Application of β-glucosidase BnaBG27 in regulating 1000-grain weight of rapeseed

Abstract

The present invention discloses the use of β-glucosidase BnaBG27 in regulating rapeseed 1000-grain weight, belonging to the field of genetic engineering technology. The present invention isolates and obtains the BGLU27 gene from Brassica napus Westar and finds that the gene is highly expressed in rapeseed seeds. Experiments have shown for the first time that the BGLU27 gene positively regulates rapeseed 1000-grain weight. Utilizing this gene can increase rapeseed 1000-grain weight and obtain high-yield rapeseed germplasm. The present invention has very important application prospects in the selection and improvement of high-yield rapeseed varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to application of beta-glucosidase BnaBG27 in regulating the thousand-grain weight of rapeseed. Background Art

[0002] Rapeseed (Brassica napus L.) is not only an important source of edible vegetable oil and feed protein in China, but also a dual-purpose oil and vegetable crop, landscape crop, and renewable energy source. Thousand-grain weight, one of the three major factors contributing to rapeseed yield, plays a crucial role in determining final yield. Research indicates that heterosis for thousand-grain weight is weak, making it impractical to increase it through heterosis. However, aggregating different superior alleles can effectively increase thousand-grain weight, and thus yield. Therefore, identifying more thousand-grain weight genes and superior haplotypes will help improve rapeseed yield. Thousand-grain weight is a quantitative trait controlled by multiple genes. Currently, hundreds of QTLs for thousand-grain weight have been identified in rapeseed, but fewer than ten genes have been verified and cloned.

[0003] β-glucosidases in plants can be divided into the GH1, GH3, GH5, and GH16 glycoside hydrolase families. The GH1 family possesses the largest number of members. Currently, 48, 38, and 26 GH1 genes have been identified in Arabidopsis, rice, and maize, respectively. Multiple sequence alignments reveal that Arabidopsis GH1 proteins possess several conserved domains, such as RFSIWSRIFP and TF / LNEP, which play important roles in enzyme activity. β-glucosidases hydrolyze β-1,4-glycosidic bonds to release glucose and participate in various biological processes in plants, including cellulose degradation, cell wall modification, plant hormone activation, and stress response. Previous studies have investigated the functions and substrates of several GH1 genes. For example, Arabidopsis BGLU45 and BGLU46 hydrolyze lignin monomeric glycosides and participate in lignin synthesis. Arabidopsis BGLU28 and BGLU30 participate in glucosinolate metabolism, and double mutants exhibit significantly impaired plant growth. Arabidopsis and rice BGLU42 hydrolyzes oligosaccharides, with cellotriose being the optimal substrate. Overexpression of this gene significantly enhances plant resistance to pathogens, while mutants exhibit the opposite effect. AtBGLU1 hydrolyzes abscisic acid-glycosides and releases abscisic acid. Overexpression of this gene increases abscisic acid levels, while mutants exhibit decreased abscisic acid levels. While the functions of several GH1 genes have been studied, these studies have focused on a few subfamilies, leaving many more subfamilies with unknown functions and substrates.

[0004] A phylogenetic tree of the GH1 gene family in Arabidopsis thaliana reveals that BGLU27 is most closely related to BGLU26. BGLU26 is involved in glucosinolate metabolism, with its substrates being indole-3-methylglucosinolate (I3G) and 4-methoxyindole-3-methylglucosinolate (4MI3G). This gene is crucial for limiting infection by powdery mildew fungi. However, the metabolic pathways involved in BGLU27 and its substrates are still unknown. In summary, β-glucosidases are involved in multiple biological processes in plant growth and development, but no studies have shown that they affect grain weight. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of β-glucosidase BnaBG27 in regulating the thousand-grain weight of rapeseed to solve the problems existing in the above-mentioned prior art. The BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed seeds, has very important application prospects in the breeding and improvement of high-yield rapeseed varieties, and lays the foundation for obtaining high-yield rapeseed germplasm.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the use of the BnaBGLU27 gene in any of the following:

[0008] (1) Application in regulating rapeseed 1000-grain weight;

[0009] (2) Application in rapeseed breeding;

[0010] The nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2. However, the nucleotide sequence is not limited thereto, and may also be a nucleotide sequence obtained by substitution and / or deletion and / or addition of one or more nucleotide residues in any of the above nucleotide sequences.

