SNP (Single Nucleotide Polymorphism) molecular marker related to pig semen quality trait gene PSMD11, primer pair and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to a pig semen quality trait gene PSMD11, a primer pair and application of the SNP molecular marker and the primer pair, and relates to the technical field of pig molecular markers. The quality traits of the boar semen are semen volume, sperm density, effective sperm density, forward movement activity, sperm activity and sperm malformation rate traits; the molecular marker is located in a No.13 intron of a pig PSMD11 gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and G.169Agt exists at the 169bp position of the sequence; the T basic group is mutated. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding by using the molecular marker. The SNP molecular marker in the pig PSMD11 gene is found to be related to the sperm volume, sperm density, effective sperm density, forward movement activity, sperm activity and sperm malformation rate characters of the pig for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of the pig, the early screening of the quality characters of the sperm of the pig is realized, and the screening method is simple and rapid.

Description

Technical Field

[0001] The present invention relates to the technical field of porcine molecular markers, and particularly relates to an SNP molecular marker, a primer pair related to the porcine semen quality trait gene PSMD11, and their applications. Background Art

[0002] China is the largest country in the world for pig production and consumption, and has become a major participant in the world pork market. The artificial insemination technology plays an important role in the development of modern pig farming industry, and is an important technical means to improve the quality of pork products, promote breed improvement and large-scale pig breeding. The quality of boar semen directly affects the success rate of artificial insemination and the reproductive ability of boars, which is the key to the successful implementation of pig artificial insemination, plays a key role in the pig farming industry, and directly affects the economic benefits of pig farms. The semen quality trait is a trait with medium to low heritability, and it is difficult to effectively improve the semen quality of boars by traditional breeding methods. Understanding the genetic structure and detecting candidate genes and molecular markers related to semen quality traits helps to improve genetic selection and accelerate the genetic process. Currently, there are still insufficient key genes that can be utilized and the mechanism of their influence on semen quality traits can be elucidated. Therefore, finding the key molecular genetic markers that control pig semen quality traits and using them in molecular marker-assisted breeding is of great significance for improving pig semen quality traits and increasing economic benefits.

[0003] The 26S proteasome (PSMD11) is a non-ATPase subunit of the proteasome, which has a highly ordered structure and is composed of 2 complexes, a 20S core and a 19S regulatory factor. PSMD11 belongs to the PSMD family and is mainly responsible for the ubiquitin-proteasome degradation pathway of proteins. This pathway plays an important role in cell cycle regulation, DNA repair and apoptosis. The PSMD11 complex plays a key role in maintaining protein homeostasis by removing misfolded or damaged proteins that may impair cell function, as well as removing proteins that are no longer needed for function. Therefore, the proteasome may be involved in many cellular processes, including cell cycle progression, apoptosis or DNA damage repair.

[0004] Some studies have shown that MicroRNA-451 inhibits the inflammation and proliferation of glomerular mesangial cells by downregulating PSMD11 and NF-κB p65; there are also studies showing that AMPK may play a related role in regulating proteasome function by physically interacting with PSMD11 and changing its phosphorylation state.

[0005] However, there has been no report on the molecular mechanism of whether the PSMD11 gene can improve the semen quality of boars. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies in the above-mentioned prior art, and provides an SNP molecular marker, a primer pair and their applications related to the porcine semen quality trait gene PSMD11. The present invention discovers that an SNP in the 13th intron of the PSMD11 gene (ensemble number: ENSSSCT00000019298.5) is associated with porcine semen quality traits, and can be used as a molecular marker for screening porcine semen quality traits and pig breeding.

[0007] In the first aspect, the present invention provides an SNP molecular marker related to the porcine semen quality trait gene PSMD11, where the porcine semen quality traits are semen volume, sperm density, effective sperm density, forward motility, sperm motility and sperm malformation rate; the molecular marker is located in the 13th intron of the porcine PSMD11 gene (ensemble number: ENSSSCT00000019298.5), and its nucleotide sequence is as shown in SEQ ID NO.1 in the sequence listing, and there is a g.169A>T base mutation at the 169th bp of this sequence.

[0008] Furthermore, the A or T base polymorphism site at the 169th bp in SEQ ID NO.1 shows three genotypes: AA, AT or TT, and the T allele is the dominant allele.

[0009] In the second aspect, the present invention provides an application of the SNP molecular marker as described in the first aspect in screening porcine semen quality traits and / or pig breeding.

[0010] In the third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, and the primer pair includes: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3.

[0011] In the fourth aspect, the present invention provides an application of the primer pair as described in the third aspect in screening porcine semen quality traits and / or pig breeding.

[0012] In the fifth aspect, the present invention provides a kit for rapid pig breeding using the SNP molecular marker as described in the first aspect, which contains the primer pair as described in the third aspect.

