Actinidia kolomikta AkbHLH92 gene and application thereof

Abstract

The invention discloses an actinidia kolomikta AkbHLH92 gene and application thereof. The invention provides a polypeptide containing an amino acid sequence as shown in SEQ ID NO: 1. Experiments prove that the transcription factor can improve the cold resistance of plants. The invention provides gene resources for cold-resistant molecular breeding of kiwi fruits, and has important significance for enriching germplasm resources for kiwi fruit breeding in China.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, and in particular to an Actinidia kokum AkbHLH92 gene and application thereof. Background Art

[0002] Actinidia kolomikta, also known as dog date fruit and deep mountain wood sky, is a deciduous vine plant of the genus Actinidia in the family Actinidiaceae, with a narrow distribution range. Actinidia kolomikta has extremely high nutritional value and is a plant with both medicinal and edible properties. The fruit is sweet and sour and is rich in various amino acids, vitamins and a large number of active ingredients.

[0003] Basic helix-loop-helix (bHLH) transcription factors are widely present in eukaryotes and have a highly conserved domain. The domain consists of about 60 amino acids, including the HLH region at the C-terminus and the basic region at the N-terminus. The HLH region participates in the formation of homologous or heterologous dimers. The basic region generally binds to the E-box (CANNTG) and G-box (CACGTG) in the promoter region of the downstream target gene to regulate its expression. In animals, bHLH proteins are divided into 6 categories, namely AF groups, while in plants, the protein is divided into 32 subfamilies. The number of bHLH transcription factors in different plants is different, such as 128 in birch, 159 in tomato, and 124 in potato. Transcription factors have a wide range of regulatory effects and are switches for plants to respond to the external environment. Studying the function and regulatory mechanism of transcription factors is of great significance for discovering key regulatory genes. Summary of the invention

[0004] The present invention has discovered a gene with cold resistance function. Based on this discovery, the present invention proposes the following technical solution.

[0005] The present invention provides a polypeptide comprising an amino acid sequence shown in SEQ ID NO:1.

[0006] The present invention provides a polynucleotide molecule, which is a polynucleotide molecule encoding a polypeptide comprising the amino acid sequence shown in SEQ ID NO:1.

[0007] The cDNA sequence of the polynucleotide molecule is shown in SEQ ID NO:2.

[0008] The present invention provides a recombinant vector, a recombinant bacterium, a recombinant plant cell or a recombinant plant organ containing the polynucleotide molecule.

[0009] The present invention provides a method for enhancing the abiotic stress resistance performance of plants. By transferring the above-mentioned polynucleotide molecule into plants, compared with plants into which the polynucleotide is not transferred, the abiotic stress resistance performance of the plants into which the polynucleotide is transferred is enhanced.

[0010] The abiotic stress resistance is cold resistance.

[0011] The plant is a monocotyledonous plant or a dicotyledonous plant.

[0012] Preferably, the plant is a plant of the genus Actinidia, a plant of the genus Nicotiana or a plant of the genus Solanum.

[0013] More preferably, the plant is Actinidia kolomikta, Nicotiana tabacum or Solanum lycopersicum.

[0014] The polypeptide of the present invention should be understood as not only the polypeptide with the amino acid sequence shown in SEQ ID NO: 1, but also any polypeptide containing partial fragments in SEQ ID NO: 1. The partial fragments can be functional domains or structural domains in SEQ ID NO: 1, or other fragments. The structural domain can be the amino acids at positions 76-128 or 78-120 of SEQ ID NO: 1. This structural domain is an HLH structure, containing multiple DNA binding sites and polypeptide binding sites, and can form a dimer with other proteins to exert functions. The polypeptide of the present invention also includes polypeptides with the same cold resistance function and having a bHLH structural domain derived from plants within the same species or the same genus, and also includes polypeptides with various tags or various leader peptides added to the N-terminus or C-terminus of the polypeptide for purification, etc., and also includes polypeptides with basically the same cold resistance function after one or several amino acid mutations occur at non-functional sites. The non-functional sites can be the amino acids at positions 1-77 and 129-230 in SEQ ID NO: 1.

[0015] The polynucleotide molecule of the present invention should be understood as being able to be genomic DNA, genomic RNA, cDNA or mRNA.

[0016] The polynucleotide molecule of the present invention should also be understood as including a polynucleotide molecule connected with various regulatory elements.

[0017] The polynucleotide molecule of the present invention should also be understood as including a polynucleotide molecule modified according to codon degeneracy.

[0018] The polynucleotide molecule of the present invention should also be understood to include polynucleotide molecules having homologous sequences from the same species or the same genus, and such polynucleotide molecules have substantially the same cold resistance function. Generally, such polynucleotide molecules still have a bHLH domain.

[0019] The polynucleotide molecule of the present invention should also be understood to include polynucleotide molecules obtained after one or several or multiple base mutations in the non-domain region, and such polynucleotide molecules still have the same cold resistance function.

[0020] The recombinant vector of the present invention should be understood to include any vector containing any of the above polynucleotide molecules, such as plasmids, viruses, phages, etc.

[0021] The recombinant bacterium of the present invention should be understood to include any bacterium containing any of the above polynucleotide molecules, such as recombinant Escherichia coli, recombinant Agrobacterium used in the process of plant transformation, etc.

[0022] The recombinant plant cell of the present invention does not have the function of regenerating into a plant. The recombinant plant organ of the present invention does not have the function of regenerating into a plant.

[0023] Enhancing the abiotic stress resistance performance of plants can enable plants that do not originally have abiotic stress resistance to acquire abiotic stress resistance, or can further improve the abiotic stress resistance of plants that already have abiotic stress resistance.

[0024] "Transfer in" can be to introduce the polynucleotide molecule into the plant by existing methods, and the polynucleotide molecule may or may not be integrated into the plant genome in the plant.