[0011] The present invention also provides the use of the protein encoded by the BnaBGLU27 gene in any of the following:

[0012] (1) Application in regulating rapeseed 1000-grain weight;

[0013] (2) Application in rapeseed breeding;

[0014] The amino acid sequence of the protein is shown in SEQ ID NO: 3 or SEQ ID NO: 4. However, the protein sequence is not limited thereto, and may also be a derivative amino acid sequence having the same function as any of the above amino acid sequences by substitution and / or deletion and / or addition of one or more amino acid residues.

[0015] The present invention also provides use of a recombinant vector comprising the BnaBGLU27 gene in any of the following:

[0016] (1) Application in regulating rapeseed 1000-grain weight;

[0017] (2) Application in rapeseed breeding;

[0018] The recombinant vector is constructed by connecting the BnaBGLU27 gene and the expression vector, and the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0019] The present invention also provides the use of a host bacterium comprising the recombinant vector in any of the following:

[0020] (1) Application in regulating rapeseed 1000-grain weight;

[0021] (2) Application in rapeseed breeding.

[0022] Preferably, the BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed.

[0023] The present invention also provides a method for regulating the thousand-grain weight of rapeseed, comprising the step of introducing the BnaBGLU27 gene into rapeseed to regulate the thousand-grain weight of rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0024] Preferably, the BnaBGLU27 gene positively regulates the thousand-grain weight of rapeseed.

[0025] The present invention also provides a breeding method for increasing the thousand-grain weight of rapeseed, comprising the step of overexpressing the BnaBGLU27 gene in rapeseed to increase the thousand-grain weight of rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0026] The present invention also provides a method for cultivating transgenic rapeseed with high 1000-grain weight, comprising the step of overexpressing the BnaBGLU27 gene in rapeseed to obtain transgenic rapeseed with high 1000-grain weight; wherein the nucleotide sequence of the BnaBGLU27 gene is as shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0027] The present invention discloses the following technical effects:

[0028] This study first discovered that the BnaBGLU27 gene regulates rapeseed 1000-grain weight. Experiments revealed that the BnaBGLU27 gene positively regulates rapeseed 1000-grain weight. Therefore, utilizing this gene can increase rapeseed 1000-grain weight and produce high-yield rapeseed germplasm. This study holds great promise for the selection and improvement of high-yield rapeseed varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0030] Figure 1 is the expression pattern of BnaBGLU27;

[0031] Figure 2 The gene structure of BnaBGLU27 (A), the acquisition of double mutants (B), and DNA detection (C) and expression level detection (D) of overexpression-positive individual strains.

[0032] Figure 3 Statistical analysis results of thousand-grain weight of wild type, mutant and overexpression materials. DETAILED DESCRIPTION

[0033] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0034] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0035] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0036] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0037] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0038] Based on GWAS analysis of resequencing and phenotypic data from 505 rapeseed association populations collected by our research group, a significant QTL locus (unpublished) was detected on chromosome A09, replicated across three environments. To further screen candidate genes for the QTL interval, the machine learning-based POCKET algorithm was used to predict candidate genes for this interval, ultimately identifying BnaA09.BGLU27 as a candidate gene for this QTL interval.

