Application of corn ZmLOB gene in regulation and control of root development and low-phosphorus tolerance

Abstract

The invention discloses application of a corn ZmLOB gene in regulation and control of root development and low-phosphorus tolerance, and belongs to the technical field of plant genetic engineering, the corn ZmLOB gene is a ZmLOB gene which is based on homologous recombination and is connected with an expression vector with a 3 * Flag tag; the overexpression ZmLOB gene is constructed by being connected with an expression vector with a 3 * Flag tag, the overexpression ZmLOB gene can regulate root system development and increase the content of inorganic phosphorus in root systems, corn is endowed with low-phosphorus stress tolerance, and a theoretical basis is provided for efficient phosphorus absorption and utilization of corn and excavation of low-phosphorus-tolerant germplasm resources.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of the maize ZmLOB gene in regulating root development and low-phosphorus tolerance. Background Art

[0002] Maize is one of the important food crops. During its growth and development, it requires a large amount of the nutrient element phosphorus. However, most of the phosphorus in the soil exists in the form of inorganic insoluble state or organic state, making it difficult to be directly absorbed by maize. That is, the available phosphorus naturally supplied in the soil is difficult to meet the phosphorus demand of maize. Therefore, it is particularly important to study the adaptation mechanism of maize to low phosphorus, which can fundamentally solve the impact of low-phosphorus stress on maize growth.

[0003] The mechanisms of maize tolerance to low-phosphorus stress mainly include suitable root morphology and efficient phosphorus absorption. Among them, suitable root morphology means that maize changes its root morphology, including inhibiting the growth of the main root, promoting the formation of adventitious roots and lateral roots, increasing the length and density of root hairs, etc., to increase the contact area with the soil and adapt to low-phosphorus stress.

[0004] Currently, there is no research on regulating maize root development in response to low-phosphorus stress targeting the LOB gene.

[0005] In view of this, the application of the maize ZmLOB gene in regulating root development and low-phosphorus tolerance is designed to solve the above problems. Summary of the Invention

[0006] To solve the problems raised in the above background art, the present invention provides the application of the maize ZmLOB gene in regulating root development and low-phosphorus tolerance, which has the characteristics of endowing maize with low-phosphorus stress tolerance by constructing an overexpression ZmLOB gene to regulate root development and increase the inorganic phosphorus content in roots, and providing a theoretical basis for the efficient absorption and utilization of phosphorus by maize and the exploration of low-phosphorus tolerant germplasm resources.

[0007] To achieve the above object, the present invention provides the following technical solution: the application of the maize ZmLOB gene in regulating root development and low-phosphorus tolerance, wherein the maize ZmLOB gene is a ZmLOB gene connected to an expression vector with a 3×Flag tag based on homologous recombination.

[0008] Further, the ZmLOB gene is the ZmLOB gene with the gene number Zm00001d027678 published on the official website of MaizeGDB, and the sequence is SEQ ID NO:1.

[0009] Further, the specific steps of connecting the ZmLOB gene to an expression vector with a 3×Flag tag based on homologous recombination include:

[0010] Based on the whole-genome sequencing of maize published on the official website of MaizeGDB, the nucleotide sequence information of the ZmLOB gene with the gene ID Zm00001d027678 was obtained, which is SEQ ID NO:1;

[0011] Primers ZmLOB-F1 and ZmLOB-R1 were designed and used to amplify the coding region sequence of the ZmLOB gene. Among them, ZmLOB-F1 is SEQ ID NO:2, and ZmLOB-R1 is SEQ ID NO:3;

[0012] The complete coding region of the ZmLOB gene was ligated to an expression vector with a 3×Flag tag by homologous recombination method.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0014] In the present invention, an overexpressed ZmLOB gene was constructed by ligating it to an expression vector with a 3×Flag tag, which can regulate root development and increase the inorganic phosphorus content in roots, endowing maize with low-phosphorus stress tolerance, and providing a theoretical basis for the efficient absorption and utilization of phosphorus by maize and the exploration of low-phosphorus tolerance germplasm resources. Brief Description of the Drawings

[0015] Figure 1 It is a detection graph of the ZmLOB expression level and editing type of the present invention. Among them, A is the sequence alignment result between the knockout line and the wild type, B is the detection of the expression level of ZmLOB at the transcriptional level in the knockout line and the wild type, C is the detection of the expression level of ZmLOB at the transcriptional level in the overexpression line and the wild type, and D is the detection of the expression level at the translational level in the overexpression line;

[0016] Figure 2 It is a phenotypic identification graph of maize ZmLOB in response to low-phosphorus stress of the present invention. Among them, A is the photograph of the knockout, wild type, and overexpression lines after being cultured in normal nutrient solution and low-phosphorus nutrient solution for 21 days. High Pi is normal hydroponics, that is, the Pi concentration is 1 mM, and Low Pi is low-phosphorus stress hydroponics, that is, the Pi concentration is 1 μM, scale = 10 cm; B-H are the statistical analyses of 7 seedling-stage phenotypic traits and phosphorus content of the wild type, overexpression, and mutant under normal hydroponics and low-phosphorus stress conditions. There are 10 biological replicates for each material. Tips is the total number of root tips, Total Root Length is the total root length, SurfArea is the surface area, Root Weight is the fresh root weight, Shoot Weight is the fresh shoot weight, Pi content in Root is the phosphorus content in the root, Pi content in shoot is the phosphorus content in the shoot, *** means P<0.001, ** means P<0.01, * means P<0.05, and ns means P>0.05. Detailed implementation manners

