SNP (Single Nucleotide Polymorphism) molecular marker related to boar semen quality trait gene GNAS, primer pair and application of SNP molecular marker and primer pair

Abstract

The invention discloses an SNP molecular marker related to a semen quality trait gene GNAS, a primer pair and application of the SNP molecular marker and the primer pair, and relates to the technical field of pig molecular markers. The quality traits of the boar semen are semen volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm motility traits; the molecular marker is located in the second intron of the pig GNAS gene, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1 in a sequence table, and g.277Ggt exists at the 277bp position of the sequence; and A basic group mutation. The invention also provides a primer pair for amplifying the molecular marker and a method for breeding pigs by using the molecular marker. The SNP molecular marker in the pig GNAS gene is found to be related to the sperm volume, sperm density, effective sperm density, forward movement activity, sperm malformation rate and sperm activity characters of pigs for the first time, so that the SNP molecular marker can be used for marker-assisted selective breeding of pigs, early screening of the quality characters of the sperm of the pigs is realized, and the screening method is simple and rapid.

Description

Technical Field

[0001] The present invention relates to the technical field of porcine molecular markers, and particularly relates to an SNP molecular marker related to the gene GNAS for porcine semen quality traits, a primer pair thereof, and applications thereof. Background Art

[0002] China is the largest country in the world in terms of pig production and consumption and has become a major participant in the world pork market. The artificial insemination technology plays an important role in the development of modern pig farming and is an important technical means to improve the quality of pork products, promote breed improvement, and scale up pig farming. The quality of boar semen directly affects the success rate of artificial insemination and the reproductive ability of boars, which is the key to the successful implementation of pig artificial insemination and plays a crucial role in pig farming, directly affecting the economic benefits of pig farms. Semen quality traits are medium to low heritability traits, and it is difficult to effectively improve boar semen quality by traditional breeding methods. Understanding the genetic structure and detecting candidate genes and molecular markers related to semen quality traits helps to improve genetic selection and accelerate the genetic progress. Currently, there are still insufficient key genes that can be utilized and whose influence mechanisms on semen quality traits can be elucidated. Therefore, finding key molecular genetic markers that control porcine semen quality traits and using them in molecular marker-assisted breeding are of great significance for improving porcine semen quality traits and increasing economic benefits.

[0003] Guanine nucleotide-binding protein (GNAS), namely G protein. This locus has a highly complex imprinted expression pattern. G protein plays a transduction role in numerous signal pathways controlled by G protein-coupled receptors (GPCRs). It has been found that this gene encodes multiple transcript variants of different subtypes, and the alternative splicing of its downstream exons produces different forms of stimulatory G protein alpha subunits, which are key elements of the classical signal transduction pathway that links receptor-ligand interactions to adenylate cyclase and various cellular responses. This gene may be involved in processes such as cell proliferation, invasion, and migration by regulating multiple signal transduction pathways.

[0004] Research shows that alcohol and nicotine exposure may be related to the methylation levels of MEST and GNAS, which change the quality of sperm cells. There is also research indicating that DNA methylation may cause a decrease in boar semen quality by altering the gene expression of the GNAS locus.

[0005] However, the specific molecular mechanism of how the GNAS gene affects boar semen quality has not been reported. Summary of the Invention

[0006] The object of the present invention is to overcome the deficiencies in the above-mentioned prior art, and provide an SNP molecular marker, a primer pair and their applications related to the porcine semen quality trait gene GNAS. The present invention discovers an SNP in intron 2 of the GNAS gene (ensemble number: ENSSSCT00000033038.4) that is associated with porcine semen quality traits, which can be used as a molecular marker for screening porcine semen quality traits and pig breeding.

[0007] In the first aspect, the present invention provides an SNP molecular marker related to the porcine semen quality trait gene GNAS, where the porcine semen quality traits are semen volume, sperm density, effective sperm density, forward motility, sperm malformation rate and sperm motility traits; the molecular marker is located in intron 2 of the porcine GNAS gene (ensemble number: ENSSSCT00000033038.4), and its nucleotide sequence is as shown in SEQ ID NO.1 in the sequence listing, and there is a G.277G>A base mutation at the 277th bp of this sequence.

