as Safe (GRAS) status and is widely used in multiple fields including protease preparations, fine chemicals, nutritional products, and pharmaceuticals. Although Bacillus subtilis has good application prospects, the expression of non-essential genes and the accumulation of non-target chemicals in production applications result in the loss of precursor substances and the dispersion of metabolic flux in production applications, thus leading to the waste of resources and energy. Therefore, the redundancy of some non-essential genes in the chassis cells is one of the limiting bottlenecks in industrial applications. By knocking out some non-essential genes in Bacillus subtilis, it is possible to improve the vanillin accumulation ability of Bacillus subtilis. Summary of the Invention:

[0006] The object of the present invention is to provide a method for vanillin accumulation and a Bacillus subtilis chassis cell constructed therefrom, to overcome the problem of vanillin decomposition or consumption in the subsequent production of related metabolic pathways, and to be used for the fermentation production of vanillin and vanillin derivatives (such as vanillic acid, ethyl vanillin, etc.).

[0007] Starting from the wild-type Bacillus subtilis strain, the present invention screens for microbial strains capable of accumulating vanillin through large-scale genomic fragment knockout. Compared with the wild type, strains with significantly reduced vanillin degradation amount have been successfully screened out, that is, a method for improving the vanillin accumulation ability of Bacillus subtilis and a Bacillus subtilis strain with improved vanillin accumulation ability constructed by this method are obtained.

[0008] One of the technical solutions provided by the present invention is a method for improving vanillin accumulation in Bacillus subtilis, and the method is to improve the vanillin accumulation ability by knocking out the fragment containing the yhfP gene on the genome of Bacillus subtilis;

[0009] Further, the fragment containing the yhfP gene is a fragment from yhfM to yhfP on the genome of Bacillus subtilis, and contains the yhfM, yhfN, aprE, yhfO, and yhfP genes.

[0010] Another technical solution provided by the present invention is a Bacillus subtilis with high vanillin accumulation ability, and the strain is a Bacillus subtilis with a defect in the yhfP gene fragment;

[0011] The defect includes but is not limited to gene knockout, gene inactivation, and other methods;

[0012] Further, the starting strain of the Bacillus subtilis with improved vanillin accumulation is Bacillus subtilis 168;

[0013] The yhfP gene fragment has a Gene ID of 939312 and is shown as SEQ ID NO.2;

[0014] Furthermore, the Bacillus subtilis strain with improved vanillin accumulation is obtained by knocking out a 4957-bp large fragment including the yhfP gene fragment on the genome, using Bacillus subtilis 168 as the starting strain. The large fragment is located at positions 1102560 - 1107516 on the Bacillus subtilis 168 genome, as shown in SEQ ID NO.1. The recombinant bacterium after knockout is named Bacillus subtilis strain No. 11 (abbreviated as Bs-11 strain).

[0015] Furthermore, the position number of the knockout sequence on the genome refers to https: / / www.ncbi.nlm.nih.gov / datasets / genome / GCF_000009045.1 / , and the GenBank accession number of the complete genome of Bacillus subtilis 168 is: NC_000964.3.

[0016] The third technical solution provided by the present invention is the application of the above-mentioned Bacillus subtilis with improved vanillin accumulation, especially in the production of vanillin, more particularly in the construction of a chassis bacterium for vanillin production or in the construction of a strain for the production of vanillin / vanillin derivatives. Those skilled in the art can continue to construct a vanillin production strain or a vanillin derivative production strain on the basis of knocking out the yhfP gene fragment or the above-mentioned 4957-bp large fragment in Bacillus subtilis.

[0017] Furthermore, the vanillin derivatives include but are not limited to: vanillic acid, vanillyl alcohol, ethyl vanillin, cinnamic acid, etc.

[0018] Beneficial effects:

[0019] By constructing a strain with improved vanillin accumulation, the present invention provides a chassis bacterium for the production of vanillin / vanillin derivatives, which is beneficial to improving the production capacity of vanillin and its derivatives and increasing the yield of the corresponding products.