[0025] After the said polynucleotide molecule is transferred into the plant, the above polypeptide is expressed in the plant.

[0026] The present invention has developed a bHLH transcription factor derived from Actinidia kolomikta. Experiments have proved that this transcription factor can improve the cold resistance performance of plants. The present invention provides gene resources for the cold-resistant molecular breeding of kiwifruit and is of great significance for enriching the germplasm resources of kiwifruit breeding in China. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the secondary structure of AkbHLH92 protein.

[0028] Figure 2 It is the tertiary structure of AkbHLH92 protein.

[0029] Figure 3 It is the interaction network of bHLH92 protein.

[0030] Figure 4 It is the phenotypic observation of transgenic tobacco after low temperature treatment.

[0031] Figure 5 For the growth status of seedlings of different tobacco lines under low temperature stress.

[0032] Figure 6 For the measurement results of the root lengths of seedlings of different tobacco lines.

[0033] Figure 7 For tomato plants with transient overexpression of AkbHLH92 under low temperature treatment.

[0034] Figure 8 For the results of the leaf damage rate of tomatoes.

[0035] Figure 9 For the phenotypic observation of different lines under low temperature treatment. Specific implementation manners

[0036] The following are some specific implementation manners of the present invention. The technical means or reagents used, unless otherwise specified, are all well-known conventional methods and reagents in the art. The pTRV2 vector was purchased from Wuhan Miaoling Biotechnology Co., Ltd., the pTRV1 vector was purchased from Wuhan Miaoling Biotechnology Co., Ltd., the pEGOEP-EGFP vector was purchased from Wuhan Aidi Jing Biotechnology Co., Ltd.; the pHK35S vector was purchased from Wuhan Boyuan Biotech Co., Ltd. The transformation bacteria used in the present invention are the well-known and commonly used Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 in the art.

[0037] Example 1 Discovery of genes

[0038] Actinidia kolomikta was obtained as a clone through tissue culture and stored in the tissue culture room of Mudanjiang Normal University (129.56E, 44.59N). The culture conditions were 26°C, the photoperiod was 16 h light / 8 h dark, and the light intensity was 1500 lx.

[0039] Based on the transcriptome data of Actinidia kolomikta (cultured at 25°C and treated at 4°C for 8 h and 24 h respectively), the local data was classified according to the annotation information in the transcriptome data, and 121 sequences containing bHLH annotation information were initially screened. After removing the genes without conserved domains, a total of 99 sequences were obtained. Taking the absolute value of the fold change (FC) ≥ 2 and the false discovery rate (FDR) < 0.05 as the reference basis, the expression levels of 40 genes showed varying degrees of changes after low-temperature treatment, and the remaining 59 genes had no significant changes. A heatmap was drawn using the Log2FC values of the FC values of the 40 genes responsive to low temperature. The results showed that genes c64922.graph-c0, c74532.graph-c0, and c72205.graph-c0 were significantly up-regulated after low-temperature treatment and had the highest expression levels at 24 h of treatment, indicating that these genes positively responded to low-temperature stress. Among them, the gene c64922.graph-c0 had the most obvious change trend. Compared with CK, it was up-regulated 5.67-fold at 8 h of treatment and 8.84-fold at 24 h of treatment. Through sequence alignment, c64922.graph-c0 was named AkbHLH92 and determined as the target gene for subsequent research.

[0040] The physicochemical properties of the AkbHLH92 protein were analyzed using Expacy, the hydrophilicity / hydrophobicity of the protein was analyzed using ProtScale, the transmembrane domain was analyzed using TMHMM-2.0, the subcellular localization was predicted using Cell-PLoc 2.0, the secondary structure was predicted using SOPMA (NPS@: SOPMA secondary structure prediction), and its secondary structure composition was analyzed. The three-dimensional protein structure model was constructed using SWISS-MODEL, the cis-acting elements of the promoter were predicted using PlantCARE, and the protein interaction network was predicted using String (STRING: functional protein association networks); after multiple sequence alignment using MEGA5.1, a phylogenetic evolutionary tree was constructed. The tree construction method was selected as the Maximum Likelihood method, and the verification parameters, namely the Bootstrap parameter values, were set to 1,000, Nearest-Neighbor-Interchange (NNI), and Make initial tree automatically (Default-NJ / BioNJ), respectively, and the remaining parameters were set to default values.

[0041] AkbHLH92 from Actinidia kolomikta contains a complete HLH conserved domain. The full length of the gene is 693 bp, and the protein is composed of 230 amino acids. Among them, the number of glutamic acid is the largest, and the number of glutamine is the smallest. The molecular formula is C1186H1898N340O349S11, the molecular weight is 26.856 kD, and the theoretical isoelectric point is 9.3, which is a basic protein. The total average hydrophilicity (GRAVY) is -0.650, showing hydrophilicity. Therefore, this protein is a basic, hydrophilic and unstable protein without transmembrane domain. AkbHLH92 identified in this study has an HLH structure in its conserved domain, lacks the basic region, and belongs to a class of atypical bHLH proteins. These bHLH transcription factors mainly form homodimers with other bHLH proteins to exert their functions. The results of protein interaction network prediction show that bHLH92 can interact with GLABRA, and GLABRA is classified as a member of the bHLH transcription factor family according to its conserved domain. Therefore, it is speculated that AkbHLH92 can form a homodimer with GLABRA to exert its functions.

[0042] The secondary structure of AkbHLH92 includes α-helix (61.3%), random coil (32.17%), extended strand (6.09%) and β-turn (0.43%). α-helix and random coil are the main components, making the secondary structure of the protein relatively stable. The proportion of β-sheet and extended strand in the protein secondary structure is relatively small. The alignment rate of the predicted model of the protein tertiary structure with the bHLH92 protein sequence in the database reaches 96.48%, which is credible. Moreover, the tertiary structure of the protein corresponds to the proportion of each component in the secondary structure, and the model construction effect is good. There is an obvious HLH structure in the protein model, and the positions of the C-terminus and N-terminus are clear ( Figure 1 and Figure 2 ).

