Sleep-improving agent

Abstract

The invention relates to a sleep improving agent. The present invention provides a heat shock protein expression-inducing agent, and specifically provides a heat shock protein expression-inducing agent containing a compound represented by formula (I) or a salt thereof: # imgabs0 # [in the formula, R is a lower alkyl group, a phenyl group, or a hydroxyphenyl group].

Description

This application is a divisional application of the patent application "Sleep improver" with an application date of May 26, 2017 and an application number of 201780045763.X (International Application No. PCT / JP2017 / 019644). Technical Field

[0001] This patent application claims priority from Japanese Patent Application No. 2016-105477, and the entire content of this patent application is incorporated herein by reference. The present invention relates to a heat shock protein expression inducer, a sleep improver, an anti-stress agent, and an autonomic nerve regulator. Background Art

[0002] Living organisms have various defense mechanisms to adapt to the breeding environment. For example, when the breeding temperature rises by 5°C to 10°C, the three-dimensional structure of cellular proteins begins to change due to thermal denaturation, and a mechanism is known to repair this change by a group of proteins called "chaperones". Representative proteins that achieve the chaperone function are known as heat shock proteins (hereinafter also referred to as "HSP"). In mammals, more than a dozen HSPs have been reported so far. They are classified into the HSP20 family, HSP40 family, HSP70 family, HSP90 family, etc. according to their molecular weights.

[0003] HSP is also called stress protein and is strongly expressed in living organisms in response to environmental stress, pathological stress, psychological stress, etc. The HSP expressed in living organisms plays the role of "specifically binding to a protein whose higher structure has partially changed due to various stresses and is about to lose its original physiological function, and using the energy generated by ATP hydrolysis to restore the higher structure of the bound protein to its original structure and restore the physiological function". Such HSP helps to maintain the defense of living organisms or homeostasis in the living body. As long as the expression of HSP can be induced in the living body, it is effective in preventing or improving various diseases or symptoms caused by abnormalities in the higher structure of proteins, or various diseases or symptoms related to HSP.

[0004] Among HSPs, especially HSP70 has been intensively studied. In recent years, the relationship between HSP70 and sleep (Non-Patent Documents 1 and 2) or the relationship between HSP70 and stress (Non-Patent Documents 3 and 4) has been clarified, and it has also been understood that there is a close correlation between stress and autonomic nerve disorders. Therefore, the chaperone function of HSP70 is considered to help recover from damage caused by sleep deprivation, daily stress, autonomic nerve disorders, etc. Therefore, there have been studies on applying HSP70 expression-inducing substances to pharmaceuticals, quasi-drugs, etc. These substances are reported to be, for example, zerumbone, etc. (Patent Document 1). Background Art Documents Patent Documents

[0005] [Patent Document 1] WO 2012 / 043808 Non-Patent Documents

[0006] [Non-Patent Document 1] Doklady Biological Sciences, 2013, Vol. 449, pp. 89 - 92 [Non-Patent Document 2] Doklady Biological Sciences, 2015, Vol. 461, pp. 76 - 79 [Non-Patent Document 3] Exp. Ther. Med. 2012, Oct; 4(4), 627 - 632 [Non-Patent Document 4] J. Biol_Chem. 2000, Vol. 275, No. 27, 20822 - 20828 Summary of the Invention (Problems to be Solved by the Invention)

[0007] An object of the present invention is to provide an HSP expression inducer, a sleep improver, an anti-stress agent, an autonomic nerve regulator, etc. containing an active ingredient having an excellent HSP expression-inducing effect. (Means for Solving the Problems)

[0008] The present inventors conducted in-depth research to solve the above problems and found that proline-3-alkyl-diketopiperazine represented by the following general formula (I) or a salt thereof has an excellent HSP expression-inducing effect, and based on this, shows a sleep-improving effect, an anti-stress effect, an autonomic nerve regulating effect, etc., thus completing the present invention. That is, the present invention includes the following aspects. [1] A heat shock protein expression inducer containing a compound represented by formula (I) or a salt thereof:

[0009] Formula (I) [In the formula, R is a lower alkyl group, a phenyl group or a hydroxyphenyl group]. [2] The heat shock protein expression inducer according to the above [1], wherein R is an isopropyl group, a phenyl group or a hydroxyphenyl group. [3] The heat shock protein expression inducer according to the above [1], wherein R is an isopropyl group. [4] The heat shock protein expression inducer according to any one of [1] to [3] above, which is in the form of a pharmaceutical composition, a quasi-pharmaceutical composition or a food or drink composition. [5] A sleep improver, which contains a compound represented by formula (I) or a salt thereof: Formula (I)