[0013] In the sixth aspect, the present invention provides a method for screening porcine semen quality traits and / or pig breeding, including the following steps:

[0014] S1. Extract the genomic DNA of pigs;

[0015] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification with the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purify it;

[0016] S3. Perform sequencing analysis on the molecular marker purified in step S2, retain the individuals carrying the T allele at the 169th bp of the sequence, and eliminate the individuals carrying the A allele.

[0017] Further, in step S1, genomic DNA is extracted from the ear edge tissue of the pigs to be tested.

[0018] Further, in step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCRmix, 1 μL of each of the above upstream and downstream primers, and ddH2O is added to make up the total volume to 50 μL; the running program of PCR is: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 59 °C for 30 s, extension at 72 °C for 30 s, 35 cycles; extension at 72 °C for 10 min; preservation at 4 °C.

[0019] Compared with the prior art, the beneficial effects of the present invention include: The present invention discovers for the first time that a SNP molecular marker in the porcine PSMD11 gene is related to the semen quality traits of pigs, specifically semen volume, sperm density, effective sperm density, straight-line motility, sperm motility, malformation rate, and effective sperm number traits. Therefore, this molecular marker can be used for screening porcine semen quality traits and breeding, that is, it provides a new use of a SNP molecular marker in the porcine PSMD11 gene for marker-assisted breeding of porcine semen quality traits, realizing the early screening of porcine semen quality traits, and the screening method is simple and fast. Description of the Drawings

[0020] Figure 1 This is the agarose gel electrophoresis detection diagram of the PCR product in Example 1 of the present invention, where lane M is DL1000Marker, and lanes 1-4 are the amplified fragments in pigs, and the fragment size is 169 bp;

[0021] Figure 2 This is the sequencing map of the g.169A>T locus in Example 1 of the present invention. Detailed Embodiments

[0022] In order to make the objectives, technical solutions, and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] Example 1 Obtaining of the SNP Detection Fragment of the Porcine PSMD11 Gene and Establishment of the Polymorphism Locus Detection Method

[0024] 1. Extraction of porcine genomic DNA

[0025] The experimental pig breed in this application is Large White pigs, and the samples are from Aonong Group. The porcine genomic DNA was extracted using the Animal Tissue Genomic DNA Extraction Kit (PureLink TM Pro 96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Corporation, and the porcine genomic DNA was extracted according to the kit instructions. The extracted DNA was subjected to concentration and quality detection and stored at -20°C for later use.

[0026] 2. Obtaining of SNP genetic marker detection fragments of porcine PSMD11 gene

[0027] (1) PCR amplification

[0028] According to the SNP genetic marker detection sequence in the genomic sequence of the porcine PSMD11 gene, a pair of primers was designed to amplify the fragment of the polymorphic site.

[0029] Among them, the nucleotide sequence of the SNP genetic marker detection sequence is:

[0030] ACCACCATGTGAATCAAACTTATCCTTTTCTTCCAATATAAACAATAACATGCATCCCCTTCACCACTGCATCACCACCACCATCCCCCTCACCGTGTGTGACTGACTTACCATGAAATTTCTTGTCAATAATCATCTGTGATAATTTCCTTTCCACATCTTCCTAAAA, as shown in SEQ ID NO.1.

[0031] The designed primers are as follows:

[0032] Forward primer: 5'ACCACCAGGTGAAGCAAACG 3', as shown in SEQ ID NO.2.

[0033] Reverse primer: 5'TTTTAGGCCGATGTGGAAAGGA 3', as shown in SEQ ID NO.3.

[0034] Genomic DNA was extracted from the ear edge tissue of the pigs to be tested as a template, and PCR amplification was carried out using the above-designed primers. The PCR reaction system was 50 μL, and the components in the system were: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL of each of the above upstream and downstream primers, and added with ddH 2O was supplemented to a total volume of 50 μL. The PCR running program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 59°C for 30 s, extension at 72°C for 30 s, for 35 cycles; extension at 72°C for 10 min; storage at 4°C. The PCR products were detected by 1.5% agarose gel electrophoresis, and the detection results are as attached Figure 1 as shown, where lane M was DL1000 Marker, and lanes 1-3 were the amplified fragments in pigs, and the size of the amplified fragment was 169 bp.

[0035] (2) Purification of PCR products

[0036] The above PCR amplification products were purified using the Gel Extraction Kit from Shanghai Sangon Biotech Co., Ltd. The specific steps are shown in the kit instruction manual.

[0037] 3. Detection of molecular markers using direct sequencing of PCR products

[0038] The above-obtained purified PCR products were directly sent to Beijing AuGCT Co., Ltd. for sequencing, and the genotypes of this locus in the detection population were determined according to the sequencing results. Analysis was performed using DNA Star software, and the results are as attached Figure 2 as shown, and it was found that there was an A169–T169 allelic gene mutation at the 169th bp in the sequence shown in SEQ ID NO.1, i.e., g.169A>T, and the above mutation caused polymorphism of the PSMD11 gene.