[0043] Construct the interaction network of AkbHLH92 protein from Actinidia kolomikta by the String protein interaction database ( Figure 3 ). Taking Actinidia chinensis as the reference plant, select the sequence with a similarity of 96.1% for the construction of the interaction network. The results show that bHLH92 (CEY00_Acc13466) mainly interacts with proteins such as methyltransferase (CEY00_Acc13659), exocyst complex component (CEY00_Acc22693), large subunit of 3-isopropylmalate dehydratase (CEY00_Acc23823), transcription factor GLABRA (CEY00_Acc15676), etc.

[0044] PlantCARE was used to predict the cis-acting elements of AkbHLH92 gene. The results showed that the promoter sequence of AkbHLH92 contained stress resistance-related elements, including ABRE and TC-rich repeats, indicating that the AkbHLH92 gene played an important role in responding to abiotic stresses. The number of enhancer promoter (CAAT-box) elements and core promoter (TATA-box) elements was large, indicating that the gene had a strong expression potential. Not only are there some light-responsive elements, such as G-Box, chs-CMA2a and TCCC-motif, but also there are a variety of other functional elements, such as cis-acting regulatory elements (O2-site) involved in the regulation of zein metabolism, cis-acting elements (MSA-like) involved in cell cycle regulation, elements involved in palisade mesophyll cell differentiation (HD-Zip 1), enhancer-like elements (GC-motif) involved in hypoxia-specific induction, auxin-responsive elements (TGA-element and TGACG-motif) and cis-acting regulatory elements (CGTCA-motif) involved in jasmonic acid response.

[0045] Subcellular localization of AkbHLH92: One-month-old Nicotiana benthamiana was used as plant material, and the 4th to 6th leaves were selected as the main test sites; the empty pBI121-GFP and pBI121-AkbHLH92-GFP recombinant bacterial solutions were activated respectively, and a sterile syringe tip was used to gently scratch the back of the tobacco leaf to make a wound. The syringe without the needle was placed close to the wound and the bacterial solution was gently pushed to allow the bacterial solution to slowly distribute in the leaf. After culturing at room temperature and away from light for 12 hours, it was cultured normally for 72 hours, and the bacterial solution pBI121-GFP was used as a control; the lower epidermis of the tobacco leaf was torn off, placed on a slide and covered with a coverslip, and observed and recorded at 488nm using a fluorescence microscope. As a result, AkbHLH92 was localized in the chloroplast.

[0046] NCBI was used to design quantitative primers for AkbHLH92 gene, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and transcription elongation factor-1α (EF-1α) of Actinidia chinensis were used as reference genes. RT-qPCR was used to analyze the expression pattern of AkbHLH92 gene under different abiotic stresses.

[0047] Select Actinidia kolomikta seedlings with a plant height of 25 cm for waterlogging stress treatment. Add water to a depth of 5 cm above the soil surface. Take functional leaves for experiments at 0 h (control), 6 h, 12 h, 24 h, and 48 h respectively; select Actinidia kolomikta seedlings with a plant height of 15 cm, and take functional leaves for experiments after treating them with 200 mmol / L NaCl solution for 0 h (control), 12 h, 24 h, and 48 h respectively; select Actinidia kolomikta seedlings with a plant height of 15 cm, and collect functional leaves for subsequent experiments after treating them at 4°C for 0 h (control), 8 h, 24 h, and 48 h.

[0048] The AkbHLH92 gene is expressed in the roots, stems, and leaves of Actinidia kolomikta. Among them, the expression level is the highest in the stem, followed by the leaf, and the expression level is relatively low in the root, while the expression level in the fruit, female flower, and male flower is 0, indicating that AkbHLH92 may mainly play a role in vegetative organs.

[0049] Under waterlogging stress, the relative expression level of AkbHLH92 showed a trend of first increasing and then decreasing, reaching a peak at 12 h of treatment, which was 2.914 times that of the control group. At 6 h of treatment, it was 2.147 times that of the control. There was no significant difference compared with the control at 24 h and 48 h of treatment.

[0050] When Actinidia kolomikta was treated at 4°C, the expression level of AkbHLH92 showed an obvious upward trend. At 8 h, 24 h, and 48 h of treatment, the relative expression levels of AkbHLH92 were 2.3 times, 3.5 times, and 5.1 times that of the control respectively, indicating that AkbHLH92 actively responds to low-temperature stress, and the low-temperature tolerance of Actinidia kolomikta may be related to the increase in the expression level of AkbHLH92.

[0051] At 12 h, 24 h, and 48 h of salt treatment, the plant leaves of Actinidia kolomikta showed slight wilting compared with the control. The expression level of AkbHLH92 showed a downward trend. At 12 h, 24 h, and 48 h of treatment, the relative expression levels of AkbHLH92 were 0.35 times, 0.0079 times, and 0.023 times that of the control respectively. There was no significant difference between the relative expression levels at 24 h and 48 h.

[0052] Example 2: Obtaining of AkbHLH92 gene-transformed tobacco and its response to low temperature

[0053] Nicotiana benthamiana seeds were disinfected with 0.2% mercuric chloride for 2.5 min and then sown on 1 / 2 MS solid medium, and cultured at 26°C, with a 16 h light / 8 h dark cycle and a light intensity of 1500 lx.