[0010] [In the formula, R is a lower alkyl group, a phenyl group or a hydroxyphenyl group]. [6] The sleep improver according to [5] above, wherein R is an isopropyl group, a phenyl group or a hydroxyphenyl group. [7] The sleep improver according to [5] above, wherein R is an isopropyl group. [8] The sleep improver according to any one of [5] to [7] above, which is in the form of a pharmaceutical composition, a quasi-pharmaceutical composition or a food or drink composition. [9] An autonomic nerve regulator, which contains a compound represented by formula (I) or a salt thereof: Formula (I)

[0011] [In the formula, R is a lower alkyl group, a phenyl group or a hydroxyphenyl group].

[10] The autonomic nerve regulator according to [9] above, wherein R is an isopropyl group, a phenyl group or a hydroxyphenyl group.

[11] The autonomic nerve regulator according to [9] above, wherein R is an isopropyl group.

[12] The autonomic nerve regulator according to any one of [9] to

[11] above, which is in the form of a pharmaceutical composition, a quasi-pharmaceutical composition or a food or drink composition.

[13] A stress resistance agent, which contains a compound represented by formula (I) or a salt thereof: Formula (I)

[0012] [In the formula, R is a lower alkyl group, a phenyl group or a hydroxyphenyl group].

[14] The stress resistance agent according to

[13] above, wherein R is an isopropyl group, a phenyl group or a hydroxyphenyl group.

[15] The stress resistance agent according to

[13] above, wherein R is an isopropyl group.

[16] The stress resistance agent according to any one of

[13] to

[15] above, which is in the form of a pharmaceutical composition, a quasi-pharmaceutical composition or a food or drink composition. Effects of the invention

[0013] According to the present invention, there can be provided an HSP expression inducer, a sleep improver, an anti-stress agent, an autonomic nerve regulator, etc. having one or more of the following effects: (1) Inducing the expression of HSP70; (2) Improving sleep in terms of quality, specifically improving one or more of sleep quality, sleep-wake rhythm, deep sleep feeling, waking-up feeling, fatigue upon waking up, daytime sleepiness, work efficiency, depressive mood caused by sleep deprivation, etc.; (3) Anti-stress effect; (4) Autonomic nerve regulation effect; (5) In addition, preventing or improving various diseases or symptoms caused by abnormal higher-order structures of proteins, or various diseases or symptoms associated with HSP. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is a graph showing the amount of HSP70 mRNA expression caused by proline-3-alkyl-diketopiperazine (Compound 1). Figure 2 It is a graph showing the amount of HSP70 mRNA expression caused by proline-3-alkyl-diketopiperazine (Compound 2). Figure 3 It is a graph showing the amount of HSP70 mRNA expression caused by proline-3-alkyl-diketopiperazine (Compound 3). Figure 4 It is a graph showing the change in the activity amount of rats during the light period after phase advancement. Figure 5 It is a graph showing the activity amount of rats during the light period (12 hours) on the first day after phase advancement. DETAILED DESCRIPTION OF THE INVENTION

[0015] The HSP expression inducer of the present invention contains proline-3-alkyl-diketopiperazine represented by the following general formula (I) or a salt thereof as an active ingredient: General formula (I)

[0016] [In the formula, R is a lower alkyl group, a phenyl group or a hydroxyphenyl group].

[0017] The "lower alkyl group" in the above formula (I) refers to a linear or branched alkyl group having 1 to 6 carbon atoms, and specifically, methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, neopentyl, hexyl, isohexyl, etc. can be mentioned. Preferred is a linear or branched alkyl group having 1 to 4 carbon atoms, and for example, isopropyl can be mentioned.

[0018] R in the above formula (I) is a lower alkyl group, a phenyl group or a hydroxyphenyl group, preferably an isopropyl group, a phenyl group or a hydroxyphenyl group, and particularly preferably an isopropyl group.

[0019] Among the proline-3-alkyldiketopiperazines of the above formula (I), particularly preferred examples include the following Compounds 1 to 3 (especially Compound 1).