[0017] The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0018] 1. Construction of maize gene ZmLOB overexpression and mutant lines:

[0019] Based on the maize whole-genome sequencing published on the official website of MaizeGDB, the nucleotide sequence information of the ZmLOB gene (gene number in maizegdb is Zm00001d027678) was obtained, which is SEQ ID NO:1;

[0020] The sequence of SEQ ID NO:1 is:

[0021]

[0022] Design primers ZmLOB-F1 and ZmLOB-R1, and amplify the coding region sequence of the ZmLOB gene. Among them, ZmLOB-F1 is SEQ ID NO:2, and ZmLOB-R1 is SEQ ID NO:3;

[0023] The sequence of SEQ ID NO:2 is: ATGGCTTCCTCCGGCAGC;

[0024] The sequence of SEQ ID NO:3 is: TCATCTCGTGTAGCTGCCTT;

[0025] Connect the complete coding region of the ZmLOB gene to an expression vector with a 3×Flag tag by homologous recombination;

[0026] Use the CRISPER / Cas9 technology to design the target sequence of the target gene. The target sequence is located in the exon region of the ZmLOB gene and is SEQ ID NO:4 and SEQ ID NO:5;

[0027] The sequence of SEQ ID NO:4 is: GTTCCTGCGGCGCAAGTGCGCGG;

[0028] The sequence of SEQ ID NO:5 is: GCAGTTCGCGGCCATCCACAAGG;

[0029] Connect the expression cassette with the target to the CRISPR / Cas9 backbone vector. Through the method of Agrobacterium-mediated transformation of maize immature embryos, infect the immature embryos of wild-type maize KN5585, use BASTA as the screening resistance, culture and obtain the T0 generation transgenic lines of the ZmLOB gene and obtain seeds;

[0030] 2. Detection of homozygous transgenic lines:

[0031] Plant the transgenic seeds in the field. At the five-leaf stage, take the leaves of the overexpression lines to extract RNA and total protein to detect the changes in the expression levels of ZmLOB at the transcriptional and translational levels;

[0032] Use the online tool Primer-BLAST on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to design the quantitative primers ZmLOB-F2 and ZmLOB-R2 for the ZmLOB gene. Among them, ZmLOB-F2 is SEQ ID NO:6, and ZmLOB-R2 is SEQ ID NO:7;

[0033] The sequence of SEQ ID NO:6 is: GCAGCAACAGGTGGCGAG;

[0034] The sequence of SEQ ID NO:7 is: TCTCGTGTAGCTGCCTTCCT;

[0035] Using the cDNA dilution obtained by reverse transcription of RNA extracted from the leaves of wild-type and each transgenic line as the template for qRT-PCR reaction, the 10 μL qRT-PCR reaction system and cycling parameters refer to the ChamQTM Universal qPCR MasterMix Vazyme kit instruction manual. Three technical replicates were designed for each sample and run on a Bio-Rad CFX96 quantitative PCR instrument. The internal reference gene is ZmGAPDH, and the primers are ZmGAPDH-F and ZmGAPDH-R. Among them, ZmGAPDH-F is SEQ ID NO:8, and ZmGAPDH-R is SEQ ID NO:9;

[0036] The sequence of SEQ ID NO:8 is: CCATCACTGCCACCCAGAAAAC;

[0037] The sequence of SEQ ID NO:9 is: AGGAACACGGAAGGACATACCAG;

[0038] The 2-ΔΔCT method was used to analyze the relative expression level of the ZmLOB gene;

[0039] Take the leaves of wild-type and positive overexpressing ZmLOB lines, grind them in liquid nitrogen, and add protein lysate (50 mM Tris PH7.5, 150 mM NaCl, 0.2% NP40, 0.1% Trixon X-100, 1 mM PSMF) to extract total protein, and use western blot to detect the change of ZmLOB protein level;

[0040] Compared with the wild-type, the RNA and protein levels of the positive overexpressing ZmLOB lines are respectively as Figure 1 shown in C and D, both are significantly increased, and two homozygous transgenic events with high expression, ZmLOB-OE#2 and ZmLOB-OE#7, were successfully identified;

[0041] Take the leaves of the mutant lines at the five-leaf stage to extract DNA and RNA, and detect the change of the expression level of ZmLOB transcription level under different editing types;

[0042] Primers ZmLOB-F3 and ZmLOB-R3 located near the target of the ZmLOB gene were designed to amplify the genomic DNA sequence near the gene target. Among them, ZmLOB-F3 is SEQ ID NO:10, and ZmLOB-R3 is SEQ ID NO:11;