[0039] Example 2 Detection of polymorphism distribution of molecular markers in pigs

[0040] In this example, the polymorphism distribution pattern of the g.169A>T locus of the porcine PSMD11 gene was detected in 170 pigs with the trait of the number of piglets born in the first parity, and the detection results are shown in Table 1.

[0041] Table 1 Polymorphism distribution pattern of the g.169A >T locus of the PSMD11 gene

[0042]

[0043] It can be seen from the results in Table 1 that at the g.169A>T locus of the PSMD11 gene in pigs, there were three genotypes: AA, AT, and TT. Among them, there were more individuals with the AA genotype, and the frequency of the A allele was 72.8%.

[0044] Example 3 Association analysis between molecular markers and porcine semen quality traits

[0045] To determine whether the g.169A>T locus of the porcine PSMD11 gene is associated with differences in porcine semen quality traits, polymorphism detection was performed using the method established in Example 1, and the correlation between different genotypes of this polymorphic locus and semen volume, sperm density, effective sperm density, progressive motility, sperm motility, and sperm abnormality rate traits was analyzed. The GLM procedure of SAS statistical software (SAS Institute Inc, Version 9.1) was used for variance analysis of different SNP genotype combinations and significant tests. The model used was:

[0046] Y ij = μ + G i + F j + e ijk ;

[0047] Y ij is the trait phenotypic value, μ is the mean value, G i is the genotype effect (including gene additive effect and dominant effect); F j is the comprehensive effect of the pig farm; e ijk is the residual effect.

[0048] Association analysis between different genotypes and semen quality traits was performed in pigs. The statistical analysis results are shown in Table 2:

[0049] Table 2 Association analysis of the g.169A>T locus of the PSMD11 gene with porcine semen quality traits

[0050]

[0051]

[0052] Note: The trait means in the table are composed of mean ± standard deviation. Different A and B indicate significant differences (P<0.05), * indicates significant differences (P<0.05), and ** indicates extremely significant differences (P<0.01)

[0053] Regarding the relationship between semen quality traits, the GLM procedure of SAS software was used to perform association analysis on the detection population. The results are shown in Table 2. In this population, individuals with the TT genotype at the g.169A>T locus of the PSMD11 gene had higher semen volume, sperm density, effective sperm density, progressive motility, sperm motility, and lower sperm abnormality rate compared to AT and AA genotype individuals, and the traits of semen volume, sperm motility, and sperm abnormality rate were all significant (P<0.05); the additive effect of the sperm abnormality rate reached a significant level (P<0.05), and the additive effect of the sperm motility trait was extremely significant (P<0.01).

[0054] Application of SNP molecular marker of PSMD11 gene in screening of porcine semen quality traits and / or porcine breeding

[0055] The SNP molecular marker g.169A>T locus on the intron of the PSMD11 gene is significantly correlated with porcine semen quality traits, and the additive effect of the sperm malformation rate trait reaches a significant level, and the additive effect of the sperm motility trait reaches an extremely significant level. Therefore, in the process of breeding pigs, TT-type or AT-type individuals with good semen quality performance can be selected assisted by this SNP molecular marker, AA-type individuals can be eliminated, and individuals carrying this advantageous allele should be retained in breeding, so as to be conducive to improving the production performance of the population.

[0056] The specific embodiments of the present invention described above do not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and deformations made according to the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the pig semen quality trait gene PSMD11, characterized in that: The semen quality traits are semen volume, sperm density, effective sperm density, linear motility, sperm motility, deformity rate and effective sperm number; the molecular marker is located in the 13th intron of the pig PSMD11 gene, and its nucleotide sequence is shown in the sequence table SEQ ID NO.

1. There is a G.169A>T base mutation at the 169bp of the sequence.

2. The SNP molecular marker associated with the pig semen quality trait gene PSMD11 according to claim 1, characterized in that: The A or T base polymorphic site at the 169 bp in the sequence SEQ ID NO.1 exhibits three genotypes: AA, AT or TT, among which the T allele is the dominant allele.

3. Use of the SNP molecular marker as described in any one of claims 1 or 2 in pig semen quality trait screening and / or pig breeding.

4. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pair includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. Use of the primer pair as claimed in claim 4 in screening of pig semen quality traits and / or pig breeding.

6. A kit for rapid pig breeding using the SNP molecular marker as claimed in claim 1, characterized in that: Comprising the primer pair as claimed in claim 4.

7. A method for screening pig semen quality traits and / or pig breeding, characterized in that: The following steps are involved: S1. Extract pig genomic DNA; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying it; S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the T allele at the 169 bp of the sequence, and eliminate the individuals carrying the A allele.

8. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

9. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; the PCR operation program is: 94°C pre-denaturation for 3 min; 94°C denaturation for 30 s, 59°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 10 min; 4°C storage.

Images