Application of knockout poplar ACO gene in increasing wood yield and method of knockout poplar ACO gene

Abstract

The invention discloses an application of a knockout poplar ACO gene in increasing wood yield and a method of the knockout poplar ACO gene, an ACO knockout plant carrier is introduced into NL895, and an ACO knockout transgenic plant is obtained; the ratio of stem xylem in the knockout plant is obviously higher than that of WT, and the number of xylem layers is also obviously increased; the result shows that after the ACO is deleted, the activity of the stem cambium and the xylem differentiation of the poplar are promoted, and the method has important significance on development and utilization of the poplar.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, specifically to the application of knocking out the ACO gene of poplar in improving wood yield, and also relates to a method for improving poplar wood yield. Background Art

[0002] During the growth and development of higher plants, secondary vascular tissues provide necessary mechanical support and material transport functions for plants, thus maintaining their normal life activities (Fischer et al., 2019). Different from herbaceous plants, perennial trees can carry out secondary growth on the basis of primary growth, eventually resulting in stem thickening. The secondary growth of trees depends on the continuous division and differentiation of cambial cells, and their differentiation to both sides forms secondary phloem and secondary xylem. The secondary xylem of forest trees is wood, which is widely used in papermaking, construction, bioenergy and other aspects. It is an important renewable resource and has extremely important economic value for human production and life (Plomion et al., 2001). With the rapid development of China's economy, people's demand for wood is increasing day by day. However, due to the long growth cycle and high heterozygosity of forest trees, traditional breeding is difficult to meet the growing demand for wood. Therefore, exploring the key genes regulating wood, analyzing the molecular regulation network of wood secondary development, and using molecular breeding methods to improve wood quality are considered to be one of the most effective ways to alleviate the contradiction between wood supply and demand.

[0003] Aconitate hydratase (ACO for short) catalyzes the isomerization of citrate into isocitrate, contributes to oxidative stress tolerance, and plays a role in respiration (Fedorin et al., 2024). The tricarboxylic acid cycle enzyme aconitate hydratase has become a key component of stress-induced organelle signal transduction and is also a regulator of metabolism and redox balance in photosynthetic organisms. Aconitate hydratase mediates mitochondrial and chloroplast retrograde signaling and contributes to the activation of the alternative oxidase (AOX) pathway in mitochondria. Some studies have shown that TZ1 negatively regulates the response of root growth to aluminum stress by interacting with ACO and regulating citrate homeostasis (Liu et al., 2022). Aconitate hydratase-driven citrate metabolism plays a crucial role in providing reducing equivalents and metabolic precursors for biosynthesis pathways related to stress acclimation. In addition to its enzymatic activity, aconitate hydratase also has non-classical functions because it is a post-transcriptional regulator of specific gene transcripts. The various functions of aconitate hydratase under stress are promoted by regulating specific aconitate hydratase isoforms at multiple levels (Rahikainen et al., 2025).

[0004] Currently, the research on the response of aconitate hydratase to plant stress and signal transduction has been relatively clear, but its regulatory mechanism on wood secondary development still needs to be further explored. Summary of the Invention

[0005] In view of this, one object of the present invention is to provide an application of knocking out the ACO gene of poplar in improving wood yield, and another object of the present invention is to provide a method for improving the wood yield of poplar.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] 1. Application of knocking out the ACO gene of poplar in improving wood yield, wherein the amino acid sequence encoded by the ACO gene of poplar is as shown in SEQ ID NO.2, and improving wood yield means improving the plant height, stem diameter or stem xylem content of poplar.

[0008] In some embodiments of the present invention, the nucleotide sequence of the ACO gene of poplar is as shown in SEQ ID NO.1.

[0009] In some embodiments of the present invention, the method of knocking out the ACO gene of poplar is using the CRISPR / Cas9 technology.

[0010] In some embodiments of the present invention, the method of knocking out the ACO gene of poplar is specifically to transform NL895 with a CRISPR / Cas9 gene editing vector containing the target sequence of the ACO gene to obtain a transgenic plant with an edited mutation of the ACO gene, and the wood yield of the obtained transgenic plant is improved.

[0011] In some embodiments of the present invention, the target sequence of the ACO gene is as shown in SEQ ID NO.3-4.

[0012] 2. A method for improving the wood yield of poplar, the specific method is to transform poplar with a CRISPR / Cas9 gene editing vector containing the target sequence of the ACO gene to obtain a transgenic plant with an edited mutation of the gene, and the target sequence of the ACO gene is as shown in SEQ ID NO.3-4.

[0013] In some embodiments of the present invention, the method of transforming poplar is by Agrobacterium-mediated transformation.

[0014] In some embodiments of the present invention, the Agrobacterium is Agrobacterium tumefaciens GV3101.