[0039] The BnaBGLU27 gene, isolated from Brassica napus Westar, has one copy each on chromosomes A09 and C08, and two copies on chromosome C04: BnaA09.BGLU27 (BnaA09T0515300WE), BnaC08.BGLU27 (BnaC08T0342100WE), BnaC04.BGLU27-1 (BnaC04T0272200WE), and BnaC04.BGLU27-2 (BnaC04T0049800WE). Transcriptome analysis of rapeseed seeds showed that BnaA09.BGLU27 and BnaC08.BGLU27 were highly expressed in developing seeds, while BnaC04.BGLU27-1 and BnaC04.BGLU27-2 were essentially unexpressed in developing seeds. Figure 1 ), therefore, the inventors mainly focused on the two genes BnaA09.BGLU27 and BnaC08.BGLU27. The nucleotide sequences of these two genes are shown in the sequence listing SEQ ID NO:1 and SEQ ID NO:2, respectively, consisting of 1008 bp and 1620 bp; the protein sequences encoded by the genes are shown in the sequence listing SEQ ID NO:3 and SEQ ID NO:4, respectively, encoding 335 and 539 amino acids, respectively.

[0040] The nucleotide sequence of BnaA09.BGLU27 (A09, SEQ ID NO: 1) is:

[0041]

[0042] The nucleotide sequence of BnaC08.BGLU27 (C08, SEQ ID NO: 2) is:

[0043]

[0044] The amino acid sequence of BnaA09.BGLU27 (SEQ ID NO:3) is as follows:

[0045] MNEAAVAGQSGLEVYTVSHNLLLAHAEAVEVFRNNPKCKDGKIGIAHCPVWFEPYDSNCPDDKEACERAMEFMFGWHMDPTVYGDYPEVMKKSIGKRLPSFTAAQSKKLRGSFDFVGVNYYSAFYVKSIPEVDHNTPNWRSDARIEWRKQNKAGQTLGVRGGSEWDFLYPQGLRKFLNYAKNKYESPKFMITENGHCDMDYEKKPKLSNLMDLQRTEYHKKHLQSIQQAIQEDGVEVEGYFAWSLLDNCEWNAGYGVRYGLFYVDYNNGLKRFPKMSAMWFKEFLKREEEIEESEKEEYLLKPAMKKKRFLLATGSASCFIPKMSESSKALELFF。

[0046] The amino acid sequence of BnaC08.BGLU27 (SEQ ID NO:4) is as follows:

[0047] .

[0048] Example 1 Cloning of the rapeseed BnaA09.BGLU27 gene

[0049] The BGLU27 gene, encoding β-glucosidase, has four copies in rapeseed: one copy each on chromosomes A09 and C08, and two copies on chromosome C04. These copies are BnaA09.BGLU27 (BnaA09T0515300WE), BnaC08.BGLU27 (BnaC08T0342100WE), BnaC04.BGLU27-1 (BnaC04T0272200WE), and BnaC04.BGLU27-2 (BnaC04T0049800WE). The BnaA09.BGLU27 gene has a nucleotide sequence of 1008 bp and encodes 335 amino acids, as shown in SEQ ID NO:1.

[0050] (1) RNA extraction

[0051] Total RNA was extracted using TansZol (catalog number ET101) from Quanshijin. 20-day-after-flowering (DAF) seeds of Brassica napus were ground in liquid nitrogen. 100 mg of the ground sample was transferred to a 1.5-mL centrifuge tube, and 1 mL of TransZol was added. The tube was vigorously inverted several times to mix thoroughly and allowed to stand at room temperature for 5 minutes. 0.2 mL of chloroform was added, the tube was vigorously shaken for 15 seconds, and the tube was incubated at room temperature for 3 minutes. The tube was centrifuged at 10,000 × g for 15 minutes at 4°C. At this point, the sample separated into three layers: a colorless aqueous phase (upper layer), a middle layer, and a pink organic phase (lower layer). The colorless aqueous phase was transferred to a new centrifuge tube, 0.5 mL of isopropanol was added, the tube was inverted to mix thoroughly, and the tube was incubated at room temperature for 10 minutes. The tube was centrifuged at 10,000 × g for 10 minutes at 4°C. The supernatant was removed, and a gelatinous precipitate formed on the sides and bottom of the tube. 1 mL of 75% ethanol (prepared with DEPC-treated water) was added and the tube was vortexed vigorously. The tube was centrifuged at 7,500 × g for 10 minutes. Centrifuge at 4°C for 5 minutes; discard the supernatant and air-dry the pellet at room temperature. Dissolve the pellet in 50-100 μL of RNA dissolution buffer and incubate at 55°C for 10 minutes. Determine the RNA concentration using a Nanodrop analyzer. Assess RNA purity by OD260 / OD280 of 1.8 < 2.0. Also, perform electrophoresis on 1% agrose gel to check RNA integrity.