[0008] Furthermore, the A or G base polymorphism site at the 277th bp in SEQ ID NO.1 shows three genotypes: AA, AG or GG, and the G allele is the dominant allele.

[0009] In the second aspect, the present invention provides an application of the SNP molecular marker as described in the first aspect in screening porcine semen quality traits and / or pig breeding.

[0010] In the third aspect, the present invention provides a primer pair for amplifying the molecular marker as described in the first aspect, and the primer pair includes: the nucleotide sequence of the upstream primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the downstream primer is as shown in SEQ ID NO.3.

[0011] In the fourth aspect, the present invention provides an application of the primer pair as described in the third aspect in screening porcine semen quality traits and / or pig breeding.

[0012] In the fifth aspect, the present invention provides a kit for rapid pig breeding using the SNP molecular marker as described in the first aspect, which contains the primer pair as described in the third aspect.

[0013] In the sixth aspect, the present invention provides a method for screening porcine semen quality traits and / or pig breeding, including the following steps:

[0014] S1. Extract the genomic DNA of pigs;

[0015] S2. Using the genomic DNA obtained in step S1 as a template, perform PCR amplification with the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purify it.

[0016] S3. Perform sequencing analysis on the molecular marker purified in step S2, retain the individuals carrying the G allele at the 277th bp of the sequence, and eliminate the individuals carrying the A allele.

[0017] Further, in step S1, genomic DNA is extracted from the ear edge tissue of the pigs to be tested.

[0018] Further, in step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng of genomic DNA, 25 μL of PCRmix, 1 μL of each of the above upstream and downstream primers, and ddH2O is added to make up the total volume to 50 μL; the PCR running program is: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; preservation at 4°C.

[0019] Compared with the prior art, the beneficial effects of the present invention include: the present invention has first discovered that an SNP molecular marker in the pig GNAS gene is related to the semen quality traits of pigs, specifically semen volume, sperm density, effective sperm density, forward motility, sperm malformation rate, and sperm motility traits. Therefore, this molecular marker can be used for screening pig semen quality traits and breeding, that is, it provides a new use of an SNP molecular marker in the pig GNAS gene in marker-assisted breeding of pig semen quality traits, realizes the early screening of pig semen quality traits, and the screening method is simple and fast. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the agarose gel electrophoresis detection diagram of the PCR product in Example 1 of the present invention, where lane M is DL1000Marker, and lanes 1-5 are the amplification fragments in pigs, and the fragment size is 277 bp;

[0021] Figure 2 It is the sequencing map of the g.277G>A locus in Example 1 of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0022] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0023] Example 1 Obtaining of SNP detection fragment of pig GNAS gene and establishment of polymorphism site detection method

[0024] 1. Extraction of Porcine Genomic DNA

[0025] The experimental pig breed in this application is Large White pigs, and the samples are from Aonong Group. The extraction of porcine genomic DNA uses the Animal Tissue Genomic DNA Extraction Kit (PureLink TM Pro 96 Genomic DNA Purification Kit, K182104A) produced by Invitrogen Corporation, and the extraction of porcine genomic DNA is carried out according to the instructions of this kit. The extracted DNA is detected for concentration and quality, and stored at -20°C for later use.

[0026] 2. Obtaining of SNP Genetic Marker Detection Fragments of Porcine GNAS Gene

[0027] (1) PCR Amplification

[0028] According to the SNP genetic marker detection sequence in the genomic sequence of the porcine GNAS gene, a pair of primers is designed to amplify the fragment of the polymorphic site.

