Molecular marker method for detecting amylose content of rice

Designing specific primers through Bi-PASA principle, PCR amplification of In1 (G/T) and Exon6-1132 sites of the rice Wx gene, solving the problem of failing to effectively identify single sites of the Wx gene in the prior art, achieving rapid and accurate Wx genotype identification, which is suitable for large-scale screening and variety improvement in rice breeding.

CN120158540AInactive Publication Date: 2025-06-17HUNAN UNIV OF HUMANITIES SCI & TECH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411825849.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-06-17
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The prior art failed to effectively identify single sites of rice Wx genes, resulting in the lack of a molecular marker system for Wx genotype identification.

Method used

Specific primers were designed using Bi-PASA principle, and PCR amplification was performed on In1 (G/T) and Exon6-1132 sites, and different Wx genotypes were identified by detecting the band length of PCR amplification products.

Benefits of technology

The genotype of the rice amylose content control gene Wx is quickly, accurately and at low cost, and is suitable for a large number of screening and variety improvement in rice breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158540A_ABST
    Figure CN120158540A_ABST
Patent Text Reader

Abstract

The invention discloses a molecular marking method for detecting the amylose content of rice, and particularly discloses a molecular marking method for detecting the types of the second basic group of the first intron and the 1132-site basic group at the sixth exon of a rice amylose content control gene Wx. The marker combination can be used for quickly judging the types of the second basic group of the first intron and the 1132-site basic group at the sixth exon of the Wx gene, so that the allelic type of the Wx gene is judged, and the quick identification and screening of the AC content of the rice variety are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of molecular genetics, and in particular to a molecular marker method for detecting the amylose content of rice. Background Art

[0002] Rice is the staple food of about one-third of the world's population. In recent years, with the implementation of plans such as high-yield breeding, super-high-yield breeding, super rice breeding, and green super rice breeding, the yield of rice has been continuously increasing. At the same time, with the improvement of people's living quality and the increasing diversification of rice foods, the quality traits related to rice taste and processing have received more and more extensive attention.

[0003] The quality of rice mainly includes processing quality, appearance quality, cooking and eating quality, etc. Among them, the amylose content is an important physical and chemical index of rice quality, and the amylose content (AC) is the most important factor affecting rice quality. Different AC contents affect the viscosity, softness, gloss, and eating quality of cooked rice, determining the quality of rice. The variety types derived from the long-term evolution and differentiation of rice are extremely complex, and the variations shown in their quality traits are also extremely rich. There are significant differences in the amylose content among existing cultivated rice varieties. The lowest content in glutinous rice is only 0% - 2%, and the highest in non-glutinous rice can reach more than 30%. In breeding, to obtain varieties with corresponding AC contents, appropriate combinations of parents with different AC contents are required. For example, to select hybrid rice with a moderate AC content, it is necessary to select combinations of low AC values with medium and high values or combinations between medium AC values.

[0004] Numerous studies have shown that Wx genes are the major genes controlling the synthesis of amylose in rice grains, and they control the synthesis of amylose by encoding granule-bound starch synthase (GBSS). During the long-term evolution of rice, rich variations have accumulated. Currently, at least five types of multiple alleles have been identified at the Wx gene locus, and the most important alleles among them Wx a , Wx in , Wx b control the phenotypes of high, medium, and low AC in rice, respectively. Research on the regulation of rice Wx gene expression shows that Wx a , Wx in , Wx b the levels of transcription are affected by WxThe important influence of the G / T single nucleotide polymorphism at the first position of the first intron of the gene (abbreviated as In1(G / T)). If the base of In1(G / T) is G, the first intron is efficiently spliced and AC increases, showing as Wx a or Wx in genotype; if the base of In1(G / T) is T, the splicing efficiency decreases and AC decreases, showing as Wx b genotype. Further research found that Wx in compared with Wx a at position 1132 of exon 6, the base A mutates to C, which affects Wx the transcriptional expression level of the gene, thus generating varieties with medium AC. Therefore, in breeding practice, different Wx genotypes can be selected by separately identifying the types of the base at In1(G / T) and position 1132 of exon 6, so as to breed different AC rice varieties.