[0052] (2) cDNA synthesis

[0053] Reverse transcription was performed using the All-Gold EasyScript® One-Step gDNA Removal and cDNA Synthesis SuperMix (Catalog No. AE311). Using 1 μg of total RNA as template, 1 μL of Anchored Oligo (dT)18 Primer, 10 μL of 2× ES Reaction Mix, 1 μL of EasyScript® RT / RI Enzyme Mix, and 1 μL of gDNA Remover were added, followed by RNase-free water to 20 μL. The system was gently mixed and incubated at 42°C for 30 minutes to synthesize first-strand cDNA and remove gDNA. The EasyScript® RT / RI and gDNA Remover were inactivated by heating at 85°C for 5 seconds. The synthesized cDNA was dissolved in 180 μL of RNase-free water and set aside.

[0054] (3) Amplification of the BnaA09.BGLU27 gene

[0055] The above cDNA was used as template and the forward primer sequence was BnaA09.BGLU27-pCAMBIA2306-F (SEQ ID NO: 5): 5'-ACGGGGGACGAGCTCGGTACC ATGAATGAAGCAGCGGTGG -3', the reverse primer sequence is BnaA09.BGLU27-pCAMBIA2306-R (SEQ ID NO: 6): 5'-TTGGTCGACTCTAGAGGATCC GAAAAATAGTT CTAGAGCCTTAGATGAT -3', amplifying the full-length CDS fragment of BnaA09.BGLU27 (with the stop codon removed). PCR amplification was performed using I-5™ 2× High-Fidelity Master Mix (TSINGKE Biologica technology). The PCR amplification system was as follows: 2×I-5™ 2× High-Fidelity Master Mix 25 μL, BnaA09.BGLU27-pCAMBIA2306-F (10 μmoL / L) 2.5 μL, BnaA09.BGLU27-pCAMBIA2306-R (10 μmoL / L) 2.5 μL, cDNA 3 μL, and ddH2O 17 μL.

[0056] PCR amplification program: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 1 min, 34 circles; total extension at 72°C for 5 min.

[0057] The amplified product was detected by agarose gel electrophoresis, and the full-length CDS sequence of BnaA09.BGLU27 of 1005 bp was amplified. The product was recovered using the Tiangen Agarose Gel Recovery Kit ( http: / / www.tiangen.com / )Recycle.

[0058] Example 2 Construction of BnaA09.BGLU27 gene overexpression transformation vector

[0059] (1) Double digest the vector pCAMBIA2306 with the fast restriction endonucleases Kpn I and Bam HI. The double digestion system is as follows: 10 μL of 5×Fast digestion buffer, 1 μL of Kpn I, 1 μL of Bam HI, 20 μL of recovered product / plasmid, and 18 μL of ddH2O.

[0060] The enzyme digestion reaction was carried out in a 37°C water bath for 3 hours, and the digestion product was recovered using the Tiangen DNA purification kit.

[0061] (2) The gene CDS fragment was ligated into the vector 35S-pCAMBIA2306, which contains a constitutive expression promoter and an antibiotic marker.

[0062] Ligation reaction system: 6 μL of BnaA09.BGLU27 amplified fragment, 1 μL of fragment recovered after vector digestion, 1 μL of Exnase II (Vazyme), and 2 μL of 5×CE II buffer.

[0063] Ligation reaction conditions: 37°C for 30 min.

