Molecular marker method for rapidly identifying southern and northern kelp culture population

Abstract

According to the molecular marker method for rapidly identifying the southern and northern kelp culture population, the nucleotide sequence of the specific molecular marker of the northern strain is SEQ ID NO: 1, and the nucleotide sequence of the specific molecular marker of the southern strain is SEQ ID NO: 2. Compared with amplified fragment length polymorphism, restriction site amplification polymorphism, microsatellite DNA marking and the like, the method is more convenient, only simple PCR amplification needs to be carried out, distinguishing can be carried out according to sequencing data, and tedious experiment steps are omitted. The molecular marker provided by the invention can be quickly identified only through simple PCR amplification and next-generation sequencing, so that the detection cost is relatively low. The development of the specific molecular marker not only can avoid seedling mixing in production, but also can lay a foundation for evaluation and identification of subsequent new strains.

Description

Technical Field

[0001] The present invention belongs to the technical field of algal genetic breeding, and specifically relates to a molecular marker method for rapidly identifying the northern and southern Saccharina japonica farming populations. Background Art

[0002] Saccharina japonica is an important large brown alga along the coast of the northwestern Pacific Ocean, widely distributed in Russia, Japan, China, South Korea, etc., and its farming populations are mainly distributed along the coasts of China and South Korea. Saccharina japonica is the type with the highest global seaweed aquaculture production and is an important raw material in fields such as food, chemical industry, and marine medicine. Since the 1930s, Chinese seaweed researchers have begun to explore the artificial breeding and farming of Saccharina japonica. After several generations of arduous efforts, major breakthroughs such as the artificial breeding of summer seedlings of Saccharina japonica under natural light, the artificial raft culture of Saccharina japonica, and the southward transfer of Saccharina japonica have been achieved, laying a solid foundation for China to rank first in the world in Saccharina japonica production and the overall development of the Saccharina japonica industry. Through genetic improvement methods such as hybridization, mutagenesis, and heterosis utilization of Saccharina japonica, more than 10 excellent varieties / lines of Saccharina japonica have been cultivated and widely used in production. Currently, farmed Saccharina japonica is widely distributed in farming sea areas such as Fujian, Shandong, and Liaoning, and can reach as far south as Shantou, Guangdong.

[0003] In the field of Saccharina japonica farming, northern farming strains generally refer to the farmed Saccharina japonica along the coasts of Shandong and Liaoning or the dominant farming strains whose parents are from northern farming sea areas; southern farming strains mainly refer to the farmed Saccharina japonica along the coasts of Zhejiang, Fujian, Guangdong, etc., or the dominant farming strains whose parents are from southern sea areas. With nearly a century of farming domestication, there are not significant differences in the external morphology between northern and southern farmed Saccharina japonica, but population genetic analysis shows significant genetic differentiation between northern and southern farmed Saccharina japonica. During the seedling raising and farming process of Saccharina japonica, it is inevitable that there will be a mixture of northern and southern strains. Since the phenotypic characteristics of Saccharina japonica are easily affected by factors such as cultivation density and farming environment, it is difficult to accurately distinguish the strains based on the morphological characteristics of Saccharina japonica. Therefore, it is necessary to establish a set of molecular markers for rapidly, accurately, and simply identifying northern and southern strains, which is helpful for the rapid identification of Saccharina japonica germplasm resources. Summary of the Invention

[0004] The purpose of the present invention is to provide a molecular marker method for rapidly identifying the northern and southern Saccharina japonica farming populations, thereby effectively identifying the northern and southern Saccharina japonica farming strains.

[0005] The present invention first provides a molecular marker for identifying the northern and southern Saccharina japonica farming strains, wherein the nucleotide sequence of the specific molecular marker for the northern strain is SEQ ID NO:1, and the nucleotide sequence of the specific molecular marker for the southern strain is SEQ ID NO:2;

[0006] The present invention also provides a use of the above-mentioned molecular marker, which is an application in identifying the northern and southern Laminaria japonica aquaculture strains;

[0007] The present invention also provides an application of a primer pair for detecting the above-mentioned molecular marker in the preparation of a molecular detection product for identifying the northern and southern Laminaria japonica aquaculture strains;

[0008] The molecular detection product described above can be a PCR amplification and sequencing detection kit;

[0009] For the primer pair described above, the sequence of the upstream primer is SEQ ID NO:3, and the sequence of the downstream primer is SEQ ID NO:4.

[0010] The present invention also provides a method for distinguishing between northern and southern strains, which is to distinguish by detecting the above-mentioned molecular marker.