[0005] At present, there are many methods for measuring the AC content of rice, mainly using instrumental analysis based on the physicochemical properties of amylose, such as SKALAR chemical autoanalyzer, chromatography, amperometric titration, near-infrared spectroscopy, etc. Although these methods can accurately measure the AC of rice, due to the cumbersome analysis methods or expensive instruments, the large-scale and rapid screening of breeding materials is limited. With the development of biotechnology, molecular marker technology has been widely applied to rice breeding practice. At present, there are many methods for identifying SNPs, such as sequencing, restriction enzyme digestion, mass spectrometry, SNP chip technology, etc., but these methods are technically cumbersome, the procedures are complex, and the cost is relatively high, and there are many limiting factors for use in breeding practice.

[0006] Bi-directional allele-specific PCR (Bi-PASA) is a relatively simple SNP genotyping method, which is easy to operate, fast in genotyping, and low in cost. The type of known mutation sites can be detected only through 1 PCR reaction. Its basic principle is: a PCR reaction system contains two primers whose 3' ends specifically bind to the two alleles of the SNP respectively, and their extension directions are opposite, generating allele-specific amplification products with different lengths. At the same time, mismatches are introduced at the 2nd or 3rd base at the 3' end of the two allele-specific primers to increase specificity. At present, there have been reports on using a technology similar to Bi-PASA to Wx develop markers for genes, but none of them have identified single sites of Wx genes, while WxGenotypes are often affected by multiple loci, and there is a lack of a molecular marker system for Wx genotype identification. SUMMARY OF THE INVENTION

[0007] 1. Technical problems to be solved The object of the present invention is to solve the problem that in the prior art, there is no identification of individual gene loci, and Wx genotypes are often affected by multiple loci, and there is a lack of a molecular marker system for Wx genotype identification, and to propose a molecular marker method for detecting the amylose content of rice. Wx

[0008] 2. Technical solution

[0009] To achieve the above object, the present invention adopts the following technical solution: A molecular marker method for detecting the amylose content of rice, comprising the following steps: Step 1: Perform PCR amplification on the rice sample DNA with the In1 (G / T) primer set, detect the amplified bands. If a 306 bp specific band and a 467 bp band are amplified, the In1 locus is G-type homozygous; if a 214 bp specific band and a 467 bp band are amplified, the In1 locus is T-type homozygous; if three bands of 214 bp, 306 bp and 467 bp are amplified, the In1 locus is GT heterozygous; Step 2: Perform PCR amplification on the rice sample DNA with the Exon6-1132 (A / C) primer set, detect the bands. If a 349 bp specific band and a 514 bp band are amplified, the Exon6-1132 locus is A-type homozygous; if a 214 bp specific band and a 514 bp band are amplified, the Exon6-1132 locus is C-type homozygous; if three bands of 214 bp, 349 bp and 514 bp are amplified, the Exon6-1132 locus is AC heterozygous.

[0010] The present invention also proposes a set of primers for genotype identification of the genes controlling the amylose content of rice, Wx with good primer specificity and high amplification efficiency, which can be used for identifying the genotypes of the genes controlling the amylose content of rice; Wx The present invention also proposes a method for genotype identification of the genes controlling the amylose content of rice, Wx which can effectively perform genotype selection on the genes controlling the amylose content of rice, and can be used for both screening and identification of rice resources and molecular assisted breeding of the genes controlling the amylose content of rice. Wx Wx

[0011] Preferably,​​​​Wx The gene is located on the short arm of chromosome 6 and consists of 14 exons and 13 introns, encoding a protein composed of 609 amino acids. Research shows that Wx There are multiple alleles of the gene, among which the allele Wx a , Wx in , Wx b respectively control the phenotypes of high, medium, and low AC content. Compared with Wx a , Wx b has a G-T mutation at the +1 position (In1) of the first intron, resulting in lower splicing efficiency and abnormal splicing of the first intron, a decrease in GBSS activity, and a decrease in AC content. Wx in Compared with Wx a , a base A at position 1132 in exon 6 is mutated to C, affecting the Wx transcription and expression level of the gene, thus producing varieties with medium AC. The present invention designs specific primers for the two SNP sites generated by the mutations respectively for genotyping identification.