[0029] Among them, the nucleotide sequence of this SNP genetic marker detection sequence is:

[0030] GTGGGTCACCTCTTAGGCATCTGAGGGGACAGGCCTGTGCTCCAAGGGGTTGGGGGTGGGGGGCGGACGAAGGTACTGGGCCCTCTGGCTCTCCCTGCCGTGGCCGCGACTGGAGCGCGCTGCAGCGGGGCGGTGGGGACGGGGAGCAAGCCGGTCCTTACGGGCAGGTGCAGGGAAGGAGAGGCCTGCAGAGGGGAATCCGCCTGCCTCGGCCCTCCGCAGCGTCCTTGTCAGGCTCGGGACCGGGCAGGTGCCTGCAGCCATCTTAGAAGGGAGA, as shown in SEQ ID NO.1.

[0031] The designed primers are as follows:

[0032] Forward primer: 5'GTGGGTCACCTCTTAGGCA 3', as shown in SEQ ID NO.2.

[0033] Reverse primer: 5'TCTCCCTTCTAAGATGGCTGC 3', as shown in SEQ ID NO.3.

[0034] Genomic DNA was extracted from the ear edge tissue of the pigs to be tested as a template, and PCR amplification was carried out using the primers designed above. The PCR reaction system was 50 μL, and the components in the system were: 100 ng of genomic DNA, 25 μL of PCR mix, 1 μL of each of the upstream and downstream primers above, and ddH 2 O was added to make up the total volume to 50 μL.

[0035] The running program of PCR was: pre-denaturation at 94 °C for 3 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, for 35 cycles; extension at 72 °C for 10 min; preservation at 4 °C. The PCR products were detected by 1.0% agarose gel electrophoresis, and the detection results are as shown in the appendix Figure 1 where lane M was DL1000 Marker, and lanes 1-4 were the amplified fragments in pigs, and the size of the amplified fragment was 277 bp.

[0036] (2) Purification of PCR products

[0037] The above PCR amplification products were purified using the Gel Extraction Kit of Shanghai Sangon Biotech Co., Ltd., and the specific steps were shown in the kit instruction manual.

[0038] 3. Detection of molecular markers using the direct sequencing method of PCR products

[0039] The above obtained purified PCR products were directly sent to Beijing Aoke Company for sequencing, and the genotypes of this locus in the detection population were determined according to the sequencing results. Analysis was carried out using DNA Star software, and the results are as shown in the appendix Figure 2 It was found that there was an allelic gene mutation of G277–A277 at the 277th bp in the sequence shown in SEQ ID NO.1, that is, g.277G>A, and the above mutation caused the polymorphism of the GNAS gene.

[0040] Example 2 Detection of the polymorphism distribution of molecular markers in pigs

[0041] In this example, the polymorphism distribution law of the g.277G>A locus of the porcine GNAS gene was detected in 195 pigs with the trait of the number of piglets born in the first parity, and the detection results are shown in Table 1.

[0042] Table 1 Polymorphism distribution law of the g.277G>A locus of the GNAS gene

[0043]

[0044] It can be seen from the results in Table 1 that at the g.277G>A locus of the GNAS gene in pigs, there were three genotypes of AA, AG, and GG, among which the number of individuals with the GG genotype was relatively large, and the frequency of the G allele was 84.6%.

[0045] Example 3 Association Analysis of Molecular Markers with Porcine Semen Quality Traits

[0046] To determine whether the g.277G>A locus of the porcine GNAS gene is associated with differences in porcine semen quality traits, polymorphism detection was performed using the method established in Example 1, and the correlations between different genotypes of this polymorphic locus and semen volume, sperm density, effective sperm density, progressive motility, sperm abnormality rate, and sperm viability traits were analyzed. The GLM procedure of SAS statistical software (SAS Institute Inc, Version 9.1) was used for variance analysis of different SNP genotype combinations, and significance tests were performed. The model used was:

[0047] Y ij = μ + G i + F j + e ijk ;

[0048] Y ij is the trait phenotypic value, μ is the mean value, G i is the genotype effect (including gene additive effect and dominance effect); F j is the comprehensive effect of the pig farm; e ijk is the residual effect.