[0011] The present invention is more convenient than amplified fragment length polymorphism (AFLP), restriction site amplified polymorphism (RSAP), and microsatellite DNA (SSR) markers, etc. Only simple PCR amplification is required, and it can be distinguished based on the sequencing data, eliminating cumbersome experimental steps. The molecular marker provided by the present invention only requires simple PCR amplification and next-generation sequencing for rapid identification, so the detection cost is relatively low. The development of the specific molecular marker of the present invention can not only avoid the mixing of seedlings in production, but also lay a foundation for the evaluation and identification of subsequent new strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 : Electrophoresis diagram of the amplification products of the rps14-10 sequence marker in the northern and southern strains, where M is the 2000bp DNA ladder marker; lanes 2-5 are the northern aquaculture strain, series Zhongke 1 (ZK1); lanes 6-9 are the northern aquaculture strain, series Zhongke 2 (ZK2); lanes 11-14 are the southern aquaculture strain, Guanwu local strain (GW); lanes 16-19 are the southern aquaculture strain, Putian local strain (PT).

[0013] Figure 2 : Result diagram of the mitochondrial rps14-10 sequence alignment of the northern Laminaria japonica strains (ZK1 and ZK2) and the southern aquaculture strains (GW and PT);

[0014] Figure 3 : Mitochondrial rps14-10 sequence alignment diagram of the Rongfu (RF) and Huangguan (HG) strains mixed in the same farm. DETAILED DESCRIPTION OF THE INVENTION

[0015] The molecular marker screened by the present invention can not only accurately distinguish between the northern and southern aquaculture strains, but also avoid the mixing of seedlings in production, and can also lay a foundation for the evaluation and identification of subsequent new strains.

[0016] The present invention will be described in detail below in conjunction with embodiments and the accompanying drawings.

[0017] Example 1: Screening molecular markers for differentiating between northern and southern strains of Saccharina japonica

[0018] Integrate all the sequenced mitochondrial genomes of Saccharina japonica, and then use bioinformatics software for whole-genome alignment to screen for genes with high mutation rates. Design primers using the primer3plus online website, and the sequence information of the primer sequence pairs is as follows:

[0019] Forward sequence: 5′-TGGATTACAAACGCCGCAAA-3′ (SEQ ID NO:3), Reverse sequence: 5′-ATAGCGTCGATACTCCCGTC-3′ (SEQ ID NO:4).

[0020] First, screen among 20 northern and southern cultured individuals (5 of the Zhongke 1 series; 5 of the Zhongke 2 series; 5 of the Guanwu local strain; 5 of the Putian local strain) (sampling information is shown in Table 1), and it is found that there are four mutated sites in the mitochondrial rps14-10 sequence among the northern and southern cultured strains, which can accurately distinguish between the northern and southern cultured strains ( Figure 1 and Figure 2 ). In order to further verify the universality of the molecular marker, 50 individuals in total, including 35 northern cultured individuals and 15 southern cultured individuals (Table 1), are used for PCR amplification and verification, and it is found that at least 4 mutated sites in the rps14-10 sequence can distinguish between the northern and southern cultured strains.

[0021] Table 1: Sample collection information table of northern and southern Saccharina japonica

[0022]

[0023]

[0024] The specific method includes the following steps:

[0025] 1. Extract the thallus DNA of the Saccharina japonica strain to be detected

[0026] Take the thalli of typical northern and southern Saccharina japonica cultured strains for DNA extraction, and the steps are as follows:

[0027] 1) Take about 100 mg of fresh tissue, wash it with ultrapure water, and dry it with a paper towel. Put it into a 2 ml centrifuge tube with steel beads. After pre-cooling the sample, put it into a grinder and grind it into powder.

[0028] 2) Quickly transfer the ground powder into a centrifuge tube pre-filled with 700 μl of buffer GP1 (for cell lysis) preheated to 65 °C (add mercaptoethanol to the preheated GP1 before the experiment to a final concentration of 0.1%). After quickly inverting and mixing well, place the centrifuge tube in a 65 °C water bath for about 30 min. During the water bath, invert the centrifuge tube several times to mix the sample.

[0029] 3) Add 700 μl (equal volume) of phenol-chloroform-isoamyl alcohol (25:24:1), mix well, and centrifuge at 12000 rpm for 5 min at room temperature.

[0030] 4) Carefully transfer the upper aqueous phase to a new centrifuge tube, and add 700 μl of buffer GP2, then mix well.

[0031] 5) Transfer the mixed liquid to adsorption column CB3, centrifuge at 12000 rpm for 30 s, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0032] 6) Add 500 μl of buffer GD to adsorption column CB3, centrifuge at 12000 rpm for 30 s, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0033] 7) Add 600 μl of washing buffer PW to adsorption column CB3, centrifuge at 12000 rpm for 30 s, pour out the waste liquid, and put the adsorption column CB3 back into the collection tube.