[0043] The sequence of SEQ ID NO:10 is: TCTGCAAGTAGTAGCTGTAGC;

[0044] The sequence of SEQ ID NO:11 is: TCATCTCGTGTAGCTGCCTT;

[0045] Using the DNA of maize mutants and wild types as templates, PCR amplification was carried out with Novoprotein's 2×Rapid Taq Master Mix. Among them, the reaction system for PCR amplification was: 10 μL of 2×Rapid taq Master PCR mix, 0.5 μL of each upstream and downstream primer, 1 μL of DNA template, and 8 μL of double-distilled water was added to make up to 20 μL. The amplification program was: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 15 s, for a total of 39 cycles; incubation at 72°C for 5 min;

[0046] The amplified PCR products were electrophoresed on 1% agarose gel and sent to Sangon Biotech for sequencing;

[0047] The sequencing results of the mutants were compared with those of the wild type (KN5585), and two homozygous mutant materials with two different editing types were successfully identified, as Figure 1 shown in A below. The ZmLOB-KO#1 material was SEQ ID NO:12, and the editing type was a 17-bp deletion. The ZmLOB-KO#2 material was SEQ ID NO:13, and the editing type was a 68-bp deletion;

[0048] The sequence of SEQ ID NO:12 is as follows. Among them, the underlined part is the targeted site to be edited, and the dotted line indicates that 17 bases were deleted:

[0049]

[0050]

[0051] The sequence of SEQ ID NO:13 is as follows. Among them, the underlined part is the targeted site to be edited, and the dotted line indicates that 68 bases were deleted:

[0052]

[0053]

[0054] RNA was extracted from the leaves of these two homozygous mutant materials. The method for detecting the relative expression level of ZmLOB in the overexpression transgenic lines was the same. The relative expression levels of the ZmLOB gene in the wild type and mutants were compared, as Figure 1As shown in B, the transcriptional level of ZmLOB in the knockout line was significantly lower than that in the wild type;

[0055] 3. Identification of the root phenotypes and low-phosphorus tolerance of maize ZmLOB overexpression, knockout materials and wild type at the seedling stage

[0056] The T2-generation seeds of the harvested ZmLOB transgenic materials were germinated at 28 °C. Seeds with consistent germination rates were selected for hydroponic cultivation. Seeds with the same germination potential were wrapped with germination paper. Half of the overexpression, knockout, and wild-type seeds were separately placed in Hoagland nutrient solution with normal phosphorus supply and low phosphorus for cultivation. The nutrient solution was changed every three days, and the differences between the ZmLOB transgenic materials and the wild-type materials were observed. After 21 days of hydroponic treatment, photos were taken, the roots were scanned, and phenotypic data were measured. The results are as Figure 2 As shown in A, B, C, and D, under normal phosphorus supply, there were no significant differences in the root traits and phosphorus content between the transgenic ZmLOB maize materials and the wild type. After low-phosphorus stress, the root traits such as the number of root tips, total root length, and root surface area of ZmLOB-OE#2 and ZmLOB-OE#7 were significantly better than those of the wild type, while the knockout materials were significantly weaker than the wild type;

[0057] The fresh weights of the underground and aboveground parts of the knockout, wild-type, and overexpression lines were measured. The results are as Figure 2 As shown in E and F, the root weight and leaf weight of the ZmLOB overexpression lines were significantly higher than those of the wild type;

[0058] After the phenotypic determination, samples were taken to detect the phosphorus content of their underground and aboveground parts. The results are as Figure 2 As shown in G and H, in the roots, the phosphorus content of the overexpression lines was significantly higher than that of the wild type, and the phosphorus content of the knockout lines was significantly lower than that of the wild type. In the aboveground parts, there were no significant differences in the phosphorus content among the overexpression, wild-type, and knockout lines.

[0059] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. Application of maize ZmLOB gene in regulating root development and low phosphorus tolerance, characterized in that: The maize ZmLOB gene is a ZmLOB gene connected to an expression vector with a 3×Flag tag based on homologous recombination.

2. The use of the maize ZmLOB gene in regulating root development and low phosphorus tolerance according to claim 1, characterized in that: The ZmLOB gene is the ZmLOB gene with the gene number Zm00001d027678 published on the official website of MaizeGDB, and the sequence is SEQ ID NO:

1.

3. The use of the maize ZmLOB gene in regulating root development and low phosphorus tolerance according to claim 1, characterized in that: The specific steps of connecting the ZmLOB gene with the expression vector carrying the 3×Flag tag based on homologous recombination include: Based on the whole genome sequencing of maize published on the official website of MaizeGDB, the nucleotide sequence information of the ZmLOB gene with the gene number Zm00001d027678 was obtained, which is SEQ ID NO: 1; Design primers ZmLOB-F1 and ZmLOB-R1, and amplify the coding region sequence of ZmLOB gene, wherein ZmLOB-F1 is SEQ ID NO: 2, and ZmLOB-R1 is SEQ ID NO: 3; The complete coding region of ZmLOB gene was connected to the expression vector with 3×Flag tag by homologous recombination method.

Images