[0012] The principle of primer design is as shown in the following figure ( Figure 1): According to the Bi-PASA principle, specific primers were first designed for the G allele at the In1 locus. Using the G at the In1 locus as the 3'-end to design the forward primer IntF, studies have shown that if the 3'-end of the primer forms a strong mismatch (G / A, C / T, T / T) with the template, then the second mismatch introduced should be a weak mismatch (A / C, T / G), and vice versa. If it is a medium mismatch (C / C, A / A, G / G), then another medium mismatch needs to be introduced. Since IntF forms a G / A mismatch when amplifying the T allele, an A / C mismatch was introduced at the second base at the 3'-end to increase the primer specificity. Then, a paired reverse primer ExtR was designed. The results showed that the IntF / ExtR primer pair specifically amplified a 306-bp band for the G allele, while there was no band for the T allele. Similarly, specific primers were designed for the T allele at the In1 locus. Using the T at the In1 locus as the 3'-end to design the reverse primer IntR, since IntR forms an A / G mismatch when amplifying the G allele, a G / T mismatch was introduced at the second base at the 3'-end to increase the specificity. Then, a paired forward primer ExtF was designed. The ExtF / IntR primer pair could specifically amplify the T allele to obtain a 214-bp band, while it could not amplify the G allele. In practical use, different allelic genotype materials were identified by mixing the four primers. The G-type and T-type materials could specifically amplify 214-bp and 306-bp bands respectively, and both could amplify a 467-bp band, which did not affect the detection of the target band. The same principle was used to design primers for the 1132nd base site of the 6th exon. First, specific primers were designed for the A allele. Using the A base at this site as the 3'-end to design the forward primer IntF, since IntF forms an A / G mismatch when amplifying the C allele, a C / A mismatch was introduced at the third base at the 3'-end. Then, a paired reverse primer ExtR was designed. The IntF / ExtR primer pair could specifically amplify the A allele, generating a 349-bp band, while it could not amplify the C allele. Similarly, using the C at this site as the 3'-end to design the reverse primer IntR, since IntR forms an A / G mismatch when amplifying the A allele, a G / T mismatch was introduced at the second base at the 3'-end. Then, a paired forward primer ExtF was designed. The ExtF / IntR primer pair could specifically amplify the C allele, generating a 214-bp fragment, while it could not amplify the A allele. In actual use, different allelic genotype materials were identified by mixing the four primers. The A-type and C-type materials could specifically amplify 349-bp and 214-bp bands respectively, and both could amplify a 514-bp band, which did not affect the detection of the target band. The names and sequences of the two groups of primers are shown in the table.

[0013] 3. Beneficial Effects

[0014] Compared with the prior art, the advantages of the present invention are as follows: 1. In the present invention, based on the Bi-PASA principle, co-dominant molecular markers that can identify different alleles and genotypes of parents and their F2 offspring only by using PCR electrophoresis technology are developed for the target SNP. Wx 2. In the present invention, with a set of marker systems of the present invention, rice germplasm resources with high, medium, and low AC contents can be simultaneously identified. The specific implementation is as follows: First, use a set of markers at the In1 locus to identify rice varieties, and varieties with high and low AC contents can be distinguished. Subsequently, continue to screen the selected varieties with high AC content using the marker combination at position 1132 of the 6th exon, and medium AC content rice varieties can be screened out from the varieties with high AC content. 3. In the present invention, when using genes to improve the AC trait of rice varieties, the molecular markers of the present invention can quickly and effectively introduce the target gene into rice varieties, thereby completing the improvement of varieties. Therefore, this method has a series of advantages such as simplicity, accuracy, low cost, and non-destructive detection in the early stage of rice growth, and is suitable for large-scale screening of genotypes in breeding. 3. In the present invention, when using Wx genes to improve the AC trait of rice varieties, the molecular markers of the present invention can quickly and effectively introduce the target gene into rice varieties, thereby completing the improvement of varieties. Therefore, this method has a series of advantages such as simplicity, accuracy, low cost, and non-destructive detection in the early stage of rice growth, and is suitable for large-scale screening of genotypes in breeding. Wx 4. BRIEF DESCRIPTION OF THE DRAWINGS 5. The figure is a schematic diagram of typing the SNP mutation site of the rice

