Myostatin gene and application of Myostatin gene mutant in regulation and control of growth and ecdysis of macrobrachium rosenbergii

Abstract

The invention provides an application of a myostatin gene and a mutant thereof in regulating growth and ecdysis of macrobrachium rosenbergii. Specifically, the invention discloses a promoter region 24bp mutant of a Macrobrachium rosenbergii Mstn (Mstn) gene and a function of the promoter region 24bp mutant of the Macrobrachium rosenbergii Mstn gene. An RNA interference technology proves that the mutant remarkably affects the growth speed and ecdysis cycle of shrimps by regulating muscle development and ecdysis pathways. Experiments show that the weight of the shrimps is reduced by 45.67%-66.67% due to mutant knock-down, the ecdysis period is prolonged by 4.5 days or more, and ecdysis related genes (Kr-h1, RXR and ECR) are abnormally expressed at the same time. The invention provides a new target for research on the growth and ecdysis mechanism of crustacean animals, and has application potential in aquaculture.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and particularly to the application of myostatin gene and its mutants in regulating the growth and molting of Macrobrachium rosenbergii. Background Art

[0002] Macrobrachium rosenbergii (Mr) is one of the largest freshwater shrimps in the world, with high economic value and good aquaculture benefits, and is deeply loved by people. According to the China Fisheries Statistical Yearbook 2024, the aquaculture output of Macrobrachium rosenbergii in China exceeded 196,300 tons in 2023 (Ministry of Agriculture and Rural Affairs, 2024).

[0003] In the prior art, there are problems such as uneven growth, high molting mortality, and loose meat quality in the aquaculture of Macrobrachium rosenbergii (Lu et al., 2018). The functional research of Mstn in crustaceans is limited to muscle regeneration (Sarasvathi et al., 2019), and its molecular mechanism for regulating growth and molting is unclear. The existing RNAi technology has not achieved growth-stage specific regulation, and mutant resources have not been developed and utilized.

[0004] Therefore, it is necessary to develop a method for regulating the growth and molting of Macrobrachium rosenbergii. Summary of the Invention

[0005] The object of the present invention is to provide the application of myostatin gene and its mutants in regulating the growth and molting of Macrobrachium rosenbergii. The present invention first discovers a 24bp deletion mutant in the promoter region of Macrobrachium rosenbergii Mstn, and through experiments, it is confirmed that it realizes the coordinated regulation of growth and molting by regulating the JH signaling pathway and the Smad pathway.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] In the first aspect of the present invention, there is provided the application of Macrobrachium rosenbergii Mstn gene in regulating the growth and molting cycle of Macrobrachium rosenbergii, characterized in that the sequence of the Macrobrachium rosenbergii Mstn gene is as shown in SEQ ID NO.1.

[0008] Further, the regulation of the growth of Macrobrachium rosenbergii includes:

[0009] Knocking down the Macrobrachium rosenbergii Mstn gene slows down the growth of Macrobrachium rosenbergii in the later stage, or promoting the expression of the Macrobrachium rosenbergii Mstn gene promotes the growth of Macrobrachium rosenbergii, thereby playing a role in regulating the growth of Macrobrachium rosenbergii;

[0010] The regulation of the molting cycle of Macrobrachium rosenbergii includes: knocking down the Mstn gene of Macrobrachium rosenbergii to extend the molting cycle of Macrobrachium rosenbergii.

[0011] In the second aspect of the present invention, a mutant of the Mstn gene of Macrobrachium rosenbergii is provided. The sequence of the gene of the mutant of the Mstn gene of Macrobrachium rosenbergii is as shown in SEQ ID NO.2. Compared with the Mstn gene of Macrobrachium rosenbergii shown in SEQ ID NO.1, there is a 24bp deletion in the 5'UTR region of the mutant.

[0012] In the third aspect of the present invention, the application of the mutant of the Mstn gene of Macrobrachium rosenbergii in regulating the growth and molting cycle of Macrobrachium rosenbergii is provided.