[0020] The Bacillus subtilis strain No. 11 constructed by knocking out the large fragment at positions 1102560 - 1107516 on the genome or the strain obtained by deleting the yhfP gene, using Bacillus subtilis 168 as the starting strain, has a significantly improved vanillin accumulation ability. At 48 h after adding 1 g / L vanillin, the remaining vanillin in the wild-type Bacillus subtilis 168 strain is 0.45 g / L, and 55% of the vanillin has undergone catabolism; the remaining vanillin in the No. 11 strain is 0.80 g / L, and only 20% of the vanillin has undergone catabolism.

[0021] The vanillin-accumulating strain constructed by the present invention can provide a chassis bacterium with higher vanillin-accumulating performance for the construction of vanillin-producing strains, laying a foundation for further realizing high-yield vanillin production. Among them, the vanillin-producing strain constructed with Bacillus subtilis strain No. 11 or the strain obtained by knocking out the yhfP gene as the chassis bacterium has about a 35% increase in vanillin production compared with the vanillin-producing strain constructed with Bacillus subtilis strain 168 as the chassis bacterium. Description of the Drawings:

[0022] Figure 1 PCR verification diagram of Bacillus subtilis Bs-11 colony

[0023] Among them, lane M is Marker, lane 1 is the wild-type strain 168, and lanes 2-9 are recombinant positive transformants.

[0024] Figure 2 Comparison of the vanillin accumulation abilities of wild-type Bacillus subtilis 168 and Bacillus subtilis Bs-11.

[0025] Figure 3 Comparison diagram of vanillin metabolites in wild-type Bacillus subtilis 168 and Bacillus subtilis Bs-11.

[0026] Figure 4 Vanillin production curves of Bacillus subtilis Bs-WT-Car strain and Bs-11-Car strain

[0027] Figure 5 Vanillin production curves of Bs-WT-Car strain, Bs-11-Car strain and Bs-Y-Car strain Detailed Embodiments:

[0028] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods.

[0029] Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0030] The following examples are detailed descriptions and explanations of the technical solutions of the present invention and are not used to limit the present invention.

[0031] Table 1 Some primers and sequences involved in the examples of the present invention

[0032]

[0033]

[0034] The Bacillus subtilis strain 168 in the present invention and its embodiments has been extensively disclosed in the prior art. For example, it was disclosed in the literature "Harwood CR, Wipat A. Sequencing and functional analysis of the genome of Bacillus subtilis strain 168. FEBS Lett. 1996 Jun 24; 389(1): 84-7. doi: 10.1016 / 0014-5793(96)00524-8. PMID: 8682212." It is also a commonly used model bacterium in the field of biotechnology, and the public can also obtain it from the Enzymology and Metabolic Engineering Laboratory of Beijing Institute of Technology.

[0035] The present invention will be further explained and illustrated through specific embodiments below.

[0036] Example 1: Construction of Bacillus subtilis Bs-11

[0037] This example is used to illustrate the method for constructing Bacillus subtilis Bs-11.

[0038] (1) In this example, the Bacillus subtilis strain 168 was used as the starting strain, and a large fragment of 4957 bp in length from yhfM to yhfP on the genome (as shown in Sequence Listing SEQ ID NO.1, located at positions 1102560 bp - 1107516 bp on the Bacillus subtilis 168 genome NC_000964.3) was knocked out to obtain the Bacillus subtilis strain No. 11 (abbreviated as Bs-11).

[0039] The region of 1102560 bp - 1107516 bp on the Bacillus subtilis 168 strain genome contains genes and their functions as shown in Table 2 below:

[0040] Table 2

[0041]

[0042] For the above genomic fragment, the CRISPR / Cas9 technology was applied to construct the large fragment deletion strain Bs-11 based on the Bacillus subtilis 168 strain.

[0043] (2) Construction of CRISPR / Cas9 editing plasmid: The target gene sequence (1102560bp - 1107516bp) was input into the Zhang Feng laboratory website (https: / / zlab.bio / guide-design-resources) for prediction of N20 efficiency, and two N20 sequences, N20-1 and N20-2, were determined. Among them, the N20-1 sequence is: ctccttcaggcattgactcg; the N20-2 sequence is: tgagcccattcagagaacat.