[0049] Association analysis between different genotypes and semen quality traits was performed in pigs. The statistical analysis results are shown in Table 2:

[0050] Table 2 Association Analysis of the g.277G>A Locus of the GNAS Gene with Porcine Semen Quality Traits

[0051]

[0052]

[0053] Note: The trait means in the table are composed of mean ± standard deviation. Different A and B indicate significant differences (P<0.05), * indicates significant differences (P<0.05), and ** indicates extremely significant differences (P<0.01)

[0054] Regarding the relationship between semen quality traits, the GLM procedure of SAS software was used to perform association analysis on the detection population, and the results are shown in Table 2. In this population, individuals with the AA genotype at the g.277G>A locus of the GNAS gene had lower semen volume, sperm density, effective sperm density, progressive motility, and sperm viability traits and higher sperm abnormality rates compared to individuals with the AG and GG genotypes, and the effective sperm density, progressive motility, and sperm viability traits were all significant (P<0.05); the additive effect of the progressive motility trait was extremely significant (P<0.01).

[0055] Application of SNP Molecular Marker of GNAS Gene in Screening of Porcine Semen Quality Traits and / or Porcine Breeding

[0056] The SNP molecular marker g.277G>A locus on the intron of the GNAS gene is significantly correlated with porcine semen quality traits, and the traits of effective sperm density, progressive motility and sperm motility are all significant (P<0.05); the additive effect of the progressive motility trait is extremely significant (P<0.01). Therefore, in the process of breeding pigs, individuals with GG or AG genotypes with good semen quality performance can be assisted in selection through this SNP molecular marker. Individuals carrying this advantageous allele should be retained in breeding, and AA-type individuals should be eliminated, which is conducive to improving the production performance of the population.

[0057] The specific embodiments of the present invention described above do not constitute a limitation on the protection scope of the present invention. Any other corresponding changes and deformations made according to the technical concept of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker associated with the pig semen quality trait gene GNAS, characterized in that: The pig semen quality traits are semen volume, sperm density, effective sperm density, forward motility, sperm deformity rate and sperm motility; the molecular marker is located in the second intron of the pig GNAS gene, and its nucleotide sequence is shown in the sequence table SEQ ID NO.

1. There is a G.277G>A base mutation at the 277bp of the sequence.

2. The SNP molecular marker associated with the pig semen quality trait gene GNAS according to claim 1, characterized in that: The A or G base polymorphic site at the 277 bp in the sequence SEQ ID NO.1 exhibits three genotypes: AA, AG or GG, wherein the G allele is the dominant allele.

3. Use of the SNP molecular marker according to any one of claims 1 or 2 in screening of pig semen quality traits and / or pig breeding.

4. A primer pair for amplifying the molecular marker according to claim 1, characterized in that: The primer pair includes: the nucleotide sequence of the upstream primer is shown as SEQ ID NO.2, and the nucleotide sequence of the downstream primer is shown as SEQ ID NO.

3.

5. Use of the primer pair as claimed in claim 4 in screening of pig semen quality traits and / or pig breeding.

6. A kit for rapid pig breeding using the SNP molecular marker as claimed in claim 1, characterized in that: Comprising the primer pair as claimed in claim 4.

7. A method for screening pig semen quality traits and / or pig breeding, characterized in that: The following steps are involved: S1. Extract pig genomic DNA; S2, using the genomic DNA obtained in step S1 as a template, performing PCR amplification using the primer pair described in claim 4 to obtain the molecular marker described in claim 1 and purifying it; S3. Perform sequencing analysis on the molecular markers purified in step S2, retain the individuals carrying the G allele at the 277 bp of the sequence, and eliminate the individuals carrying the A allele.

8. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S1, genomic DNA is extracted from the ear margin tissue of the pig to be tested.

9. The method for screening pig semen quality traits and / or pig breeding according to claim 7, characterized in that: In step S2, the PCR reaction system is 50 μL, and the components in the system are: 100 ng genomic DNA, 25 μL PCR mix, 1 μL each of the upstream and downstream primers mentioned above, and ddH2O is added to make up the total volume to 50 μL; The PCR operation program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 10 min; and storage at 4°C.

Images