[0013] Furthermore, the regulation of the growth of Macrobrachium rosenbergii includes: knocking down the mutant of the Mstn gene of Macrobrachium rosenbergii to slow down the growth and molting cycle of Macrobrachium rosenbergii in the later stage, or promoting the expression of the mutant of the Mstn gene of Macrobrachium rosenbergii to promote the growth of Macrobrachium rosenbergii, thereby playing a role in regulating the growth of Macrobrachium rosenbergii;

[0014] The regulation of the molting cycle of Macrobrachium rosenbergii includes: knocking down the mutant of the Mstn gene of Macrobrachium rosenbergii to extend the molting cycle of Macrobrachium rosenbergii.

[0015] In the fourth aspect of the present invention, a method for regulating the growth and molting cycle of Macrobrachium rosenbergii is provided, by injecting an RNA interference agent of the Mstn gene of Macrobrachium rosenbergii or a mutant of the Mstn gene of Macrobrachium rosenbergii into Macrobrachium rosenbergii.

[0016] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0017] 1. The present invention for the first time discovered a mutant of the Mstn gene of Macrobrachium rosenbergii. Subsequently, taking the mutant of 24 bases in the Mstn gene and its promoter region of Macrobrachium rosenbergii as the research object, the regulation research of the Mstn gene and its mutant in Macrobrachium rosenbergii was carried out, providing a theoretical basis for analyzing the function of Mstn in crustaceans. The spatio-temporal expression results of the Mstn gene showed that this gene was expressed in both embryonic development and body tissues, and the expression level was the highest in the gastrula stage and hepatopancreas; during the molting cycle, the expression level of this gene from high to low was the post-molting stage (stage A), the pre-molting stage (stage D3), and the molting stage (stage E). The knockdown results of the two genotypes (normal and deletion) in the promoter region of this gene showed that: after knocking down the two Mstn genotypes, the growth rate of the shrimp was significantly lower than that of the non-knockdown group, while the average molting cycle was significantly higher than that of the non-knockdown group;

[0018] 2. The detection results of three molting-related genes showed that Mstn affected the expression of molting-related genes. The knockdown experiment was continued on the second-generation offspring of the two knockdown groups, and the results also showed that knockdown of the promoter region of this gene prolonged the molting cycle of shrimp and caused slow growth of Macrobrachium rosenbergii. This study clarified the functions of the Mstn gene and its mutants of Macrobrachium rosenbergii in its growth and molting, laying a foundation for exploring the regulatory mechanism of this gene in crustaceans.

[0019] 3. The mutants of the Mstn gene of Macrobrachium rosenbergii and its interfering reagents in the present invention have great application prospects in the synchronized aquaculture management of precisely controlling the growth cycle and molting cycle regulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0021] Figure 1 is the nucleotide and deduced amino acid sequences of MrMstn cDNA. The black numbers on the left side of each row represent the positions of nucleotides, and the red numbers represent the positions of amino acids. The yellow-highlighted region in the promoter region is the predicted auxin response element (AACGAC), the red-highlighted region is the common cis-acting element (CCAAT) in the promoter and enhancer regions, the green-highlighted region is the short sequence element (ATCTACGCTTCACG), and the underlined region represents a 24bp deletion region (GTAACATCTACGCTTCACGCTCAG). In the amino acid region, the yellow-highlighted region is the TGF-β propeptide region, and the blue-highlighted region is the mature TGF-β region.

[0022] Figure 2 . (A) Expression levels of Mstn in different tissues, (B) Expression levels of Mstn at different molting stages, each letter represents a specific stage: E: molting stage; A and B: post-molting stages; C: intermolt; D1, D2, and D3: pre-molting stages, (C) Expression levels of Mstn at nine different embryonic stages. Different letters indicate significant differences between experimental groups at the same time point (p < 0.05).

[0023] Figure 3 . (A) Expression levels of Mstn on the 1st, 3rd, 5th, 7th, and 14th days after injection of dsRNA; (B) Expression levels of Mstn after injection of five different concentrations of dsRNA. Different letters and asterisks indicate significant differences between experimental groups at the same time (p < 0.05).