[0044] To introduce the two N20s into the editing plasmid simultaneously, primers Δ11-N20-1-1, Δ11-N20-1-2, Δ11-N20-2-1, and Δ11-N20-2-2 were designed. N20-1 is the overlapping region (overlap) of Δ11-N20-1-1 and Δ11-N20-1-2; N20-2 is the overlapping region (overlap) of Δ11-N20-2-1 and Δ11-N20-2-2.

[0045] Using plasmid pJOE-8999 as a template, the editing plasmid pJOE-8999 was linearized by PCR reaction with primers CasA and Δ11-N20-1-1, and the size of the PCR fragment was 2270bp. CasB and Δ11-N20-1-2 were primers for introducing N20-1, and the size of the PCR fragment was 2309bp; Δ11-N20-2-2 and Δ11-N20-2-1 were primers for introducing N20-2, and the size of the PCR fragment was 3011bp. N20-1 and N20-2 were introduced into plasmid pJOE-8999 to construct the knockout plasmid pJOE-8999-N20.

[0046] The PCR reaction system is as follows:

[0047]

[0048]

[0049] According to the above table, the PCR reaction systems of the plasmid backbone linear fragment 11-1, the linear fragment 11-2 for introducing N20-1, and the linear fragment 11-3 for introducing N20-2 were respectively configured in the corresponding PCR tubes. After shaking and mixing evenly, they were placed in a PCR instrument for PCR reaction. The PCR reaction program is as follows:

[0050]

[0051] (3) After the reactions of the three PCR systems were completed, linear fragments of 11-1, 11-2, and 11-3 were obtained. After agarose gel electrophoresis and comparison with the DNA Marker, the target-sized bands in the above table were obtained. The remaining reaction products in the PCR tubes were separately subjected to DNA recovery to obtain the purified linear fragments of 11-1, 11-2, and 11-3.

[0052] (4) The three purified DNA fragments obtained were ligated. In the PCR tube, ligase, 2 μL of ddH 2 O, 1 μL of 11-1, 1 μL of 11-2, and 1 μL of 11-3 were added. After pipetting and mixing evenly with a pipette tip, it was placed in a 50 °C constant temperature water bath for ligation. The ligation time was half an hour. The ligated product was pJOE-8999-N20 into which N20-1 and N20-2 were introduced.

[0053] (5) All 10 μL of the ligated product was transferred into 100 μL of JM109 competent cells with a pipette gun and placed on ice for an ice bath for 25 min. After the ice bath ended, the centrifuge tube was placed in a water bath at 42 °C for heat shock for 1 min 30 s. After the heat shock ended, the centrifuge tube was placed back on ice for an ice bath for 2 min. After the ice bath ended, 900 μL of SOC medium was added to the centrifuge tube, and then it was placed on a shaker at 37 °C and recovered at 220 r for 45 min and then spread on a kanamycin-resistant plate. The plate was placed in a 37 °C constant temperature incubator for overnight growth.

[0054] (6) The colonies on the plate were subjected to PCR verification the next day (the verification primers were Δ11-Test-1 and Δ11-Test-2), and a band of about 1 kb was obtained, indicating that N20 was successfully introduced. The strains with successfully introduced N20 were picked with single colonies and inoculated into a 5 ml sterilized shaking tube, 5 ml of LB medium and 5 μL of kanamycin were added, and it was placed in a shaking tube at 37 °C for overnight culture. The next day, the TIANGEN plasmid miniprep kit was used for plasmid extraction to obtain pJOE-8999-N20.

[0055] (7) Plasmid pJOE-8999-N20 was used for the insertion of homologous arms. Using plasmid pJOE-8999-N20 as a template, first, the linear fragment N20-G of the double N20 backbone was amplified, and a repair template was introduced on this basis. Using the genome of Bacillus subtilis 168 as a template, the upstream and downstream homologous arms (11-5HA, 11-3HA) of the 4957 bp gene to be knocked out (the fragment from yhfM to yhfP on the genome) were obtained by PCR amplification with primers Δ11-HA-1 and Δ11-HA-2 and Δ11-HA-3 and Δ11-HA-4 respectively. The upstream and downstream homologous arms were spliced together by Overlap PCR to form a repair template. The PCR reaction system is as follows:

[0056]

[0057]

[0058] Prepare the PCR reaction systems of the linear fragment N0-G with double N20 scaffolds, repair template 11-5HA, and repair template 11-3HA in the corresponding PCR tubes as shown in the above table. After shaking and mixing evenly, place them in a PCR instrument for PCR reaction. The PCR reaction program for N20-G is as follows:

[0059]

[0060] The PCR reaction systems for 11-5HA and 11-3HA are as follows:

[0061]

[0062] (8) After the reactions of the three PCR systems are completed, the linear fragments of N20-G, 11-5HA, and 11-3HA are obtained. After agarose gel electrophoresis and comparison with the DNA Marker, the target-sized bands in the above table are obtained. The remaining reaction products in the PCR tubes are respectively subjected to DNA recovery to obtain the purified linear fragments of N20-G, 11-5HA, and 11-3HA.

[0063] (9) Ligate the three obtained purified DNA fragments. Add ligase, 2 μL of ddH2O, 1 μL of N20-G, 1 μL of 11-5HA, and 1 μL of 11-3HA to the PCR tube. After pipetting and mixing evenly, place it in a 50 °C constant temperature water bath for ligation. The ligation time is half an hour. The ligated product is the knockout plasmid pCas11.

[0064] (10) Transfer all 10 μL of the ligated product into 100 μL of JM109 competent cells using a pipette gun, place it on ice, and incubate on ice for 25 min. After the ice bath is completed, place the centrifuge tube in a 42 °C water bath for heat shock for 1 min 30 s. After the heat shock is completed, place the centrifuge tube back on ice for an ice bath for 2 min. After the ice bath is completed, add 900 μL of SOC medium to the centrifuge tube, then place it on a shaker at 37 °C and incubate at 220 rpm for 45 min, and then spread it on a kanamycin-resistant plate. The plate is placed in a 37 °C constant temperature incubator and grown overnight.

[0065] (11) On the second day, the colonies on the plate were verified by PCR (the verification primers were HA-5 and HA-3), and a band of about 1966 bp was obtained, indicating that the repair template was successfully introduced. Single colonies of the strains with the successfully introduced repair template were picked and inoculated into 5 ml sterilized shaking tubes, 5 μL of kanamycin was added to 5 ml of LB medium, and they were placed in a shaking tube at 37 °C for overnight culture. The next day, a plasmid miniprep kit from TIANGEN was used to extract the plasmid, and the knockout plasmid pCas11 was obtained.

[0066] (12) CRISPR / Cas9 induction and editing: 10 μL of the constructed editing plasmid pCas11 was transferred into competent cells of Bacillus subtilis 168 using a pipette. After resuscitating at 220 rpm in a shaker at 37 °C for 1 h, it was spread on an LB plate containing 20 μg / mL kanamycin resistance and 0.2% mannitol and then placed in an incubator at 30 °C for overnight culture.

[0067] (13) Detection of CRISPR / Cas9 gene editing results: On the LB editing plate containing kanamycin and mannitol, single colonies were randomly selected, and positive clones were screened by colony PCR using two pairs of internal and external primers designed for the deleted gene fragment. Sanger sequencing was performed to further verify the genomic editing situation. The PCR reaction system is as follows:

[0068]

[0069] The PCR reaction system is as follows:

[0070]

[0071] The PCR products were subjected to agarose gel electrophoresis. When a band within 11- could not be obtained for the same colony, but a band outside 11- with a size of 2.2 kb could be obtained, it indicated that the colony was successfully edited. The verification results are as Figure 1 shown, Figure 1 The upper figure is the band 11- outside obtained by PCR using external primers of the homologous arm, and the lower figure is the band 11- inside obtained by PCR using internal primers of the homologous arm. Among them, the first lane is the marker, and the second to the ninth lanes are the results of single colony PCR of the Bs-11 knockout strains. From Figure 1 the results, it can be seen that when performing PCR on 8 single colonies of the Bs-11 knockout strains, fragments of 11- outside with a size of 2.2 kb could be obtained, and fragments of 11- inside could not be obtained, indicating that these colonies were successfully edited.