[0064] (3) Transformation into E. coli DH5α:

[0065] Pipette 10 µL of the ligation product into 50 µL of DH5α competent cells, pipette and mix thoroughly, and place on ice for 30 minutes. Incubate in a 42°C water bath for 1.5 minutes, then place on ice for 3 minutes. Add 400 µL of antibiotic-free liquid LB medium and activate the cells at 37°C, shaking at 150 rpm for 45-60 minutes. Spread 200 µL of the activated culture onto solid LB medium containing the appropriate resistance and incubate at 37°C for 12-16 hours. Positive clones were screened and the plasmids were digested and identified by enzyme digestion. Three positive clones were selected and sequenced. Analysis revealed that the CDS sequence of the BnaA09.BGLU27 gene was successfully ligated into the vector, indicating the successful construction of the plant expression vector 35S-pCAMBIA2306-BnaA09.BGLU27 for transformation.

[0066] (4) Introduce the correctly constructed recombinant plasmid vector into Agrobacterium strain GV3101, select positive single clones and store them in a -80℃ refrigerator. The introduction method is as follows:

[0067] a. Clean the cuvette: First, rinse with pure water, then with ultrapure water, discard, and then rinse with anhydrous ethanol (using a 1 mL pipette tip). Discard the anhydrous ethanol and place on a clean bench to dry.

[0068] b. Take 50 μL of competent Agrobacterium GV3101;

[0069] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent medium. Mix thoroughly by gently pipetting to avoid creating bubbles.

[0070] d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture against the wall of the cup;

[0071] e. Adjust the electroporator to 1800 V;

[0072] f. Remove the electroporation cup from the ice and wipe the outer wall of the electroporation cup with absorbent paper;

[0073] g. Place the rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, the process is successful.

[0074] h. After successful electroporation, add 400 μL of antibody-free LB to the cuvette, pipette to mix, and transfer to a sterile centrifuge tube.

[0075] i. Activate at 28°C for approximately 1 hour. Apply 100 μL of the solution to a plate containing the corresponding resistance. Seal with sealing film and incubate upside down at 28°C for 2 days. Perform spot detection.

[0076] (5) Agrobacterium colony detection

[0077] Select colonies and culture them in double-antibody LB medium at 28°C for 1 hour. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0078] Example 3 Construction of BnaBGLU27-CRISPR vector

[0079] The rapeseed BnaBGLU27 mutant was created using the sgRNA-Cas9 system developed by Qijun Chen's team at the College of Life Sciences, China Agricultural University. The experimental steps are as follows:

[0080] (1) Target screening

[0081] Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / and screen the target sites sgRNA1 (SEQ ID NO:7): GTATTGCGCATTGTCCCGTG and sgRNA2 (SEQ ID NO:8): AGAAGCATGTGAACGAGCCA, located in the second and seventh exons of genes BnaA09.BGLU27 and BnaC08.BGLU27, respectively. BnaA04.BGLU27 and BnaC04.BGLU27 differ from both target sites at different bases. Therefore, sgRNA1 and sgRNA2 only target BnaA09.BGLU27 and BnaC08.BGLU27, which are highly expressed in developing seeds.

[0082] (2) Primer design

[0083] DT1-BsF (SEQ ID NO:9): 5'-ATATATGGTCTCGATTG GTATTGCGCATTGTCCCGTG GTT-3';

[0084] DT1-F0 (SEQ ID NO: 10): 5'-TG GTATTGCGCATTGTCCCGTGGTTTTAGAGCTAGAAATAGC-3';

[0085] DT2-R0 (SEQ ID NO: 11): 5'-AAC TGGCTCGTTCACATGCTTCT CAATCTCTTAGTCGACTCTAC-3';

[0086] DT2-BsR (SEQ ID NO:12): 5'-ATTATTGGTCTCGAAAC TGGCTCGTTCACATGCTTCT CAA-3'.

[0087] (3) PCR amplification

[0088] Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as the template. DT1-BsF and DT2-BsR were at normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20-fold.

[0089] The amplification system was as follows: 2×I-5™ 2×High-Fidelity Master Mix 25 μL, DT1-BsF (10 μmol / L) 2 μL, DT2-BsR (10 μmol / L) 2 μL, DT1-F (0.5 μmol / L) 2 μL, DT2-R0 (0.5 μmol / L) 2 μL, pCBC-DT1T2 plasmid 3 μL, and ddH2O 14 μL.