[0034] 8) Repeat step 7.

[0035] 9) Put the adsorption column CB3 back into the collection tube, centrifuge at 12000 rpm for 2 min, pour out the waste liquid, and place the adsorption column CB3 at room temperature for 4 min to thoroughly dry the residual washing buffer in the adsorption material.

[0036] 10) Transfer the adsorption column CB3 into a clean centrifuge tube, suspend and add 60 μl of elution buffer TE to the middle part of the adsorption membrane. After standing at room temperature for 4 min, centrifuge at 12000 rpm for 2 min. Re-add the eluted DNA to the adsorption column and centrifuge at 12000 rpm for 2 min to increase the DNA concentration. Store the extracted DNA at -20 °C.

[0037] 2. PCR Amplification and Agarose Gel Electrophoresis Detection

[0038] This marker has a high amplification efficiency. The extracted DNA can be directly used for PCR amplification without purification. The 50 μL reaction system includes: 25 μL of Mix, 22 μL of ddH20, 1 μL of DNA template, and 1 μL each of forward and reverse primers (10 μmol / L).

[0039] Reaction procedure: The reaction was carried out in a TAKRA PCR instrument. Pre-denaturation was performed at 94°C for 2 min, followed by 35 cycles. Denaturation at 94°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 30 s. After the cycle was completed, extension was carried out at 72°C for 2 min.

[0040] After the reaction was completed, 5 μl of the amplification product was taken and subjected to electrophoresis detection in 1.0% agarose gel. The electrophoresis buffer was 1×TAE, the voltage was 120 V, and electrophoresis was stopped after 30 min. The results were recorded by photographing with a gel imaging system.

[0041] It was found that the primers with sequences SEQ ID NO:3 and SEQ ID NO:4 had high amplification efficiency in the northern and southern kelp culture strains, and a single band could be amplified. The sequencing results are as follows:

[0042] Sequencing results of the northern breeding strain (SEQ IDNO:1) As follows: CAAACCAAAATTTAGAGATTTCTTTACGTTGGTGGGCTCAATTAGAAAAATCTAAATTACCTCGAAAAAGTAGTTTAAGTAGAGTTCATAATCATTGTATTGATACTAATAGATCAAGATCGGTTATAAGTTTTTATAAATTATCCCGTCTTCAATTCAGACGTTTGGCATCAAAAGGTTCTTTTACAGGTTTACGTAAAGCATGTTGGTAATATTTCCAGCATATGTTTAACTAAAAGTATTATTTTTGGGTAAAGTGTACGTAAAGTTTAGGTTCTGGAATAGAGATACCTTTAATATTAAGGGGAATAGCTTTATTGATAAAGTATAGGTGCGGGGAGGTTTTTAATTATTTCAGGTGACCTTTAAAATTTTAATTATTTATATATGCCTCAATTTGATATATTGACCTTCTTCAATCAGGTTTTTTGGTTAATCCTGATAGTTTTTAATTTTTATTTGGTAGTTGTACGTTTTATATTACCTTCTTTAGCCTTTAGTTTAAAATCTAGAATAAAACACTTAAAAGTAACCGTTGATTCTAGATAATAACTTAAAATTTAATAAATTTTATAGCTTGTTAGAGACAAAGTTATATAAACTCAAACTTCTAGTGTGGAGTTAATAATAGTAATAAGTAACTTAATATTAAACCCCTGGCAAGGTAGCTTTTGGAGGTGTTGCTGAGTGGTTGAAAGCCTTGGTTTGCTAAATCAATCTACATTTTTAATGTAGCGTGGGTTCGAATCCTACCACCTCCAAAAAGAAAAAGTAACTCAGGTGGTAGAGTGCTGGTTTGTCATACCAGTGGTCGCGGGTTCAAGTCCCGTCTTTTTCGAGGTATATTTTACACTGTAGAATTATTTTAGGGTTATTTATTAAGCATGTAGTTAAATATATGGCACAGTATAAAAAAAGCATTCTATATATATGTAAAGTTTGGTCTGTATCGACTGACTTTAAAAGTTTAAATTCTTTG。