[0072] (14) Elimination of the editing plasmid: After successful gene editing, it is necessary to eliminate the editing plasmid in the bacteria for subsequent gene operations. Since the editing plasmid carries the temperature-sensitive Bacillus subtilis replication origin pE194ts, the loss of the editing plasmid can be achieved by increasing the culture temperature of Bacillus subtilis. Pick the correctly edited positive mutants and inoculate them into antibiotic-free LB liquid medium, and culture them overnight in a shaker at 50 °C and 220 rpm. Dip an appropriate amount of the bacterial solution with a sterilized inoculation loop, streak it on an antibiotic-free LB agar plate, and incubate it at 42 °C until single colonies grow. Inoculate the single colonies into LB liquid medium containing kanamycin and antibiotic-free LB medium respectively to verify whether the plasmid has been eliminated. When the same colony grows normally on the antibiotic-free LB plate but cannot grow on the LB plate containing kanamycin, the colony has successfully lost the editing plasmid. After losing the plasmid, the obtained strain was named Bacillus subtilis strain No. 11 (abbreviated as Bs-11 strain) and stored in a -80 °C refrigerator.

[0073] Example 2: Analysis of the vanillin accumulation ability of Bacillus subtilis Bs-11 strain.

[0074] This example is used to illustrate that Bacillus subtilis Bs-11 strain can accumulate a high concentration of vanillin.

[0075] Randomly pick single colonies of Bacillus subtilis 168 and Bacillus subtilis Bs-11 from each plate and inoculate them into 20 mL of fresh LB medium, and culture them overnight in a shaker at 37 °C and 220 rpm as the seed solution. The next day, inoculate them at 2% into 20 ml of fresh LB medium, shake at 37 °C until OD 600 ≈ 2.5, add vanillin to make its final concentration 1 g / L and transfer to a shaker at 30 °C and 220 rpm. After culturing for 48 h, take 1 mL of the sample, centrifuge the sample at 7000 rpm for 10 min, suck the supernatant with a disposable sterile syringe, filter it through a 0.22 μm water membrane, and then perform high performance liquid chromatography (HPLC) detection.

[0076] The chromatographic detection conditions are as follows: chromatographic column: Gemini (5μm NX-C18 150×4.6mm), mobile phase: methanol / acetonitrile / 0.2% formic acid water (volume ratio 15:15:70); flow rate: 1 mL / min; detection wavelength: 231 nm; column temperature: room temperature; injection volume: 5 μL, detection duration: 15 min.

[0077] After detection, all data were statistically analyzed, and the results are as Figure 2As shown (in the figure, CK is the blank control without adding any strains, WT is the experimental group adding Bacillus subtilis 168, and 11 is the experimental group adding Bacillus subtilis Bs-11). After 48 h, the residual vanillin content in the medium was detected by HPLC to evaluate the vanillin accumulation ability of the modified strains. The wild-type original strain (WT) only had 0.45 g / L of residual vanillin after 48 h, and 55% of the vanillin was decomposed. While the vanillin concentration in the medium of Bs-11 was significantly higher than that of the wild-type at 48 h, reaching 0.80 g / L, and only 20% was decomposed, indicating that Bs-11 belongs to the vanillin-accumulating type of Bacillus subtilis.

[0078] Example 3: Analysis of vanillin metabolites of Bacillus subtilis Bs-11

[0079] Single colonies of Bacillus subtilis 168 and Bacillus subtilis Bs-11 were randomly picked from each plate and inoculated into 20 mL of fresh LB medium respectively, and cultured overnight at 37 °C and 220 rpm in a shaker as seed solutions. The next day, they were inoculated at 2% into 20 ml of fresh LB medium and shaken at 37 °C until OD 600 ≈2.5, vanillin was added to make its final concentration 1 g / L (6.57 mM), and then transferred to a shaker at 30 °C and 220 rpm. After culturing for 48 h, 1 mL of the sample was taken, the sample was centrifuged at 7000 rpm for 10 min, the supernatant was aspirated with a disposable sterile syringe, and after passing through a 0.22 μm water membrane, the by-products were detected by high performance liquid chromatography (HPLC). Vanillin is an aldehyde substance, and the main potential by-products are alcohol and acid substances. By detection and comparison with the standard products, it can be confirmed that the main by-products of vanillin are vanillic acid and vanillyl alcohol.