[0020] (Compound 1) Name: (3S,8aS)-3-isobutylhexahydropyrrolo[1,2-a]pyrazine-1,4-dione Abbreviation: Cyclo(L-Leu-L-Pro)

[0021] (Compound 2) Name: (3S,8aS)-3-benzylhexahydropyrrolo[1,2-a]pyrazine-1,4-dione Abbreviation: Cydo(L-Phe-L-Pro)

[0022] (Compound 3) Name: (3S,8aS)-3-(4-hydroxyphenylmethyl)hexahydropyrrolo[1,2-a]pyrazine-1,4-dione Abbreviation: Cyclo(L-Tyr-L-Pro)

[0023] Examples of the salts of the above proline-3-alkyldiketopiperazines include salts permissible in the fields of pharmaceuticals and foodstuffs, and examples thereof include salts formed with inorganic bases, salts formed with organic bases, salts formed with basic amino acids, and the like. Preferred examples of the salts formed with inorganic bases include, for example, alkali metal salts such as sodium salts and potassium salts; alkaline earth metal salts such as calcium salts and magnesium salts; ammonium salts and the like. Preferred examples of the salts formed with organic bases include, for example, salts formed with alkylamines (trimethylamine, triethylamine, etc.), heterocyclic amines (pyridine, methylpyridine, etc.), alkanolamines (ethanolamine, diethanolamine, triethanolamine, etc.), dicyclohexylamine, N,N'-dibenzylethylenediamine, and the like. Preferred examples of the salts formed with basic amino acids include, for example, salts formed with spermine, lysine, ornithine, and the like. Among these salts, alkali metal salts or alkaline earth metal salts are preferred. A sodium salt is preferred.

[0024] The proline-3-alkyl-diketopiperazine or its salt used in the present invention can be prepared according to methods well known in the art, such as chemical synthesis methods, enzymatic methods, microbial fermentation methods, etc. Specifically, it can be synthesized by subjecting a linear peptide to a dehydration / cyclization reaction. For example, it can be prepared according to the methods described in Japanese Patent Application Laid-Open No. 2003-252896 and J. Peptide Sci., 10, 737-737 (2004). In addition, the above Compounds 1 to 3 are known compounds and can be purchased from, for example, BACHEM.

[0025] In the present invention, the above proline-3-alkyl-diketopiperazine or its salt can be used alone as an active ingredient, or two or more kinds can be used. For example, one kind of the above Compounds 1 to 3 can be used alone, or two or three kinds can be used. For example, when two kinds of the above Compounds 1 to 3 are used, their usage ratios are not particularly limited. For example, when using two kinds of Compound 1 and Compound 2, Compound 1:Compound 2 = 10 to 0.5:3 to 0.1, preferably 6 to 1:2 to 0.5; when using two kinds of Compound 1 and Compound 3, Compound 1:Compound 3 = 10 to 0.5:5 to 0.5, preferably 6 to 1:4 to 0.7; when using two kinds of Compound 2 and Compound 3, Compound 2:Compound 3 = 3 to 0.1:5 to 0.5, preferably 0.5:4 to 0.7. In addition, for example, when using all the above Compounds 1 to 3 (three kinds), their usage ratios are not particularly limited. For example, Compound 1:Compound 2:Compound 3 = 10 to 0.5:3 to 0.1:5 to 0.5, preferably 6 to 1:2 to 0.5:4 to 0.7.

[0026] The above proline-3-alkyl-diketopiperazine or its salt has an excellent HSP expression-inducing effect. Therefore, the HSP expression inducer of the present invention containing this compound as an active ingredient is effective in preventing or improving various diseases or symptoms caused by abnormal higher-order structures of proteins, or various diseases or symptoms related to HSP. In the present invention, the HSP to be the object of expression induction includes: HSP20 family proteins such as HSP20, HSP27, HSP28; HSP40 family proteins such as HSP40, HSP47; HSP70 family proteins such as HSP70, HSP72, HSP73; HSP90 family proteins such as HSP90a, HSP90b. Preferably, it is an HSP70 family protein, and more preferably HSP70. In the present invention, the expression induction of HSP includes expression in vivo and in vitro, and preferably in vivo. In addition, the internal site of the organism where HSP expression is induced preferably includes the brain.