[0054] Extract RNA from the leaves of Actinidia kolomikta, reverse transcribe it to obtain cDNA. Use the cDNA of Actinidia kolomikta as a template to amplify the AkbHLH92 gene. Ligate the recovered product of AkbHLH92 after PCR amplification with the linearized vector pHK35S. Transform the ligation product into competent cells of Escherichia coli DH5α. Randomly pick 1 single colony on the resistance screening plate for large-scale culture, perform plasmid extraction and PCR verification on it. Send the positive bacterial solution identified by colony PCR for sequencing, and the sequencing result is consistent with the transcriptome data result. Use the freeze-thaw method for Agrobacterium transformation and perform PCR identification. The constructed recombinant expression vector is denoted as pHK35S-AkbHLH92.

[0055] The primers for amplifying the AkbHLH92 gene include: forward primer (pHK35S-AkbHLH92-F) (5’-3’) CAGTGGTCTCACAACATGGAGGAGTTCTTCCGCTAC (SEQ ID NO:3); reverse primer (pHK35S-AkbHLH92-R) (5’-3’) CAGTGGTCTCATACATCAGATTTGGAAATGGAAATGAAGTTTC (SEQ ID NO:4)

[0056] Take the mature leaves of one-month-old sterile tobacco, cut them into pieces of 1 cm×1 cm size after removing the leaf margins and main veins. Infect the explants with the recombinant Agrobacterium, and then culture to obtain transgenic tobacco. Use the DNA of wild-type tobacco and the DNA of different transgenic tobacco lines as templates, and perform PCR amplification identification with pHK35S-AkbHLH92-F and pHK35S-AkbHLH92-R as primers.

[0057] After co-culture, after culturing in the screening medium for 20 days, adventitious buds are produced at the wounds of tobacco explants. Isolate the tobacco adventitious buds and culture them in the rooting medium to obtain tobacco plants, and a total of 9 transgenic tobacco lines are obtained.

[0058] Extraction and identification of transgenic tobacco DNA: Use a plant genomic DNA rapid extraction kit to extract transgenic tobacco DNA. Use the DNA of different tobacco lines as templates and perform PCR verification with the primers pHK35S-AkbHLH92-F and pHK35S-AkbHLH92-R. As a result, 8 out of the 9 tobacco lines screened by resistance have successfully transferred the AkbHLH92 gene. The 8 obtained transgenic tobacco lines are named OE-1 to OE-8 in sequence.

[0059] Analysis of the expression level of the AkbHLH92 gene in transgenic tobacco: Leaves of transgenic tobacco with consistent growth status were selected for RNA extraction. cDNA was obtained by reverse transcription. Using cDNA diluted to the same concentration as the template, semi-quantitative PCR was performed. The test results showed that the expression level of AkbHLH92 was relatively high in 5 out of 8 transgenic lines. OE-2, OE-7, and OE-8 were selected for plant phenotype observation and determination of physiological and biochemical indexes, and OE-1, OE-2, and OE-4 were selected for transgenic tobacco seedling experiments.

[0060] To further study the low-temperature response of AkbHLH92 overexpression transgenic lines (OE2, OE7, and OE8), wild-type tobacco and transgenic lines with consistent growth status were cultured in a low-temperature environment of 25 °C and 4 °C for 24 h respectively. The changes in the wild-type and the three overexpression lines under low-temperature stress were observed and photographed. Figure 4 As can be seen, there was no obvious difference between wild-type tobacco WT and transgenic lines under room temperature conditions. After 24 h of low-temperature culture, tobacco of different lines all showed a certain degree of wilting. Compared with transgenic tobacco, the leaves of wild-type tobacco drooped significantly and wilted more obviously.

[0061] Measurement of the stomatal aperture of transgenic tobacco under low-temperature stress: The results showed that the stomatal numbers of wild-type WT and transgenic tobacco lines were 42 ± 0.81, 40 ± 2.2, 41 ± 0.51, and 39 ± 1.4 per cm2 respectively. There was no significant difference in stomatal number among the lines, indicating that overexpression of AkbHLH92 from Actinidia kolomikta in tobacco did not cause changes in stomatal density. After treatment at 4 °C, the stomata of transgenic lines were significantly closed. The stomatal aperture of the wild-type line was 0.51 ± 0.092, and the stomatal apertures of transgenic lines were 0.26 ± 0.087, 0.23 ± 0.057, and 0.25 ± 0.064 respectively. The stomatal aperture of wild-type tobacco was significantly higher than that of transgenic lines.

[0062] Wild-type tobacco (WT) and transgenic tobacco OE-2, OE-7, and OE-8 with consistent growth status were selected and cultured at 25°C and 4°C for 24 h, respectively, and then various physiological and biochemical indexes were measured. Determination of relative conductivity: The relative conductivity of the three overexpression lines was significantly lower than that of the WT line, indicating that after low-temperature treatment, the cell membranes of the transgenic lines were less damaged, the degree of extracellular leakage of cell sap was lighter, and the conductivity was lower. Determination of malondialdehyde (MDA) content: The MDA content of the three overexpression lines was significantly lower than that of the WT line, indicating that the damage degree of transgenic tobacco was lighter and its low-temperature resistance was stronger. Determination of peroxidase (POD) activity: The POD activity of the three overexpression lines was significantly higher than that of the WT line, indicating that under low-temperature stress, the antioxidant ability of tobacco overexpressing the AkbHLH92 gene was higher and its low-temperature tolerance was stronger. Determination of proline (Pro) content: The proline content in the overexpression lines was significantly higher than that in the wild type. Determination of soluble sugar content: The soluble sugar content in the overexpression lines was significantly higher than that in the wild type. Determination of soluble protein content: The soluble protein content in the overexpression lines was higher than that in the wild-type line.

[0063] WT and three transgenic tobacco lines OE-2, OE-7, and OE-8 with consistent growth status in tissue culture bottles were selected and cultured at 25°C and 4°C for 72 h, respectively, and then DAB, NBT, and Evans blue staining were performed.