[0015] Figure 1 gene by the bidirectional allele-specific PCR method; Wx 6. In the figure, a is a schematic diagram of amplifying 3 different genotypes of DNA templates at the In1 locus of the Figure 2 gene using the In1 primer combination of the present invention; b is a schematic diagram of the electrophoresis of amplifying 3 different genotypes of DNA templates at the Exon6-1132 locus of the Wx gene using the Exon6-1132 primer group of the present invention; Wx 7. The figure is an electrophoresis diagram of the F2 population with the separation of the In1 locus of the Figure 3 gene identified by the In1 primer group; Wx 8. The figure is an electrophoresis diagram of the F2 population with the separation of the Exon6-1132 locus of the Figure 4 gene identified by the Exon6-1132 primer group. Wx 9. DETAILED DESCRIPTION OF THE EMBODIMENTS 10. Hereinafter, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.

[0016] 11. Hereinafter, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.

[0017] The experimental methods not specifically described in this example are conventional methods in molecular biology. The Taq enzyme and dNTP used in this study were produced by Tiangen Biotech Co., Ltd., and the rest were all conventional biochemical reagents. Example 1

[0018] Use the primer combination of In1 site designed by the present invention to amplify 3 genotypes of DNA templates at the In1 site; use the primer combination of Exon6-1132 of the present invention to amplify 3 different genotypes of DNA templates at this site 1) Biological materials Construct an F1 generation material with IR64 / Huazhan. Among them, IR64 is of GG type and CC type at the In1 and Exon6-1132 sites respectively, Huazhan is of TT type and AA type at the In1 and Exon6-1132 sites respectively, and the hybrid F1 material is of GT type and AC type at the In1 and Exon6-1132 sites respectively.

[0019] 2) Rice DNA extraction and primer synthesis Extract the DNA of the above materials by the CTAB method and synthesize the primer sequences shown in the table 3) PCR The PCR system is recorded as 10ul: 1ul 10×PCR reaction buffer; 0.8ul 10mM dNTP; 0.15ul of each of the 4 10mM primers; 0.1ul Taq DNA polymerase; 2ul DNA template; make up the system with ddH2O. The PCR reaction conditions are: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, extension at 72°C for 45 seconds, for a total of 35 cycles; extension at 72°C for 8 minutes. The amplified products are electrophoresed on a 2% agarose gel, and the electrophoresis results are recorded with a gel imaging system scanner.

[0020] 4) Result analysis When detecting the genotype at the In1 site using the In1 primer combination: Lane 1 is the material with the homozygous G genotype. The amplification using the marker of the present invention shows bands of 306bp and 467bp. Lane 2 is the material with the homozygous T genotype, and the amplified bands are 214bp and 467bp. Lane 3 is the GT heterozygous material, and 3 bands of 214bp, 306bp and 467bp are amplified ( Figure 2 a); When detecting the genotype at this site using the Exon6-1132 primer combination: Lane 1 is the material with the homozygous A genotype. The amplification using the marker of the present invention shows bands of 214bp and 514bp. Lane 2 is the material with the homozygous C genotype, and the amplified bands are 349bp and 514bp. Lane 3 is the AC heterozygous genotype material, and 3 bands of 214bp, 349bp and 514bp are amplified ( Figure 2b). The result shows that the molecular markers designed in the present invention have clear bands and distinct differentiation when amplifying materials with different genotypes at two loci. Example 2

[0021] Wx Identification of single-gene segregation of In1 and Exon6-1132 loci in the F2 population 1) Biological materials An F2 population was constructed with IR64 and Huazhan, and 100 individual plants from the F2 population were selected for analysis.