[0027] The above-mentioned proline-3-alkyl-diketopiperazine or its salt exhibits excellent sleep improvement effects, anti-stress effects, autonomic nerve regulation effects, etc., based on the HSP expression induction effect. Therefore, the present invention also provides a sleep improver, an anti-stress agent, an autonomic nerve regulator, etc., containing the above-mentioned proline-3-alkyl-diketopiperazine or its salt as an active ingredient.

[0028] In the present invention, "sleep improvement" refers to observing an improvement effect on one or more of sleep quality, sleep-wake rhythm, sense of deep sleep, sense of waking up, fatigue upon waking up, daytime sleepiness, work efficiency, and depressive mood caused by unmet sleep. Improvement of sleep quality means shortening the sleep onset latency, reducing the number and duration of awakenings during sleep, smoothly transitioning to slow-wave sleep regarded as deep sleep after falling asleep, increasing the deep sleep time, and thereby obtaining high-quality sleep. Improvement of the sleep-wake rhythm means improving the deviation of the sleep-wake rhythm and making the bedtime-wake-up rhythm orderly. The deviation of the sleep-wake rhythm also includes social jet lag that causes the social time to be inconsistent with the biological clock due to major changes such as the light environment or work environment at night. That is, it also means a deviation in the bedtime-wake-up rhythm between weekdays with social constraints such as work and holidays without constraints, or the disruption of the organism's circadian rhythm due to irregular sleep cycles, etc. By improving sleep quality and / or sleep-wake rhythm, a sense of deep sleep can be obtained, and a comfortable sense of waking up can be obtained. In addition, daytime sleepiness or fatigue upon waking up is not felt, and daytime work efficiency is improved. Furthermore, the depressive mood caused by poor-quality sleep or deviation of the bedtime-wake-up rhythm can be alleviated. The improvement effect refers to the improvement of symptoms or conditions; the prevention or delay of the deterioration of symptoms or conditions; or the reversal, prevention, or delay of the progression of symptoms.

[0029] The "anti-stress effect" of the present invention refers to preventing fatigue caused by stress in mammals (especially humans) or preventing fatigue caused by brain stress. Here, fatigue refers to a temporary phenomenon of reduced physical and mental performance seen when continuously applying physical or mental loads. The reduction in performance refers to a reduction in the quality or quantity of physical and mental abilities.

[0030] The "autonomic nerve regulation effect" of the present invention refers to improving the imbalance of the sympathetic nerve and the parasympathetic nerve (the balance of the autonomic nerves) and the decrease in the activity of the autonomic nerves caused by excessive stress load. For example, the function of the digestive tract is mainly controlled by the parasympathetic nerve. If the sympathetic nerve is continuously tense due to stress load, the function of the digestive tract will be inhibited, causing gastrointestinal disorders such as loss of appetite and constipation. In addition, it is considered that if the parasympathetic nerve cannot function well due to stress load and the activity of the exchange nerve continues to be hyperactive, insomnia will occur. As described above, there is a close relationship between stress and the autonomic nerves, and there are also autonomic nerve disorders that are not caused by stress load. In addition, stress load does not necessarily cause autonomic nerve disorders, and there are also cases where other physical symptoms are induced.

[0031] In the present invention, the above-mentioned proline-3-alkyl-diketopiperazine or its salt can be directly used as an HSP expression inducer, sleep improver, anti-stress agent, autonomic nerve regulator, etc. (hereinafter may also be simply referred to as "HSP expression inducer, etc."). In addition, within the range that does not affect the intended effect, it can also be used in combination with carriers or food additives that can be added to pharmaceuticals or quasi-pharmaceuticals.

[0032] In addition, in the present invention, the above-mentioned proline-3-alkyl-diketopiperazine or its salt can be added as an HSP expression inducer, etc. to various pharmaceuticals, quasi-pharmaceuticals, cosmetics, and food and beverages, and used in the form of pharmaceutical compositions, quasi-pharmaceutical compositions, food and beverage compositions, etc. The above-mentioned pharmaceuticals, quasi-pharmaceuticals, food and beverages may be those that are commonly used without particular limitation, and examples include tablets, granules, capsules, powders, chewable tablets, confectionery (cookies, sweet cookies, chocolate confectionery, potato chips (chips), cakes, chewing gum, candies, gummies, Japanese steamed buns, yokan, puddings, jellies, yogurts, ice creams, sherbets, etc.), bread, noodles, rice, cereal foods, beverages (liquids, soft drinks, carbonated drinks, nutritional drinks, powdered drinks, fruit drinks, milk drinks, jelly drinks, etc.), soups (powders, freeze-dried products), miso soups (powders, freeze-dried products), etc. Food and beverages also include foods with functional claims, foods for specified health uses, health foods, nutritional supplements (supplements), therapeutic foods, etc.