[0015] The beneficial effects of the present invention are as follows: The present invention provides the application of knocking out the ACO gene of poplar in improving wood yield and its method. By introducing the ACO knockout plant vector into NL895, ACO knockout transgenic plants are obtained; the plant height and stem diameter of the ACO knockout transgenic plants are increased, and the proportion of stem xylem in the knockout plants is significantly higher than that of the WT, and the number of xylem layers and the number of cambium layers are also significantly increased; this result indicates that the activity of the poplar stem cambium and xylem differentiation are promoted after the deletion of ACO. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to make the objectives, technical solutions and beneficial effects of the present invention clearer, the following drawings are provided for the description of the present invention:

[0017] Figure 1 It is the vector map of the gDNA expression cassette.

[0018] Figure 2 It is the sequencing identification result of the NL895 ACO knockout positive plant.

[0019] Figure 3 It is the growth situation of the NL895 ACO knockout plant material (A: comparison of the growth of the knockout material and the wild type; B: statistical analysis of the plant height of the knockout material and the wild type; C: statistical analysis of the stem diameter of the knockout material and the wild type).

[0020] Figure 4 It is the phenotypic secondary development phenotypic analysis of the NL895 ACO knockout plant (A: toluidine blue staining of the knockout material and the wild type; B: analysis of the number of xylem layers of the knockout material and the wild type; C: analysis of the number of cambium layers of the knockout material and the wild type). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0021] The following further describes the present invention in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the examples given are not intended to limit the present invention.

[0022] Example 1. Construction of a knockout vector and engineering bacteria containing the target sequence of the ACO gene

[0023] Adapter preparation: According to the ACO gene sequence of Populus deltoides cv. 'Nanlin895' (shown in SEQ ID NO.1 - 2), target sequences capable of specifically knocking out the ACO gene are designed. The specific target sequences are as follows:

[0024] T1-F: 5’-AAATGCAGTGCAGGCTAATA-3’ (SEQ ID NO.3);

[0025] T1-R: 5’-TATTAGCCTGCACTGCATTT-3’ (SEQ ID NO.4).

[0026] Synthesize primer sequences containing T1-F and T1-R target sequences and a specific vector linker. Centrifuge the obtained primers at 8000 rpm for 2 minutes and dissolve the primers with 1 / 5 TE. Amplify with KOD enzyme, and the PCR system is shown in Table 1 below:

[0027] Table 1. PCR system

[0028]

[0029] Use the following PCR program for amplification:

[0030] Pre-denature at 95°C for 2 min; denature at 95°C for 20 s, anneal at 55°C for 30 s, extend at 68°C for 10 s, for a total of 15 cycles; extend at 68°C for 2 min; hold at 16°C forever.

[0031] After recovering the DNA fragment by ethanol precipitation, perform enzymatic digestion. The system is shown in Table 2:

[0032] Table 2. Enzymatic digestion system

[0033]

[0034] Ligate with the Bige CRISPR / Cas vector (product number BGK012). The system is shown in Table 3:

[0035] Table 3. Ligation reaction system

[0036]

[0037] After ligating at 16°C for 8 hours, transform Escherichia coli DH5α to obtain a recombinant plant knockout vector containing the ACO gene target, named the WMC001-BGK012-ACO vector ( Figure 1 ). The correctness of the gene was confirmed by sequencing by the Hi-TOM sequencing group of the China National Rice Research Institute.

[0038] Transform the WMC001-BGK012-ACO vector into Agrobacterium tumefaciens GV3101, screen for positive clones, and obtain an engineered bacterium containing the WMC001-BGK012-ACO vector, named GV3101-WMC001-BGK012-ACO.

[0039] Example 2. Transformation of the ACO knockout vector mediated by Agrobacterium tumefaciens into Populus deltoides cv. 'Nanlin895'

[0040] I. Two-step activation culture of Agrobacterium

[0041] 1) Streak the GV3101-WMC001-BGK012-ACO strain on a YEP solid medium containing 40 mg / L rifampicin and 50 mg / L kanamycin, and culture it in an incubator at 28 °C for 36 h; Scrape all the single colonies on the plate and inoculate them into 50 mL of a double-antibiotic liquid medium of YEP+Rif+kan;

[0042] 2) Incubate with shaking at 28 °C and 200 rpm / min for 36 - 48 h until the bacterial liquid concentration reaches OD600 = 0.8 - 1.0;

[0043] 3) According to a ratio of 1:1000, pipette 50 μL of the first-stage viable liquid into 50 mL of fresh double-antibiotic liquid medium of YEP+Rif+kan for second-stage viable liquid culture;

[0044] 4) Incubate with shaking at 28 °C and 200 rpm / min for 12 - 16 h until the bacterial liquid concentration reaches OD600 = 0.3 - 0.4 for later use.