[0064] Results of DAB staining: Under the condition of 25°C, there was no obvious color precipitation in the leaves of the WT line and the three transgenic lines. After low-temperature treatment, the brown precipitation in the WT line was significantly more than that in the transgenic lines, indicating that more H2O2 was accumulated in the WT under low-temperature conditions.

[0065] Results of NBT staining showed that after low-temperature treatment, the degree of blue accumulation in the leaves of the WT was significantly deeper than that in the leaves of the transgenic lines, indicating that more ROS was accumulated in the WT under low-temperature conditions.

[0066] Results of Evans blue staining showed that under the condition of 25°C, there was no obvious color accumulation in the leaves of the WT and the three transgenic lines. After low-temperature treatment, the staining of the WT was significantly deeper than that of the transgenic lines, indicating that the number of dead cells in the WT line was more after low-temperature treatment.

[0067] Growth of transgenic tobacco seedlings under low-temperature stress: Tobacco seeds were cultured for 14 d under different treatment conditions, and the growth of seedlings of different lines was as follows Figure 5As shown in the figure. Under the condition of 25 °C, the seedlings of different strains could grow normally, and there was no obvious difference in the growth state of the seedlings. There was no significant difference in the root length of the seedlings between WT and each transgenic line, which were 2.53 ± 0.56 (WT), 2.68 ± 0.12 (OE-1), 2.72 ± 0.28 (OE-2) and 2.44 ± 0.20 cm (OE-4) respectively; Under the low temperature condition of 16 °C, the growth state of the transgenic line seedlings was better than that of WT, and the root lengths of the three transgenic line seedlings were significantly higher than that of WT( Figure 6 ), which were 1.01 ± 0.41 (OE-1), 1.01 ± 0.37 (OE-2), 0.97 ± 0.34 (OE-4) cm and 0.17 ± 0.044 (WT) cm respectively.

[0068] Analysis of the expression of key genes in the CBF pathway: Low temperature stress will affect the expression level of cold-regulated genes in plants, thereby affecting plant growth. The three AkbHLH92 gene overexpression lines and WT were treated with low temperature at 4 °C, and the expression levels of NtCBF1, NtCBF2 and downstream target genes NtCOR47 and NtICE1 in tobacco were analyzed. The results showed that after low temperature treatment, the relative expression level of NtCBF1 in wild-type tobacco increased by 23.82 times. The relative expression levels of NtCBF1 in the three transgenic lines increased by 35.97 (OE-2), 13.45 (OE-7) and 33.47 (OE-8) times respectively compared with those before treatment. The gene increase amounts were higher than that of WT, which were 33.28, 50.20 and 112.98 times that of WT before low temperature treatment respectively. After low temperature treatment, the relative expression level of NtCBF2 in wild-type tobacco decreased by 0.6 times compared with that before treatment. The relative expression levels of NtCBF2 in the three transgenic lines were all higher than those before treatment, which were 68.05 (OE-2), 190.94 (OE-7) and 66.59 (OE-8) times that before treatment respectively. The increase amounts were higher than that of WT, which were 1.34, 1.72 and 2.33 times that of WT before low temperature respectively. After low temperature treatment, the relative expression level of NtCOR47 in wild-type tobacco decreased by 0.57 times. The relative expression levels of NtCOR47 in the three transgenic lines were 1.82 (OE-2), 1.58 (OE-7) and 1.74 (OE-8) times that before treatment respectively, which were 0.27, 0.38 and 0.46 times that of WT before low temperature treatment respectively. Compared with WT after low temperature treatment, there was no significant difference in the relative expression level of NtCOR47. Under low temperature conditions, the relative expression level of NtICE1 in wild-type tobacco increased by 1.82 times. The relative expression levels of NtICE1 in the three transgenic lines were 0.99 (OE-2), 0.91 (OE-7) and 1.02 (OE-8) times that before treatment respectively, which were 1.65, 1.17 and 2.02 times that of WT before treatment respectively. Compared with WT after low temperature treatment, there was no significant difference in the relative expression level of NtICE1.

[0069] Example 3: Obtaining of AkbHLH92 Gene-Transiently Transformed Tomatoes and Their Response to Low Temperature

[0070] Micro Tom tomato seeds were provided by Wuhan Aidi Jing Co., Ltd. The seeds were soaked in water for 2 h and then sown in nutrient soil (vermiculite: peat soil = 1:1). The soil was kept moist, and the seeds were cultured at 26°C under a 16 h light / 8 h dark cycle with a light intensity of 10,000 lx. Tomato seedlings at the 5-leaf stage were used for the experiment.

[0071] According to the pEGOEP-EGFP vector sequence and the AkbHLH92 gene sequence, the enzyme BasⅠ was used to construct the expression vector. Primers for the AkbHLH92 gene with restriction enzyme sites were designed. Using the correctly sequenced recombinant plasmid pHK35S-AkbHLH92 as a template, AkbHLH92 was amplified by PCR.

[0072] The amplification primers were as follows: forward primer (pEGOEP-AkbHLH92-EGFP-F) (5'-3') ACTAGGGTCTCGGACCATGGAGGAGTTCTTCCGCTACGA (SEQ ID NO:5); reverse primer (pEGOEP-AkbHLH92-EGFP-R) (5'-3') ACTAGGGTCTCTCGCCGATTTGGAAATGGAAATGAAGTTTCCTCTCCAC (SEQ ID NO:6).