[0080] The specific results are as Figure 3 shown. After 48 h, the wild-type original strain (WT) only had 0.45 g / L (2.96 mM) of vanillin left, and at the same time, 0.14 g / L (0.91 mM) of vanillyl alcohol and 0.36 g / L (2.14 mM) of vanillic acid were produced. The cumulative total of these compounds was 6.01 mM, which was close to the total amount of vanillin initially added (6.57 mM), indicating that vanillyl alcohol and vanillic acid were the main by-products of vanillin, and the total amount of by-products was 3.05 mM. While Bs-11 retained 0.80 g / L (5.26 mM) of vanillin at 48 h, and at the same time, 0.04 g / L (0.26 mM) of vanillyl alcohol and 0.15 g / L (0.89 mM) of vanillic acid were produced, and the total amount of by-products was only 1.15 mM. It can be seen from this that the main by-products of vanillin are vanillyl alcohol and vanillic acid, and Bs-11 has fewer vanillin metabolites than the wild-type original strain (WT), that is, less vanillin degradation occurs in the Bs-11 strain.

[0081] Example 4: Production of vanillin using vanillin-accumulating strain Bs-11 as the chassis bacterium

[0082] (1) Construction of the vanillin metabolic pathway in Bacillus subtilis: To generate vanillin using vanillic acid as the substrate, it is necessary to express the carboxylic acid reductase gene Car (GenBank: AAR91681.1) from Candida. The Car gene fragment was obtained by gene synthesis, and the Car gene was constructed on pHT-01 to obtain the vanillin production plasmid pHT-Car. The PCR reaction system is as follows:

[0083]

[0084] According to the system shown in the above table, the PCR reaction systems for the plasmid backbone linear fragment Car-G and the Car gene were respectively configured in the corresponding PCR tubes. After shaking and mixing evenly, they were placed in a PCR instrument for PCR reaction. The PCR reaction program is as follows:

[0085]

[0086] (2) After the two PCR systems were reacted, the linear fragments of Car-G and Car were obtained. Agarose gel electrophoresis was performed respectively and compared with DNA Marker to obtain the target size bands in the above table.

[0087] (3) The remaining reaction products in the PCR tubes were respectively subjected to DNA recovery to obtain the purified linear fragments of the DNA amplification products, namely Car-G and Car.

[0088] (4) Ligation of the two purified DNA fragments obtained: Ligase, 3 μL of ddH2O, 1 μL of Car-G, and 1 μL of Car were added to the PCR tube. After pipetting and mixing evenly, it was placed in a 50 °C constant temperature water bath for ligation. The ligation time was half an hour. The ligated product was the plasmid pUC-Car.

[0089] (5) Transformation of the ligated product into 100 μL of JM109 competent cells: All 10 μL of the ligated product was transferred into 100 μL of competent cells, placed on ice, and ice-bathed for 25 min. After the ice bath, the centrifuge tube was placed in a 42 °C water bath for heat shock for 1 min 30 s. After the heat shock, the centrifuge tube was placed back on ice for an ice bath for 2 min. After the ice bath, 900 μL of SOC medium was added to the centrifuge tube, and then it was placed on a 37 °C shaker and resuscitated at 220 rpm for 45 min and then spread on a kanamycin-resistant plate. The plate was placed in a 37 °C constant temperature incubator for overnight growth.

[0090] (6) The next day, single colonies were picked for PCR to verify whether the plasmid was successfully constructed. The PCR reaction system is as follows:

[0091]

[0092] According to the system shown in the above table, configure the PCR reaction system for verifying the Car fragment in the corresponding PCR tubes respectively. After shaking and mixing evenly, put them into the PCR instrument for PCR reaction. The PCR reaction program is as follows:

[0093]

[0094] After the PCR reaction, perform agarose gel electrophoresis, compare the bands with the DNA Marker, and obtain the target correct bands in the above table, that is, successfully construct the vanillin production plasmid pHT-Car.