[0033] There are no particular restrictions on the subjects for the HSP expression inducer of the present invention, etc. For example, subjects who subjectively feel dissatisfied with their sleep, such as light sleep, feeling sleep-deprived when waking up, difficulty falling asleep, insufficient sense of deep sleep (inability to sleep deeply), having nightmares, and inability to relieve fatigue; subjects who do not subjectively feel dissatisfied with their sleep but feel tired and hope to improve the sleep quality; subjects who feel autonomic nerve disorders; and subjects who feel stressed in daily life, etc. In addition, even for subjects without particular problems, they can be ingested daily for the purposes of maintaining good sleep, preventing sleep disorders, improving sleep quality, regulating the action of autonomic nerves, anti-stress effects, etc. In addition, the subjects in the present invention particularly refer to humans, but the present invention can also be applied to mammals other than humans (such as mice, rats, hamsters, monkeys, cows, horses, pigs, sheep, goats, dogs, cats, guinea pigs, rabbits, etc.).

[0034] Regarding the daily dosage (intake) of the HSP expression inducer of the present invention, etc., there are no particular restrictions on the above-mentioned proline-3-alkyl-diketopiperazine or its salt, and it can be appropriately set according to the purpose of administration (the disease or symptom of the subject), the form of administration, the gender, weight or age of the subject, etc. For example, for adult humans, in terms of proline-3-alkyl-diketopiperazine conversion, it is usually 0.1 μg to 1.7 g, preferably 1 μg to 1.5 g, and more preferably 5 μg to 1.3 g. In addition, the daily dosage of the above compound 1 is usually 0.5 μg to 500 mg for adult humans, preferably 1 μg to 450 mg, and more preferably 10 μg to 400 mg. The daily dosage of the above compound 2 is usually 0.1 μg to 400 mg for adult humans, preferably 2 μg to 350 mg, and more preferably 5 μg to 300 mg. The daily dosage of the above compound 3 is usually 0.1 μg to 800 mg for adult humans, preferably 2 μg to 700 mg, and more preferably 5 μg to 600 mg.

[0035] There are no particular restrictions on the timing of administration of the HSP expression inducer of the present invention, etc., and it is preferably administered (ingested) once a day before going to bed.

[0036] In addition, the present invention provides the above-mentioned proline-3-alkyl-diketopiperazine or its salt for use as an HSP expression inducer, a sleep improver, an anti-stress agent, an autonomic nerve regulator, etc. Furthermore, the present invention provides the use of the above-mentioned proline-3-alkyl-diketopiperazine or its salt for manufacturing an HSP expression inducer, a sleep improver, an anti-stress agent, an autonomic nerve regulator, etc. In addition, the present invention provides a method for inducing HSP expression, a method for improving sleep, a method for resisting stress, a method for autonomic nerve regulation, etc., which comprises: administering the above-mentioned proline-3-alkyl-diketopiperazine or a salt thereof to a subject. The definitions of the terms in these aspects, the above-mentioned proline-3-alkyl-diketopiperazine or a salt thereof, its usage form, the subject, the dosage, the administration timing, the formulation amount in each agent, etc. are the same as those described above. Examples

[0037] Next, representative examples are listed, but the present invention is not limited to these examples. In addition, unless otherwise specified, "%" means "% by weight".