[0073] The gel-extracted product of the AkbHLH92 gene and the plasmid pEGOEP-EGFP were digested with BasⅠ according to their respective digestion systems. After digestion and purification, the AkbHLH92 gene and the pEGOEP-EGFP plasmid were ligated according to the ligation system of T4 DNA ligase. The ligation product was transformed into Escherichia coli competent cells. One single colony was randomly selected from the resistance screening plate for large-scale culture, and its plasmid was extracted and verified by PCR. The results showed that the selected single colony could amplify a PCR product with a single band and the correct size, indicating that the target gene had been ligated to the pEGOEP-EGFP overexpression vector. The resulting recombinant vector was designated as pEGOEP-AkbHLH92-EGFP. The positive bacterial solution after colony PCR identification was sent for sequencing, and the sequencing results were consistent with the transcriptome data. Then it was transformed into Agrobacterium.

[0074] Five-leaf tomatoes with the same growth status were used as the experimental materials to activate the empty pEGOEP-EGFP and pEGOEP-AkbHLH92-EGFP Agrobacterium suspensions respectively. The tip of a sterile syringe was used to lightly scratch the back of the tomato leaves to make a wound. The syringe without the needle was placed close to the wound and the bacterial suspension was gently pushed to allow the bacterial suspension to slowly distribute in the leaves. Four sites were injected on each leaf. The leaves were cultured in the dark at room temperature for 12 hours and then switched to light culture. The bacterial suspension pEGOEP-EGFP was used as the negative control, and the wild-type tomato was used as the blank control. 20 tomato plants were treated with each of the different bacterial suspensions.

[0075] PCR was performed using the cDNA of wild-type tomato WT as a template and pEGOEP-AkbHLH92-EGFP-F and pEGOEP-AkbHLH92-EGFP-R as primers. The results showed that the target band could not be amplified using WT cDNA as a template, indicating that the AkbHLH92 gene does not exist in wild-type tomato.

[0076] The results of semi-quantitative PCR showed that during the period of 1 to 7 days after switching to light culture, the expression level of AkbHLH92 gene showed a trend of first increasing and then stabilizing. After light-proof culture, the expression level of AkbHLH92 gene was low on the first day after switching to light culture, and the expression level of AkbHLH92 increased and was relatively stable from the 2nd to the 7th day. Therefore, low temperature treatment was chosen on the 2nd day after switching to light culture.

[0077] Phenotype of tomatoes transiently overexpressing AkbHLH92 under low temperature stress: Tomatoes at the 5-leaf stage with consistent growth status were selected as test materials, with wild-type tomatoes WT as blank control, tomatoes injected with empty vector (pEGOEP-EGFP) bacterial suspension as negative control, and tomatoes injected with engineered bacterial suspension (pEGOEP-AkbHLH92-EGFP) as test group. After injection, they were cultured in dark for 12 hours and then placed in a light environment for normal culture. On the second day of culture in a light environment, the plants were cultured at room temperature of 25°C and 0°C for 24 hours, and then the growth of the plants was observed. Then, the cultures were restored at 25°C for 5 days to observe the recovery of the tomatoes. Figure 7 It can be seen that there was no significant difference among WT, negative control and transgenic lines at 25°C. After 24 hours of low-temperature cultivation, the tomato leaves all showed obvious curling. After recovery cultivation at 25°C, it was found that most of the curled parts of the overexpressing tomato leaves were stretched out, and there was no obvious external injury on the leaf surface, while the curled parts of the WT and negative control leaves did not recover significantly, and the plants suffered obvious low-temperature damage.

[0078] Tomato leaf damage rate: After 5 days of recovery culture at 25℃, obvious leaf damage was observed in the wild type (WT) and negative control tomato leaves, while the curling of the transgenic tomato leaves was significantly alleviated, and the overall recovery momentum was good ( Figure 8)。The degree of leaf damage was significantly reduced compared to each control group. The leaf damage rate of wild-type tomatoes was 57.8%, and that of the negative control group was 52.7%. There was no significant difference in the leaf damage rate between the two. The leaf damage rate of transgenic tomatoes was 20.5%, showing significantly enhanced low-temperature tolerance compared to the control group. Leaf damage rate: number of damaged leaves / total number of leaves × 100%.

[0079] Select wild-type tomatoes (WT), negative controls, and experimental group tomatoes with consistent growth status, and perform DAB and NBT staining after culturing at 25°C and 0°C for 24 hours respectively. The DAB staining results showed that there was no obvious color precipitation in the leaves of WT, negative controls, and overexpressing tomatoes under the condition of 25°C. After low-temperature treatment, the brown precipitation in WT and negative controls was significantly more than that in overexpressing tomatoes, indicating that more H2O2 was accumulated in WT and negative controls under low-temperature conditions. The NBT staining results showed that there was no obvious color accumulation in the leaves of WT, negative controls, and overexpressing tomatoes under the condition of 25°C. After low-temperature treatment, the degree of blue accumulation in the leaves of WT and negative controls was significantly deeper than that in overexpressing tomato leaves, indicating that more ROS was accumulated in WT and negative controls under low-temperature conditions.

[0080] Select wild-type tomatoes (WT), negative controls, and overexpressing tomatoes with consistent growth status, and measure various physiological and biochemical indexes after culturing at 25°C and 0°C for 24 hours respectively.

[0081] After low-temperature treatment, the MDA contents of WT and negative controls were 1.18 ± 0.073 and 1.27 ± 0.010 nmol / mL respectively, while the MDA content of overexpressing tomatoes was 0.95 ± 0.024 nmol / mL, which was significantly lower than that of the control group, indicating that tomatoes with transient overexpression of the AkbHLH92 gene had less damage and stronger low-temperature resistance.

[0082] After low-temperature culture, the CAT enzyme activities in WT and negative controls were 7.21 ± 0.019 and 7.212 ± 0.034 μmol / g respectively, while the CAT content of overexpressing tomatoes was 9.55 ± 0.0078 μmol / g, which was significantly higher than that of the control group, indicating that tomatoes with transient overexpression of the AkbHLH92 gene could promote the hydrolysis of H2O2 at low temperature, thereby reducing the degree of plant damage.