[0045] II. Preparation of Agrobacterium infection liquid

[0046] 1) Collect the second-stage viable liquid using a 50 mL centrifuge tube, centrifuge at 4000 rpm / min for 8 min to collect the bacterial cells;

[0047] 2) Discard the supernatant of the medium, resuspend the Agrobacterium using 40 mL of an AS-containing WPM resuspension, and pour the resuspension into a sterile glass bottle;

[0048] 3) Place the resuspension at 28 °C and shake it at 200 rpm / min for 40 min to enhance the infection activity of the Agrobacterium.

[0049] III. Preparation of leaf discs

[0050] 1) In a laminar flow hood, burn the sterilized scissors, forceps, and scalpel handle with the outer flame of an alcohol lamp for 15 s, and let them cool for later use;

[0051] 2) Use scissors to cut 5 - 6 leaves from healthy wild-type Populus deltoides cv. 'Nanlin895' tissue culture seedlings and place them in a petri dish. Add 1 / 3 volume of sterile water to the dish to keep the leaves moist;

[0052] 3) Install the sterile scalpel blade on the handle, burn it with the flame and let it cool. Use the blade to evenly cut the leaves into square leaf discs with a side length of 0.5 cm 2

[0053] IV. Infection

[0054] 1) Use forceps to pick up the leaf discs and place them into the Agrobacterium resuspension. Gently shake the glass bottle to evenly coat the leaf discs with the resuspension and infect for 10 min;

[0055] ​2) After the infection is completed, carefully pick out the leaf discs with forceps and place them on sterile paper to absorb the excess infection liquid on the leaf discs;

[0056] 3) Place the leaf discs flat on the co-culture plate, put them in a dark box, and culture them in the dark at 25 °C for 36 - 48 h.

[0057] V. Selection and culture of leaf discs

[0058] 1) After the dark culture is completed, select the appropriate plant resistance according to the vector and prepare a selection medium containing antibiotics;

[0059] 2) Transfer the leaf discs to the selection medium in a laminar flow hood to induce callus. During this period, every seven days, transfer the leaf discs to a new medium and continue to change the medium for 3 - 4 weeks until white or light yellow callus grows at the edges of the leaf discs. The whole process is cultured at 25 °C in a dark box.

[0060] VI. Inducing shoots from callus

[0061] Transfer the leaf discs with callus to a shoot induction medium containing the corresponding antibiotics, and culture them under light at 8000 Lux and 25 °C for 5 - 6 weeks, changing the medium every two weeks. During this period, the callus will grow and expand fully. Around the 5th week, bud points will appear on the callus, and multiple shoots will grow.

[0062] VII. Inducing roots from multiple shoots

[0063] When the multiple shoots grow to about 3 - 5 cm, cut the shoots with a sharp scissors, insert the multiple shoots into the rooting medium with forceps, and culture them under light at 8000 Lux and 25 °C for 7 - 10 days to obtain rooted seedlings. These are the candidate transgenic plants, and they can be transplanted to soil for cultivation only after subsequent positive identification. Name the transgenic seedlings as ACO-KO plants.

[0064] Example 3. PCR molecular identification of ACO-KO transgenic plants

[0065] I. DNA extraction of wild-type and ACO-KO transgenic Populus deltoides cv. Nanlin895

[0066] Select 10 - 15 resistant regenerated transgenic plants respectively, and extract the genomic DNA of Populus deltoides cv. Nanlin895. The method is as follows:

[0067] 1) Prepare CTAB buffer and preheat it in a 65 °C water bath for later use;

[0068] 2) Take about 0.5 g of leaves of wild-type and ACO-KO transgenic Populus tomentosa respectively, grind them into powder in liquid nitrogen, add 500 μL of the above preheated CTAB extraction solution, and mix well;

[0069] 3) Incubate in a 65 °C water bath for 45 min, and gently shake three times at intervals during the process to mix evenly.

[0070] 4) After the water bath, cool to room temperature, add an equal volume of chloroform:isoamyl alcohol (24:1), gently invert to mix evenly, then lay flat and emulsify for 10 min. Centrifuge at 4 °C, 12000 rpm / min for 10 min;

[0071] 5) Pipette the supernatant into a new sterile centrifuge tube, add an equal volume of isopropanol pre-cooled at -20 °C, and invert to mix evenly to see white flocculent precipitate;

[0072] 6) Centrifuge at 4 °C, 12000 rpm / min for 10 min. Discard the supernatant, rinse the precipitate twice with 500 ml of 75% (V / V) ethanol, and then rinse once with 500 ml of absolute ethanol. Discard the liquid. Dry the precipitate in a rotary evaporator at 37 °C until it becomes semi-transparent;

[0073] 7) Dissolve the precipitate with 25 μL of sterile water to obtain crude DNA extracts from wild-type and TIR-KO transgenic Nanlin 895 poplar leaves;

[0074] 8) Add approximately 1 μl of RNase to the crude DNA extract and enzymatically digest the RNA at 37 °C for 1 h;

[0075] 9) Store the DNA samples in a -20 °C refrigerator for future use.