[0038] (Example 1) Evaluation of the effect of inducing HSP70 mRNA expression The effect of inducing HSP70 expression of Compounds 1 to 3 was evaluated by measuring the mRNA expression level of HSP70. Leukemia cell line cells (HL-60 cells) were suspended in RPMI 1640 medium supplemented with 10% fetal bovine serum and seeded in 1.5 mL tubes (45,000 cells / 0.9 mL). 0.1 mL of the specimen prepared in a 1% DMSO solution was added and left standing at 37 °C for 4 hours. In the control group, 0.1 mL of a 1% DMSO solution was added. After culturing for 4 hours, the cells were centrifuged using a small cooling centrifuge (1,000 g × 5 minutes) to precipitate the HL-60 cells. After removing the supernatant, the cells were dissolved in 0.25 mL of Trizol (manufactured by Thermo Fisher Scientific) and total RNA was extracted as per the protocol. After dissolving in RNase free water, the RNA concentration (wavelength 260 nm) was measured using a NanoDrop2000 / 2000c (manufactured by Thermo Fisher Scientific), a very low-volume spectrophotometer. The RNA solution was diluted to a concentration of 50 ng / mL with RNase free water and ReverTra Ace (R) qPCR RT Kit (manufactured by TOYOBO) was used to synthesize cDNA. The reverse-transcribed reaction solution (10 μL) was diluted to 100 μL with RNase free water and used as a template for PCR. The beta 2 microglobulin gene was used as an internal standard gene for correcting the HSP70 gene expression. The primer sequences of each gene used in the PCR reaction are shown below. HSP70 forward primer: GCATTTCCTAGTATTTCTGTTTGT (SEQ ID NO: 1) HSP70 reverse primer: AATAGTCGTAAGATGGCAGTATA (SEQ ID NO: 2) β2-microglobulin forward primer: TAGCTGTGCTCGCGCTACT (SEQ ID NO: 3) β2-microglobulin reverse primer: AGTGGGGGTGAATTCAGTGT (SEQ ID NO: 4)

[0039] Expression analysis was performed using a CFX Connect real time PCR analysis system (manufactured by Bio-rad). 10 μL of the reaction solution was incubated at 95°C for 3 minutes (initial denaturation), and then 55 cycles of denaturation at 95°C for 10 seconds, annealing at 57.8°C for 30 seconds, and elongation were repeated. Finally, the melting curve was measured from 65°C to 95°C at intervals of 0.2°C. The Bio-Rad CFX Manager 3.1 was used to analyze the expression levels of the HSP70 gene and the internal standard gene.

[0040] Figures 1 to 3 These represent the percentages of the HSP70 mRNA expression induction ability of Compounds 1, 2, and 3 relative to the control group. From these results, it was clear that the mRNA expression of the HSP70 gene was enhanced in any of the specimens compared to the control group. In addition, when studying the concentration dependence of the HSP70 mRNA expression induction ability of each active ingredient, the concentrations at which the HSP70 mRNA expression induction ability increased to 150% relative to the control group were 0.083 mg / mL for Compound 1, 0.045 mg / mL for Compound 2, and 0.101 mg / mL for Compound 3.

[0041] (Example 2) The small activity meter (NanoTag (R), (manufactured by Kissei Comtec Co., Ltd.) was implanted into the abdominal cavity of 7-week-old male Wistar rats. Then, after a one-week recovery period, the rats were stratified and randomly assigned into 4 groups (control group, compound A-1 group, compound A-2 group, compound A-3 group; n = 17 for each group) based on body weight, and the test diet was given as a mixed diet. At the time point of 15 days after the start of the mixed diet administration, the light-dark cycle was advanced by 8 hours, and then the test diet was continuously given as a mixed diet for another 2 weeks. In addition, except on the day of the cycle advancement, the light-dark cycle of the breeding environment was set to a 12-hour cycle, and the illuminance during the light period was set to approximately 200 Lx (185 to 230 LX). For this mild sleep disorder model caused by the cycle advancement, the effect of the test diet on the activity level during the light period after the cycle advancement was investigated. In addition, a two-sided test was performed for the verification, the significance level of the verification was 5%, and a 10% difference on both sides was considered as a tendency difference. The analysis was performed using SAS software release 9.3 (manufactured by SAS Institute Japan Co., Ltd.). [Table 1] Group (n = 17) Test diet Control group MF Compound A-1 MF containing 0.0005% of Compound A (equivalent to 0.62 mg / kg BW / day) Compound A-2 MF containing 0.005% of Compound A (equivalent to 6.25 mg / kg BW / day) Compound A-3 MF containing 0.05% of Compound A (equivalent to 62.46 mg / kg BW / day) MF: MF (powder) for experimental animals (manufactured by Oriental Yeast Co., Ltd.) Compound A: (3S,8aS)-3-isobutylhexahydropyrrolo[1,2-a]pyrazine-1,4-dione (the above compound 1) BW: Body Weight (body weight)

[0042] [Results] Figure 4 It is a graph showing the change in the activity level of rats during the light period after the cycle advancement. The horizontal axis represents the number of days elapsed since the cycle advancement, and the vertical axis represents the activity level during the light period (12 hours). The activity level is expressed as the mean ± standard error. In addition, "the first 3 days" represents the average activity level during the light period of the 3-day pre-administration period. The shape of the curve shows that the activity level increased after the cycle advancement and returned to the activity level before the cycle advancement as the number of days passed.