[0090] PCR amplification program: pre-denaturation at 94°C for 2 min; denaturation at 98°C for 15 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, 34 circles; total extension at 68°C for 5 min.

[0091] (4) Purify and recover PCR products and construct recombinant expression vectors

[0092] The PCR product was purified and recovered, and the following restriction-ligation system was established: 2 μL of PCR fragment, 2 μL of pKSE401, 1.5 μL of 10×NEB T4 Buffer, 1.5 μL of 10×BSA solution, 1 μL of BsaI (NEB), 1 μL of T4 ligase (NEB), and 6 μL of ddH2O.

[0093] Reaction conditions: 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min.

[0094] (5) Transformation of Escherichia coli DH5α

[0095] Take 5 μL of competent E. coli, screen on a Kan plate, identify positive clones by PCR, and sequence. The vector that is sequenced correctly is the CRISPR vector for BnaBGLU27.

[0096] The primers for PCR identification of positive clones are:

[0097] U626-IDF (SEQ ID NO:13): 5'-TGTCCCAGGATTAGAATGATTAGGC-3' and U629-IDR (SEQ ID NO:14): 5'-GTCAGGCTGCAGTAGTTTCCATTAA-3'.

[0098] The PCR reaction system was: 2×I-5™ 2×High-Fidelity Master Mix 10 μL, U626-IDF (10 μmoL / L) 0.4 μL, U629-IDR (10 μmoL / L) 0.4 μL, cDNA 2 μL, and ddH2O 7.2 μL.

[0099] The PCR reaction program was as follows: total denaturation at 98°C for 1 min; denaturation at 98°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 30 sec, 32 circles; total extension at 72°C for 5 min.

[0100] (6) Transformation of Agrobacterium GV3101

[0101] The correctly constructed recombinant plasmid vector was introduced into Agrobacterium tumefaciens strain GV3101, and positive single clones were selected and stored in a -80°C refrigerator. The introduction method is as follows:

[0102] a. Clean the cuvette: First, rinse with pure water, then with ultrapure water, discard, and then rinse with anhydrous ethanol (using a 1 mL pipette tip). Discard the anhydrous ethanol and place on a clean bench to dry.

[0103] b. Take 50 μL of competent Agrobacterium GV3101;

[0104] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent cells. Mix thoroughly by gently pipetting to avoid creating bubbles.

[0105] d. Place the washed and dried electric rotating cup in ice to pre-cool, and then pour the above mixture against the wall of the cup;

[0106] e. Adjust the electroporator to 1800 V;

[0107] f. Remove the electroporation cup from the ice and wipe the outer wall of the electroporation cup with absorbent paper;

[0108] g. Place the rotating cup into the instrument and press the "push" button twice in succession. If you hear a "beep" sound after a few seconds, the process is successful.

[0109] h. After successful electroporation, add 400 μL of antibiotic-free LB medium to the cuvette, pipette a few times, and transfer to a sterile centrifuge tube.

[0110] i. Activate at 28°C for approximately 2 hours. Apply 100 μL of the solution to a solid LB plate containing double-antibody antibodies. Seal with sealing film and incubate upside down at 28°C for 2 days. Perform spot detection.

[0111] (7) Agrobacterium colony detection

[0112] Select colonies and culture them in double-antibody LB culture medium at 28°C for 2 hours. Take an appropriate amount of bacterial solution for PCR detection and save the positive Agrobacterium bacterial solution.

[0113] Example 4 Genetic transformation experiment

[0114] (1) Genetic transformation of rapeseed

[0115] The constructed BnaA09.BGLU27 overexpression vector and BnaBGLU27-CRISPR vector were used to genetically transform rapeseed using Agrobacterium-mediated genetic transformation. The recipient plant used for the transformation was Brassica napus (Westar). The detailed procedure is described in the reference: An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus.