[0022] 2) Rice DNA extraction The DNA of the above materials was extracted by the CTAB method. 3) PCR The procedure refers to Example 1. 4) Result analysis Using the markers of the present invention for 100 individual plants in the F2 population Wx The electrophoresis diagrams for genotype identification of gene In1 and Exon6-1132 loci of 100 individual plants in the F2 population are shown in Figures 3 Figure 4 as follows, where Figure 3 P1 is the G-type parent IR64, P2 is the T-type parent Huazhan, 1-16 are individual plants in the F2 population constructed by the parent IR64 and the parent Huazhan. Homozygous G-type individual plants have the same 306bp band pattern as the parent IR64, homozygous T-type individual plants have the same 214bp band pattern as the parent Huazhan, heterozygous individual plants have two band patterns of 214bp and 306bp, all three genotypes have a 467bp band, and the genotypes of individual plants are marked below the corresponding lanes. Figure 4 In it, P1 is the parent Huazhan, P2 is the parent IR64, 1-16 are individual plants in the F2 population. Homozygous A-type individual plants have the same 349bp band as the parent Huazhan, homozygous C-type individual plants have the same 214bp band as the parent IR64, heterozygous AC-type individual plants have 214bp and 349bp bands, all three genotypes have a 514bp band, and the genotypes of individual plants are marked below the corresponding lanes. Detection and analysis of the genotypes of 100 individual plants in the F2 population show that in this experiment, due to the co-segregation of In1 and Exon6-1132 loci, the segregation ratio of the three different genotypes is 27GC / GC:48GC / TA:25TA / TA. After chi-square test, the segregation ratio conforms to the Mendelian single-gene segregation ratio of 1:2:1 (χ 2 = 0.24 < χ 2 0.05 = 5.99), so the loci identified by the experimental markers are single-gene segregation.

[0023] In the present invention, based on the Bi-PASA principle, target SNPs are used to develop markers that can identify parents and their F2 offspring with different WxCo-dominant molecular markers for alleles and their genotypes.

[0024] In the present invention, by using a set of marker systems of the present invention, rice germplasm resources with high, medium, and low AC contents can be simultaneously identified. The specific implementation is as follows: First, a group of markers at the In1 locus are used to identify rice varieties, and varieties with high and low AC contents can be distinguished. Subsequently, the selected varieties with high AC content are further screened with the marker combination at position 1132 of the 6th exon, and rice varieties with medium AC content can be screened out from the varieties with high AC content.

[0025] In the present invention, when Wx improving the AC trait of rice varieties by gene, the molecular markers of the present invention can quickly and effectively introduce the target gene into rice varieties, thereby completing the improvement of the varieties. Therefore, this method has a series of advantages such as simplicity, accuracy, low cost, and non-destructive detection in the early stage of rice growth, and is suitable for Wx large-scale screening of genotypes in breeding.

[0026] As mentioned above, the above is only the preferred specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered by the protection scope of the present invention.

Claims

1. A molecular marker method for detecting the content of amylose in rice, characterized in that: The following steps are involved: Step 1: Use the In1 (G / T) primer set to perform PCR amplification on the rice sample DNA and detect the amplified bands. If a 306bp specific band and a 467bp band are amplified, the In1 site is G-type homozygous; if a 214bp specific band and a 467bp band are amplified, the In1 site is T-type homozygous; if three bands of 214bp, 306bp and 467bp are amplified, the In1 site is GT heterozygous; Step 2: Use Exon6-1132 (A / C) primer set to perform PCR amplification on rice sample DNA and detect the bands. If a 349bp specific band and a 514bp band are amplified, the Exon6-1132 locus is type A homozygous; if a 214bp specific band and a 514bp band are amplified, the Exon6-1132 locus is type C homozygous; if three bands of 214bp, 349bp and 514bp are amplified, the Exon6-1132 locus is type AC heterozygous.

2. A rice amylose content control gene Wx The genotype identification primer is characterized in that: It consists of two sets of primers, one for each Wx The second base of the first intron of the gene and the 1132nd base of the sixth exon were identified to determine Wx genotype.

3. A method for identifying rice Wx A gene-specific primer, characterized in that It consists of the following two sets of primers: (1) For detection Wx Molecular marker group In1 (G / T) of gene In1 locus: Wx-G / T-ExtF:TGCCCCGCATGTCATC Wx-G / T-ExtR:AACGAAGATTTAATATCAGGACA Wx-G / T-IntF:CATCAGGAAGAACATCTGCAAAT Wx-G / T-IntR: GAAACAAAGAATTATAAACATATATGTATGC (2) For detection Wx Gene Exon6-1132 site marker group Exon6-1132 (A / C): Wx-A / C-ExtF: ACCAGATGCGTTTCAGCC Wx-A / C-ExtR:ACGGCCCTGGGTAGGAGAT Wx-A / C-IntF:ACAACCCATACTTCAAAGGAACCTA Wx-A / C-IntR:CTTGAGATCAATTGTAACTCACCGG.