[0043] Sequencing results of the southern breeding strain (SEQ IDNO:2) is as follows: CAAACCAAAATTTAGAGATTTCTTTACGTTGGTGGGCTCAATTAGAAAAATCTAAATTACCTCGAAAAAGTAGTTTAAGTAGAGTTCATAATCATTGTATTGATACTAATAGATCAAGATCGGTTATAAGTTTTTATAAATTATCCCGTCTTCAATTCAGACGTTTGGCATCAAAAGGTTCTTTTACAGGTTTACGTAAAGCATGTTGGTAATATTTCCAGCATATGTTTAACTAAAAGTATTATTTTTGGGTAAAGTGTACGTGAAGTTTAGGTTCTGGAATAGAGATACCTTTAATATTAAGGGGAATAGCTTTATTGATAAAGTATAAGTGCGGGGAGGTTTTTAATTATTTCAGGTGACCTTTAAAATTTTAATTATTTATATATGCCTCAATTTGATATATTGACCTTCTTCAATCAGGTTTTTTGGTTAATCCTGATAGTTTTTAATTTTTATTTGGTAGTTGTACGTTTTATATTACCTTCTTTAGCCTTTAGTTTAAAATCTAGAATAAAACACTTAAAAGTAACCGTTGATTCTAGATAATAACTTAAAATTTAATAAATTTTATAGCTTGTTAGAGACAAAGTTATATAAACTCAAACTTCTAGTGTGGAGTTAATAATAGCAATAAGTAACTTAATATTAAACCCCTGGCAAGGTAGCTTTTGGAGGTGTTGCTGAGTGGTTGAAAGCCTTGGTTTGCTAAATCAATCTACATTTTTAATGTAGCGTGGGTTCGAATCCTACCACCTCCAAAAAGAAAAAGTAACTCAGGTGGTAGAGTGCTGGTTTGTCATACCAGTGGTCGCGGGTTCAAGTCCCGTCTTTTTCGAGGTATATTTTACACTGTAGAATTATTTTAGGGTTATTTATTAAGCATGTAGTTAAATATATGGCACAGTATAAAAAAAGCATTATATATATATGTAAAGTTTGGTCTGTATCGACTGACTTTAAAAGTTTAAATTCTTTG。

[0044] Example 2: Using screened markers to quickly distinguish between southern and northern Laminaria japonica strains in the same farm

[0045] The parent of Huangguan No. 1 is from the Laminaria japonica farming population in Lianjiang County, Fujian Province, so it belongs to the southern farming strain. However, in recent years, Huangguan No. 1 has not only been widely farmed in the southern region, but also promoted in northern coastal areas such as Liaoning and Shandong. Rongfu Laminaria japonica represents the northern farming strain, and because of its high temperature tolerance and other characteristics, it can also be farmed in southern waters. Therefore, it is quite common for southern and northern farming strains to coexist in the same farm.

[0046] In the Lidao Farm in Rongcheng, Shandong, there are both the northern Rongfu strain and the southern Huangguan No. 1 strain. For further strain identification, we collected 5 samples from each strain and analyzed them using the mitochondrial rps14-10 sequence. First, extract the thallus DNA of the sample to be detected, and use primers (SEQ ID NO: 3 and SEQ ID NO: 4) to amplify the rps14-10 sequence (the experimental steps refer to Example 1). Then perform second-generation sequencing and compare it with the southern (SEQ ID NO: 2) and northern (SEQ ID NO: 1) sequences ( Figure 3 ). The sequencing results show that the Huangguan strain is completely consistent with the SEQ ID NO: 2 sequence, and the Rongfu strain is completely consistent with the SEQ ID NO: 1 sequence. The sequencing results further illustrate that this molecular marker can effectively identify southern and northern farming strains.

[0047] In summary, the mitochondrial marker provided by the present invention has good stability, good discrimination in different farming strains, is not affected by the environment, and is conducive to the identification of germplasm and the evaluation of new strains.

Claims

1. A molecular marker for identifying northern and southern kelp culture strains, characterized in that: The nucleotide sequence of the specific molecular marker of the northern strain in the molecular marker is SEQ ID NO: 1, and the nucleotide sequence of the specific molecular marker of the southern strain is SEQ ID NO:

2.

2. Use of the molecular markers described in claim 1 in identifying southern and northern kelp culture strains.

3. Use of the primer pair for detecting the molecular marker according to claim 1 in the preparation of a molecular detection product for identifying the cultured strains of kelp in the north and south.

4. The use according to claim 3, characterized in that The molecular detection product is a PCR amplification sequencing detection kit.

5. The use according to claim 3, characterized in that The upstream primer of the primer pair has a sequence of SEQ ID NO: 3, and the downstream primer has a sequence of SEQ ID NO:

4.

6. A PCR amplification sequencing detection kit for identifying northern and southern kelp culture strains, characterized in that: The kit comprises a primer pair for detecting the molecular marker according to claim 1.

7. A method for distinguishing southern and northern strains of kelp, characterized in that: The method is to distinguish and identify by detecting the molecular marker described in claim 1.

Images