[0043] Regarding by Figure 4The activity levels during the light periods on the 1st and 2nd days when the activity level increased significantly were used to confirm the effect of Compound A. The Dunnett test with Mixed-model for repeated measures method was performed. As a result, in the Compound A-3 group, there was a tendency to inhibit the activity level more than the control group (P = 0.0978), and in the Compound A-2 group, the inhibition was more significant than the control group (P = 0.0481). This suggests that Compound A inhibits the sleep disorder caused by phase advancement during the light periods from the 1st day to the 2nd day.

[0044] Figure 5 It shows the activity level of rats during the 12-hour light period on the 1st day after phase advancement. The horizontal axis represents each group, and the vertical axis represents the activity level during the 12-hour light period. The activity level is expressed as the mean ± standard error. When comparing groups by the Dunnett test, in the Compound A-3 group, there was a tendency to inhibit the activity level more than the control group (P = 0.0536), and in the Compound A-2 group, the activity level was more significantly inhibited than the control group (P = 0.016). This suggests that Compound A inhibits the sleep deterioration caused by phase advancement during the 12-hour light period on the 1st day.

[0045] As described above, Figure 4 and Figure 5 both showed significant differences in the initial light period when the activity level was most chaotic after phase advancement, suggesting that Compound A improves sleep quality.

[0046] (Example 3) The method described in Wada T.et al., Brain Res Bull.2006;69:388-92. EEG electrodes were implanted into the brains of 8-week-old male Wistar rats, and a 1-week recovery period was given after the operation. Then, habituation to brush stimulation (sleep deprivation stimulation) was performed for 2 to 3 days. On the test day, while monitoring the EEG data, non-rapid eye movement sleep (non-REM sleep) was disrupted with brush stimulation when detected. The effect of the test drug on disrupting non-REM sleep was verified.

[0047] (Example 4) The method described in Miyazaki K.et al., PLoS One.2013;8:e55452. Male C3H-HeN mice aged 8 to 15 weeks were housed on a paper floor mat in a cage equipped with a rotating cage. On the first day of the experiment, the housing condition was changed to a 1.5-cm water immersion state at room temperature to impose stress on them. In this state, to avoid the water immersion, the mice would live on the rotating cage. The activity status of the mice was monitored by the rotation of the rotating cage to evaluate sleep and wakefulness. Regarding the imposed stress, as long as it was evaluated after 7 consecutive days, the EEG evaluation and the evaluation based on the activity level would become similar situations.

[0048] (Example 5) The method described by Sei H. et al., Life ScL 2003; 73: 53-59. Male Wistar rats aged 10 to 12 weeks were changed from a 12-hour dark period / 12-hour light period light-dark cycle to a 4-hour dark period and 12-hour light period light-dark cycle and were housed for 1 to 7 days. For these animals, a telemetry thermometer was pre-implanted intraperitoneally to monitor their body temperature rhythm. By changing the above light-dark cycle, the modulation of the body temperature rhythm could be detected. In addition, the effects on the plasma cortisol concentration or the amount of hippocampal BDNF protein could also be monitored. Sequence listing free text

[0049] The base sequence described in Sequence No. 1 is the base sequence of the HSP70 forward primer. The base sequence described in Sequence No. 2 is the base sequence of the HSP70 reverse primer. The base sequence described in Sequence No. 3 is the base sequence of the β2-microglobulin forward primer. The base sequence described in Sequence No. 4 is the base sequence of the β2-microglobulin reverse primer.

Claims

1. Use of a compound represented by formula (I) or a salt thereof in the preparation of a sleep improver, wherein the sleep improver contains the compound represented by formula (I) or a salt thereof in the form of a food or beverage composition: Formula (I) In the formula, R is a linear or branched alkyl group having 1 to 6 carbon atoms, phenyl group or hydroxyphenyl group.

2. The use according to claim 1, wherein, R is isopropyl, phenyl or hydroxyphenyl.

3. The use according to claim 1, wherein, R is isopropyl.

Images