[0116] (2) Identification of CRISPR-transformed strains

[0117] The obtained CRISPR-transformed rapeseed plants were sequenced to screen for rapeseed mutants. The Cas9 protein was first identified using primers Cas9-570-F (5'-AGACCGTGAAGGTTGTGGAC-3', SEQ ID NO: 15) and Cas9-570-R (5'-TAGTGATCTGCCGTGTCTCG-3', SEQ ID NO: 16). For Cas9 protein-positive plants, the target gene was specifically amplified and sequenced. The method for specific amplification of the target gene is as follows: primers BGLU27(A09)-CRISPR-F (5'-CTGGACGTGCCTCCAAGTA-3', SEQ ID NO: 17) and BGLU27(A09)-CRISPR-R (5'-TGATCAAATAATATGAGTAAGTCTTGT-3', SEQ ID NO: 18) are used to specifically amplify BnaA09.BGLU27; BGLU27(C08)-CRISPR-F (5'-GCACTTTTAAGTCTTCGTTA-3', SEQ ID NO: 19) and BGLU27(C08)-CRISPR-R (5'-AGCCCTATATAATATGATAAAA-3', SEQ ID NO: 20) are used to specifically amplify BnaC08.BGLU27. The amplification method is as follows:

[0118] The PCR amplification system consisted of 20 μL of 2× Taq Master Mix, 2 μL of DNA template, 1.6 μL of F primer, 1.6 μL of R primer, and ddH2O to 40 μL. PCR amplification conditions included initial denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, and extension at 72°C for 30 sec, 34 circles, and a total extension at 72°C for 5 min.

[0119] The amplified target fragments were sequenced by PCR products, and the sequencing results were analyzed using the DSDecode online website ( http: / / skl.scau.edu.cn / dsdecode / ) Analysis of target site editing. Sequencing results showed that two independent mutant strains (bglu27-1 and bglu27-2) were obtained in which both BnaBGLU27 homologous genes (BnaA09.BGLU27 and BnaC08.BGLU27) were edited; Figure 2 (A, B).

[0120] (3) Identification of overexpression transformed cells

[0121] The genomic DNA of the obtained rapeseed overexpression transformed plant was extracted, and the insertion of the exogenous gene fragment was detected by PCR. The overexpression backbone vector in the present invention was 35S-pCAMBIA2306. The primer pCAMBIA2306-R (5'-CATGGTGGCAAATTCTGATCC-3', SEQ ID NO: 21) was designed on the vector backbone. PCR was performed by combining the vector backbone primer with the exogenous fragment primer (BnaA09.BGLU27-pCAMBIA2306-F: 5'-ATGAATGAAGCAGCGGTGG-3', SEQ ID NO: 22). The transgenic seedlings were detected at the PCR level ( Figure 2 (C). PCR system: Taq polymerase mix 5 µL; pCAMBIA2306-R (10 µmol / L) 0.5 µL; BnaA09.BGLU27-pCAMBIA2306-F (10 µmol / L) 0.5 µL; gDNA 1 µL; ddH2O 3 µL. PCR conditions: total denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 58°C for 30 sec, extension at 72°C for 1 min, 34 circles; total extension at 72°C for 5 min.

[0122] qRT-PCR was performed on transgenic rapeseed seedlings obtained by PCR to detect gene expression. RNA was extracted from leaves of individual transformed plants, and cDNA was synthesized (using the same method as in Example 1). Quantitative primers were designed using Primer 5 software, with product sizes ranging from 80 to 250 bp. After design, BLAST comparison was performed with reference sequences to ensure the specificity of primers BnaBGLU27-RT-F (5'-CCGAAAATGTCTGCGATGTG-3', SEQ ID NO: 23) and BnaBGLU27-RT-R (5'-TAGGAATGAAACATGAGGCCG-3', SEQ ID NO: 24). BnaACTIN7-F (5'-CGCGCCTAGCAGCATGAA-3', SEQ ID NO:25) and BnaACTIN7-R (5'-GTTGGAAAGTGCTGAGAGATGCA-3', SEQ ID NO:26) were used as internal control primers for qRT-PCR in Brassica napus (see Zhou et al. 2012: BnMs3 is required for tapetal differentiation and degradation, microspore separation, and pollen-wall biosynthesis in Brassica napus). The reaction system consisted of 2 μL of 10-fold diluted cDNA, 0.4 μL of the upstream primer (10 μM), 0.4 μL of the downstream primer (10 μM), 10 μL of 2× TransStart® Green qPCR SuperMix, and 7.2 μL of ddH2O.