[0083] After low-temperature culture, the SOD enzyme activities of WT and negative controls were 27.58 ± 0.87 and 30.62 ± 3.90 U / g respectively, while the SOD enzyme activity of overexpressing tomatoes was 80.58 ± 7.69 U / g, which was significantly higher than that of the control group, indicating that transient overexpression of the AkbHLH92 gene under low-temperature stress could improve the antioxidant capacity and low-temperature tolerance of tomatoes.

[0084] After low-temperature cultivation, the proline contents of WT and the negative control were 25.59 ± 2.31 and 27.11 ± 2.19 μg / mL, respectively, while the proline content of the overexpressing tomato was 34.84 ± 2.45 μg / mL, which was significantly higher than that of the control group.

[0085] After low-temperature cultivation, the soluble sugar contents of WT and the negative control were 0.20 ± 0.0034 and 0.20 ± 0.019 mg / mL, respectively, while the soluble sugar content of the overexpressing tomato was 0.27 ± 0.033 mg / mL, and its soluble sugar content was significantly higher than that of the control.

[0086] After low-temperature cultivation, the soluble protein contents of WT and the negative control were 1.13 ± 0.013 and 1.21 ± 0.035 mg / g, respectively, while the soluble protein content of the overexpressing tomato was 1.66 ± 0.024 mg / g, which was significantly higher than that of the control.

[0087] Example 4 Analysis of Cold Resistance of Plants with AkbHLH92 Gene Silenced by VIGS in Actinidia kolomikta

[0088] The test seedlings were all Actinidia kolomikta clones. The Actinidia kolomikta seedlings were transferred to nutrient soil (vermiculite: peat soil = 1:1, and the two were mixed with distilled water to a moist state), and cultured at 26 °C, 16 h light / 8 h dark, and a light intensity of 10,000 lx. When the Actinidia kolomikta grew to the 5-leaf stage, it was used for subsequent tests.

[0089] Based on the silencing vector pTRV2 sequence and the AkbHH92 gene silencing sequence, two single restriction enzyme sites XbaⅠ and BamHⅠ in the pTRV2 vector were selected for vector linearization. Specific primers pTRV2-AkbHLH92 were designed based on the principle of homologous recombination, that is, 15 bp vector sequences were added to the 5' ends of the upstream and downstream primers.

[0090] Upstream primer (pTRV2-AkbHLH92-F) (5'-3') AGAAGGCCTCCATGGGGATCCGCTACGATTCGCCGGAACATTTTTTC (SEQ ID NO:7)

[0091] Downstream primer (pTRV2-AkbHLH92-R) (5'-3') TGTCTTCGGGACATGCCCGGGTTATCACTCTTGGTACCAGGGGG (SEQ ID NO:8).

[0092] Using the correctly sequenced recombinant plasmid pHK35S-AkbHLH92 as a template and pTRV2-AkbHLH92-F and pTRV2-AkbHLH92-R as primers, the AkbHLH92 gene silencing region was amplified by PCR. The pTRV2 plasmid was double digested according to the Xba I and BamHⅠ digestion system. The AkbHLH92 gel recovery product after PCR amplification was ligated to the linearized pTRV2 plasmid vector by homologous recombination. The ligation product was transformed into Escherichia coli competent cells, and 1 single colony was randomly picked from the resistance screening plate for enlarged culture. Plasmid extraction and PCR verification were performed on it. As a result, the single colony picked could amplify a PCR product with a single band and the correct size, indicating that the target gene had been ligated to the pTRV2 silencing vector. The positive bacterial solution identified by colony PCR was sent for sequencing, and the sequencing result was consistent with the silencing fragment sequence. The Agrobacterium was transformed by the freeze-thaw method and identified by PCR.

[0093] Using Actinidia kolomikta at the 5-leaf stage with consistent growth status as the experimental material; pTRV1, pTRV2, and pTRV2-AkbHLH92 Agrobacterium suspensions were activated respectively, and the pTRV1 bacterial suspension was mixed with the bacterial suspensions pTRV2 and pTRV2-AkbHLH92 in equal volumes. The back of the Actinidia kolomikta leaves was gently scratched with the tip of a sterile syringe to create wounds, and the bacterial suspension was gently pushed after closely attaching the syringe without the needle to the wound, so that the bacterial suspension slowly distributed in the leaves. 4-6 sites were injected into each leaf. After culturing in the dark at 16℃ for 24 h, it was placed in a normal culture environment at 25℃. The wild-type Actinidia kolomikta (WT) was used as the blank control, and the mixed bacterial suspension of pTRV1 and pTRV2 was used as the negative control. There were 30 plants each for the blank control, negative control, and silenced plants.

[0094] The relative expression level of the AkbHLH92 gene in the Actinidia kolomikta silenced plants was measured after culturing in the dark at 16℃ for 24 h. Compared with the WT and negative control, the expression level of the AkbHLH92 gene in the silenced plants was significantly reduced. The expression levels of the AkbHLH92 gene in the negative control and silenced plants were 1.19 times and 0.25 times that of the WT, respectively.

[0095] The silenced plants after 24 h of light - avoidance culture were placed in normal culture at 25°C, and the expression levels of the AkbHLH92 gene were measured at 0, 1, 2, 4, 6, 8, and 10 d of recovery culture. The experimental results showed that the expression level of the AkbHLH92 gene in the silenced plants showed a trend of first increasing and then decreasing. It showed an upward trend from 1 to 2 d of recovery culture and reached a peak at 2 d, which was 3.04 times and 7.82 times that of the 0 d, respectively. Subsequently, the expression level of the AkbHLH92 gene decreased. At 4, 6, 8, and 10 d, the expression levels of the AkbHLH92 gene were 1.00 times, 0.88 times, 2.52 times, and 1.86 times that of the 0 d, respectively. Therefore, the low - temperature experiment was started at 4 d of recovery culture at 25°C.