[0076] II. PCR Amplification of Transgenic Plants

[0077] Since wild-type plants do not contain the exogenously introduced BGK012 vector sequence, positive plant screening is performed by PCR amplification using the BGK012 vector primers WMC001-F and WMC001-R. Using wild-type DNA template as a negative control, PCR amplification and gel electrophoresis imaging of the transgenic plant DNA are carried out to identify transgenic positive lines. TIR-KO positive lines will have a bright and clear single band at around 500 bp, while wild-type ones will not.

[0078] The specific primers designed using the BGK012 vector, WMC001-F and WMC001-R sequences are as follows:

[0079] WMC001-F: 5′-cctgggaatctgaaagaag-3′ (SEQ ID NO.5);

[0080] WMC001-R: 5′-gatagctgggcaatggaat-3′ (SEQ ID NO.6).

[0081] The PCR reaction system is shown in Table 4 below. The reaction procedure is as follows: pre-denaturation at 94°C for 3 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 1 min, a total of 31 cycles; extension at 72°C for 10 min. The amplified products were detected by 1% agarose gel electrophoresis.

[0082] Table 4. System of PCR reaction for identification of transgenic plants

[0083]

[0084] III. Identification of positive plants

[0085] After confirming the transfer of the BGK012 vector, further confirm whether the target gene has been edited. Using the nucleotide sequences of the target gene ACO shown in SEQ ID NO.1 - 2, the following primers were designed for PCR amplification:

[0086] ACO-F: ATGCCGACGCCGGTAACTAC (SEQ ID NO.7)

[0087] ACO-R: CTCTATCTGCATCCACGTG (SEQ ID NO.8)

[0088] The specific amplification system is as shown in the previous step "PCR amplification of plants transferred with the vector". The amplified products were sent to Beijing Tsingke Biotechnology Co., Ltd. for sequencing to confirm the sequences of the amplified genes. The results are as Figure 2 shown. There was a 1-bp deletion of A base at the sgRNA of the amplified gene sequence, which was a homozygous mutation.

[0089] Example 4. Phenotypic analysis of ACO knockout plants of Populus deltoides cv. 'Nanlin895'

[0090] One-month-old tissue culture seedlings were transplanted into flower pots and grown in a greenhouse at 25°C under long-day conditions (16 h light / 8 h dark, light intensity 10000 Lux) for three months. The plant heights and stem diameters of WT and ACO-KO transgenic poplars (plant number IT-3-9) were measured and statistically analyzed.

[0091] The results are as Figure 3 shown. Compared with WT plants, the plant height of ACO-KO plants increased by 21.9% and the stem diameter increased by 22.3%.

[0092] Example 5. Secondary development analysis of ACO-KO transgenic plants

[0093] Sections of 3-month-old WT and ACO-KO transgenic poplars were observed. The results are as Figure 4 shown. After knocking out the ACO gene, the xylem of Populus deltoides cv. 'NL895' increased by 83.3% and the cambium increased by 66.7%.

[0094] The above-described embodiments are merely preferred embodiments given to fully illustrate the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or transformations made by those skilled in the art on the basis of the present invention are all within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. Application of knocking out the ACO gene of poplar in increasing wood yield, characterized in that: The amino acid sequence encoded by the poplar ACO gene is shown in SEQ ID NO.2, and the purpose of increasing wood yield is to increase the plant height, stem diameter or stem xylem content of the poplar.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the poplar ACO gene is shown as SEQ ID NO.

1.

3. The use according to claim 1, characterized in that: The method for knocking out the poplar ACO gene is to use CRISPR / Cas9 technology.

4. The use according to claim 1, characterized in that: The method for knocking out the poplar ACO gene is specifically to transform NL895 with a CRISPR / Cas9 gene editing vector containing an ACO gene target sequence to obtain a transgenic plant with an ACO gene editing mutation, and the wood yield of the obtained transgenic plant is increased.

5. The use according to claim 4, characterized in that: The ACO gene target sequence is shown in SEQ ID NO.3-4.

6. A method for increasing the yield of poplar wood, characterized in that: The specific method is to transform poplar with a CRISPR / Cas9 gene editing vector containing an ACO gene target sequence to obtain a transgenic plant with a gene editing mutation, wherein the ACO gene target sequence is shown in SEQ ID NO.3-4.

7. The method according to claim 6, characterized in that: The method for transforming poplar is to adopt Agrobacterium-mediated method.

8. The method according to claim 6, characterized in that: The Agrobacterium is Agrobacterium GV3101.

Images