[0123] The reaction program was as follows: 94°C for 30 s, followed by 45 cycles of 94°C for 10 s, 60°C for 15 s, and 72°C for 30 s. Melting curves were drawn. qRT-PCR was performed in a Bio-Rad CFX96 Real-Time System.

[0124] Normalization was performed based on the internal reference primers, and delta-delta athreshold cycle relative quantification (2 -ΔΔCT ) method. Finally, the relative expression levels of rapeseed overexpression transformed plants OE-3 and OE-8 were obtained by analysis ( Figure 2 Middle D).

[0125] Example 5 Phenotypic analysis of wild type, mutant and overexpressing materials

[0126] The 1000-grain weight of rapeseed seeds harvested at maturity was analyzed using an SC-G automatic seed analyzer to obtain 1000-grain weight data for wild-type, mutant, and overexpression materials. The measuring instrument was provided by the National Rapeseed Engineering Technology Research Center of Huazhong Agricultural University.

[0127] The results of thousand-grain weight analysis showed that the thousand-grain weight of the recipient background material Westar was 3.32±0.32 g, the thousand-grain weights of the mutant materials bglu27-1 and bglu27-2 were 2.91±0.25 g and 2.96±0.31 g, respectively, and the thousand-grain weights of the overexpression materials OE-3 and OE-8 were 4.07±0.30 g and 3.99±0.22 g, respectively. Statistical analysis showed that the thousand-grain weights of the two mutants were significantly reduced compared with the wild type, while the thousand-grain weights of the two overexpression materials were significantly increased compared with the wild type ( Figure 3 These results indicate that BnaBGLU27 positively regulates the 1000-grain weight of rapeseed.

[0128] In summary, BnaBGLU27 plays an important role in regulating the thousand-grain weight of rapeseed.

[0129] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of the BnaBGLU27 gene in positively regulating the thousand-grain weight of rapeseed, characterized in that: The nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1, and the positive regulation is to overexpress the BnaBGLU27 gene to increase the thousand-grain weight of rapeseed.

2. Application of the protein encoded by the BnaBGLU27 gene in positively regulating the thousand-grain weight of rapeseed, characterized in that: The nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1, and the amino acid sequence of the protein is shown in SEQ ID NO:

3. The positive regulation is to overexpress the BnaBGLU27 gene to increase the expression level of the protein and increase the thousand-grain weight of rapeseed.

3. Application of a recombinant vector comprising the BnaBGLU27 gene in positively regulating the thousand-grain weight of rapeseed, characterized in that: The recombinant vector is constructed by connecting the BnaBGLU27 gene and an expression vector. The nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:

1. The positive regulation is to overexpress the BnaBGLU27 gene to increase the thousand-grain weight of rapeseed.

4. Use of a host bacterium comprising the recombinant vector according to claim 3 in positively regulating the thousand-grain weight of rapeseed.

5. A method for regulating rapeseed thousand-grain weight, characterized in that: The method comprises the steps of introducing the BnaBGLU27 gene into rapeseed and over-expressing the gene to increase the thousand-grain weight of the rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:

1.

6. A breeding method for increasing the thousand-grain weight of rapeseed, characterized in that: The method comprises the steps of overexpressing the BnaBGLU27 gene in rapeseed to increase the thousand-grain weight of rapeseed; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO:

1.

7. A method for cultivating transgenic rapeseed with high 1000-grain weight, characterized in that: The method comprises the steps of overexpressing the BnaBGLU27 gene in rapeseed to obtain transgenic rapeseed with high 1000-grain weight; wherein the nucleotide sequence of the BnaBGLU27 gene is shown in SEQ ID NO: 1.

Images