[0096] Phenotypes of AkbHLH92 - silenced lines under low - temperature stress: The WT, negative control, and silenced plants were placed in light - avoidance culture at 16°C for 24 h, and then transferred to a normal culture environment at 25°C. At 4 d of culture at 25°C, they were placed in a low - temperature environment at 0°C for 4 d, and then transferred to a 25°C environment for recovery culture to observe the growth of Actinidia kolomikta plants. The experimental results are shown in Figure 9 , under the condition of 25°C, the WT, negative control, and silenced plants could all grow normally, and there was no obvious difference among the plants. Under low - temperature conditions, the WT and negative control could still grow normally, and there was no obvious damage on the leaf surface, while the petioles of the silenced plants softened and drooped, and the leaves were significantly wilted. After placing the WT, negative control, and silenced plants after low - temperature treatment in a 25°C environment for 2 d of recovery culture, it was found that the WT and negative control could still grow normally, and there was no obvious damage on the leaf surface except at the injection position, while the leaves of the silenced plants were severely damaged, indicating that the silenced plants had enhanced sensitivity to low temperature compared with the control group.

[0097] Select wild - type Actinidia kolomikta WT, negative control, and silenced plants with consistent growth status, and place the leaves of Actinidia kolomikta before and after 0°C low - temperature treatment in DAB and Evans blue staining solutions for staining.

[0098] The results of DAB staining showed that the brown precipitate in the leaves of the silenced plants was significantly more than that of the control after low - temperature treatment, indicating that more H2O2 was accumulated in the silenced lines under low - temperature conditions.

[0099] The results of Evans blue staining showed that the degree of blue staining in the silenced plants was significantly deeper than that of the control after low - temperature treatment, indicating that the number of dead cells in the silenced plants was more after low - temperature treatment.

[0100] Select wild - type Actinidia kolomikta (WT), negative control, and silenced plants with consistent growth status, and measure various physiological and biochemical indexes after culture at 25°C and 0°C, respectively.

[0101] After low-temperature treatment, the relative conductivity of WT and the negative control were 11.75±0.032% and 0.80±0.87%, respectively, while that of the silenced lines was 43.91±0.20%, which was significantly higher than that of the control group, indicating that the damage degree of Actinidia kolomikta under low-temperature conditions was deepened after silencing the AkbHLH92 gene.

[0102] After low-temperature treatment, the MDA content of WT and the negative control were 0.65±0.021 and 0.65±0.012 nmol / mL, respectively, while that of the silenced lines was 0.77±0.064 nmol / mL, which was significantly higher than that of the control group, indicating that the damage degree of the silenced plants was more serious under low temperature after silencing AkbHLH92, and the low-temperature resistance was weakened.

[0103] After low-temperature treatment, the POD enzyme activities of WT and the negative control were 18.93±1.06 and 18.40±0.57 U / g, respectively, while that of the silenced plants was 9.93±0.86 U / g, which was significantly lower than that of the control group, indicating that the antioxidant capacity of the silenced plants under low-temperature stress was reduced and the low-temperature tolerance was weakened.

[0104] After low-temperature treatment, the SOD enzyme activities of WT and the negative control were 88.54±9.87 and 83.45±6.23 U / g, respectively, while that of the silenced plants was 56.60±9.03 U / g, and the SOD enzyme activity was significantly lower than that of the control group, indicating that the antioxidant capacity of the silenced plants under low-temperature stress was reduced.

[0105] After low-temperature treatment, the proline contents of the WT line and the negative control were 32.69±0.89 and 28.18±0.93 μg / mL, respectively, while that of the silenced lines was 24.93±1.48 μg / mL, which was significantly lower than that of the control.

[0106] After low-temperature treatment, the soluble sugar contents of the WT line and the negative control were 0.47±0.027 and 0.43±0.014 mg / mL, respectively, while that of the silenced plants was 0.23±0.0048 mg / mL, and its soluble sugar content was significantly decreased.

[0107] After low-temperature treatment, the soluble protein contents of WT and the negative control were 23.41±2.92 and 19.87±0.89 mg / g, respectively, while that of the silenced plants was 17.80±1.54 mg / g. The soluble sugar content in the silenced lines was lower than that of the control, indicating that virus-induced silencing of the AkbHLH92 gene could reduce the accumulation of proline, soluble sugar and soluble protein in Actinidia kolomikta, and thus enhance its sensitivity to low temperature.

Claims

A polypeptide comprising the amino acid sequence shown in SEQ ID NO:

1.

2. A polynucleotide molecule encoding the polypeptide according to claim 1.

3. The polynucleotide molecule according to claim 2, characterized in that The cDNA sequence of the polynucleotide molecule is shown in SEQ ID NO:

2.

4. A recombinant vector, recombinant bacteria, recombinant plant cell or recombinant plant organ containing the polynucleotide molecule according to claim 2 or 3.

5. A method for enhancing the resistance of plants to abiotic stress, comprising transferring the polynucleotide molecule according to claim 2 or 3 into a plant, wherein the resistance of the plant to abiotic stress is enhanced compared with a plant not transferred with the polynucleotide molecule.

6. The method according to claim 5, characterized in that: The resistance to abiotic stress is cold resistance.

7. The method according to claim 5 or 6, characterized in that: The plant is a monocotyledon or a dicotyledon.

8. The method according to any one of claims 5 to 7, characterized in that: The plant is an Actinidia plant, a Nicotiana plant or a Solanum plant.

9. The method according to claim 8, characterized in that: The plant is Actinidia kolomiti (Actinidiakolomikta), tobacco (Nicotiana tabacum) or tomato (Solanum lycopersicum).

Images