[0095] (7) Transform the constructed vanillin production plasmid pHT-Car into the competent cells of Bacillus subtilis 168 and the competent cells of Bs-11 respectively. Resuscitate in a shaker at 37°C and 220 rpm for 1 h. Take 200 μL and coat it on the kanamycin plate, and place it in an incubator at 37°C for overnight culture.

[0096] (8) The next day, pick the monoclonal colonies on the plate and inoculate them into the shaking culture tubes for culture. Add 5 ml of liquid LB medium, 5 μL of kanamycin and the monoclonal colonies on the two plates respectively. Obtain two production strains that can convert vanillic acid into vanillin. One is the vanillin production strain Bs-WT-Car with wild-type Bacillus subtilis 168 as the chassis bacterium, and the other is the vanillin production strain Bs-11-Car with Bacillus subtilis Bs-11 as the chassis bacterium. Put the shaking culture tubes into a shaker at 37°C and shake at 220 rpm for 8 h for bacteria preservation. Take 1 ml of the bacterial liquid and mix it evenly with 500 μL of 50% glycerol solution, and store it in a -80°C refrigerator.

[0097] (9) Take out the strains Bs-WT-Car and Bs11-Car that have been transferred with the vanillin production pathway plasmid and stored in the -80°C refrigerator, place them in an ice box or on ice respectively, dip a small amount of the bacterial liquid with an inoculation loop in the ultra-clean bench, and perform plate streaking on the solid medium respectively. Then place it in an incubator at 30°C and incubate overnight at a constant temperature until single colonies grow. Randomly pick single colonies from each plate and inoculate them into 20 mL of fresh LB medium, and place them in a shaker at 37°C and 220 rpm for overnight culture as the seed liquid. Add 20 ml of medium, 20 μL of kanamycin antibiotic and 200 μL of the seed liquid into the shake flask respectively, and place it in a shaker at 37°C and 220 rpm for overnight culture. Set up blank controls and three parallels for each group of experiments. After 12 h, add the substrate vanillic acid to make its final concentration 3 mM. Sampling is carried out every 12 h to detect the vanillin yield of the fermentation broth.

[0098] (10) The results are as Figure 4 shown. Compared with the Bs-WT-Car strain constructed with wild-type Bacillus subtilis 168 as the chassis bacterium, the Bs-11-Car strain constructed with the vanillin-accumulating strain Bs-11 as the chassis bacterium has a higher yield of vanillin produced from vanillic acid. At 12 h, the vanillin yield of the Bs-11-Car strain reached 1.88 mM, and the conversion rate was 62.8%, while the vanillin yield of Bs-WT-Car was 1.39 mM, and the conversion rate was 46.4%. Therefore, the vanillin-accumulating strain Bs-11 has a stronger vanillin-accumulating ability than the wild-type Bs168 and is a more suitable chassis strain for vanillin production.

[0099] Example 5: Comparison of vanillin-accumulating abilities between the YhfP gene knockout strain and the Bs-11 strain

[0100] To further verify whether the vanillin-accumulating ability of the Bs-11 strain is caused by a single gene deletion, we used the Bacillus subtilis 168 strain as the starting strain and performed a single gene knockout of the YhfP gene (the specific gene information is shown in Table 2, and the specific knockout method refers to Example 1. Replace the corresponding primers, and the specific primers are shown in Table 1, using single N20). The strain constructed by knocking out the YhfP gene on the Bacillus subtilis 168 strain was named strain Bs-Y.

[0101] By transferring the vanillin production plasmid pHT-Car (the specific transformation method is shown in Example 4), we obtained the vanillin production strain Bs-Y-Car.

[0102] Using Bs-WT-Car and Bs-11-Car as controls respectively, we measured the vanillin production ability of Bs-Y-Car (the measurement method is the same as that in Example 4).

[0103] The experimental results are as Figure 5 shown. At 12 h of Bs-11-Car, the vanillin yield of Bs-Y-Car reached 1.80 mM, and the conversion rate was 60%, which was very close to the vanillin yield of Bs-11-Car (1.88 mM) and significantly higher than the vanillin yield of Bs-WT-Car (1.39 mM). This result indicates that the knockout of the YhfP gene is the key reason for the Bs-11 strain to have the vanillin-accumulating ability.

[0104] The 4957-bp large fragment located at positions 1102560 bp - 1107516 bp on the genome of Bacillus subtilis 168 described in the present invention is as shown in SEQ ID NO.1:

[0105]

[0106] The YhfP gene fragment of the present invention has a Gene ID of 939312 and is shown as SEQ ID NO.2:

[0107] Atgtcaacgttatttcaagccttgcaggcagaaaaaaatgccgatgatgtttcagtccatgtgaaaaccatatcaacagaggatttgccgaaggatggtgtcctgattaaagttgcttattccggcattaattacaaagatggtctggccggaaaagcaggaggcaatatcgtcagagagtatccgcttattttaggcattgatgctgcgggtacggtcgtctcttccaatgatccgcgttttgcggagggggatgaggtgatcgcgacaagctatgagctcggtgtctcacgtgatggcggattaagtgaatacgcttcggtgcctggtgactggctggtgcctttgccacagaatctttcgttaaaagaagcgatggtgtacggaacggcgggatttactgcggcgttatcagtgcatcggcttgaacagaacggtctgtctccggaaaaaggcagcgtgctagtcacaggagcaaccggcggtgtcggcggaattgcggtatcgatgctgaacaagcggggttatgatgtggtggcaagtaccggaaaccgggaggcggctgattatttgaaacagcttggtgcaagcgaagtaatcagcagggaagatgtctatgacggaacgcttaaggcgctgtccaagcagcaatggcagggagcggttgatccagtcggcggaaaacagcttgcctcgcttttaagcaaaattcaatacggcggatctgtcgcagtgagcggcttaaccggcggaggagaagttccggcaaccgtgtatccttttattcttcgcggagtaagcctgctcggaatcgattcagtatattgtccgatggacgtcagagccgctgtttgggagcgcatgtcttctgatctcaagcctgatcagctgctgaccatcgtggacagggaagtatcattggaagaaacgccgggtgcgttaaaagatattttgcaaaatcgcattcaaggaagagtgattgtgaagctttaa。

[0108] Although the present invention has been disclosed above in preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various changes, modifications, substitutions, and variations in form and details to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.

Claims

1. A method for enhancing vanillin accumulation in Bacillus subtilis, characterized in that, the method enhances the ability of vanillin accumulation by knocking out the fragment containing the yhfP gene on the genome of Bacillus subtilis.

2. The method for enhancing vanillin accumulation in Bacillus subtilis according to claim 1, characterized in that, the fragment containing the yhfP gene is a fragment from yhfM to yhfP on the genome of Bacillus subtilis, including the yhfM, yhfN, aprE, yhfO, and yhfP genes.

3. A strain of Bacillus subtilis with enhanced vanillin accumulation, characterized in that, the strain is a Bacillus subtilis with a defect in the yhfP gene fragment.

4. The strain of Bacillus subtilis with enhanced vanillin accumulation according to claim 3, characterized in that, the starting strain of the Bacillus subtilis with enhanced vanillin accumulation is Bacillus subtilis 168.

5. The strain of Bacillus subtilis with enhanced vanillin accumulation according to claim 3, characterized in that, the yhfP gene fragment, with Gene ID 939312, is as shown in SEQ ID NO.

2.

6. The strain of Bacillus subtilis with enhanced vanillin accumulation according to claim 3, characterized in that, the strain of Bacillus subtilis with enhanced vanillin accumulation is obtained by knocking out a 4957bp large fragment including the yhfP gene fragment on the genome, using Bacillus subtilis 168 as the starting strain. The large fragment is located at positions 1102560 - 1107516 on the genome of Bacillus subtilis 168 and is as shown in SEQ ID NO.

1.

7. Use of the strain according to any one of claims 3 - 6 in the production of vanillin or vanillin derivatives.

8. Use of the strain according to any one of claims 3 - 6 in the construction of a chassis bacterium for vanillin production or vanillin derivative production.

9. The use according to claim 7 or 8, characterized in that, the vanillin derivatives include but are not limited to: vanillic acid, vanillyl alcohol, ethyl vanillin, cinnamic acid.