[0024] Figure 4 . (A) Body weight trends of the continuous dsRNA injection group and the control group within eight weeks. (B) The body weights of the remaining Macrobrachium rosenbergii in each group were raised to 180 days. (C) Body weights of the offspring after continuous dsRNA injection for 8 weeks in the experimental group and the control group. (D) Hepatopancreas-somatic index of the experimental group and the control group. Different letters indicate significant differences between experimental groups at the same time (p < 0.05).

[0025] Figure 5 . (A) Muscle tissue of the control group. (B) Muscle tissue of group D. (C) Muscle tissue of group N. (D) Number of muscle fibers. (E) Average area of muscle fibers. Different letters indicate significant differences between experimental groups at the same time (p < 0.05).

[0026] Figure 6 . (A) Expression level of Krüppel-homolog 1, (B) Expression level of retinoic acid-X receptor, (C) Expression level of ECR. Different letters indicate significant differences between experimental groups at the same time (p < 0.05).

[0027] Figure 7 . The average molting time of Macrobrachium rosenbergii after injection of dsRNA indicates significant differences between experimental groups at the same time (p < 0.05). Detailed implementation manners

[0028] The present invention will be specifically described below in combination with the detailed implementation manners and examples, and the advantages and various effects of the present invention will be presented more clearly therefrom. Those skilled in the art should understand that these detailed implementation manners and examples are used to illustrate the present invention, rather than to limit the present invention.

[0029] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention pertains. In case of any conflict, this specification shall prevail.

[0030] Unless otherwise specifically stated, various raw materials, reagents, instruments, and equipment used in the present invention can be obtained through market purchases or by existing methods.

[0031] To solve the technical problems of the present invention, the general idea of the present invention is as follows:

[0032] During the research on the cDNA of the Mstn gene in Macrobrachium rosenbergii by the inventors of this application, it was found that there is a natural mutation of 24 bp in the 533 - 557 bp region of the promoter 5’UTR of this gene, and the molecular regulation mechanism of this natural mutation region on the growth and molting of Macrobrachium rosenbergii is still unclear. Therefore, this article aims to clarify the molecular regulation mechanism of the Mstn gene and its mutants in Macrobrachium rosenbergii, and further provide a basis for studying the function of the Mstn gene in crustaceans.

[0033] That is, this application discovers a mutant of the Mstn gene in Macrobrachium rosenbergii. The gene sequence of the mutant of the Mstn gene in Macrobrachium rosenbergii is shown in SEQ ID NO.2. Compared with the Mstn gene in Macrobrachium rosenbergii shown in SEQ ID NO.1, there is a 24 bp deletion in the 5’UTR region of the mutant.

[0034] Then, after knocking down the promoter region (SEQ ID NO.5) of the normal Mstn gene in Macrobrachium rosenbergii and the mutant of the Mstn gene in Macrobrachium rosenbergii respectively, it was found that the growth rate of shrimp in both groups was significantly lower than that of the non - knocked - down group, while the average molting cycle was significantly higher than that of the non - knocked - down group. This indicates that knocking down the promoter region of the Mstn gene in Macrobrachium rosenbergii (including the normal gene and the mutant gene) prolongs the molting cycle of shrimp and causes slow growth of Macrobrachium rosenbergii.

[0035] According to the above conclusions, it can be applied in regulating the growth and molting of Macrobrachium rosenbergii. For example:

[0036] I. Reverse application: Precise control of the growth cycle

[0037] 1. Stage - based growth regulation

[0038] Application scenario: Aiming at the pain points of "rapid growth leading to a sharp increase in feed costs" or "uneven specifications" in the cultivation of Macrobrachium rosenbergii, stage - based growth inhibition can be achieved by regulating Mstn expression.

[0039] Technical path: Inject mutant dsRNA2 (5 μg / g) during the shrimp seedling stage to inhibit Mstn expression, slow down the growth of the shrimp body, and extend the cultivation cycle to the target specification (such as 20 g / tail). Resume Mstn expression 1 - 2 weeks before listing (by stopping RNAi injection) to promote rapid weight gain and shorten the slaughter time.

[0040] Advantages: Reduce feed waste and increase unit yield (such as a 15% - 20% increase in mu yield). Meet the needs of the high - end market (such as gift shrimp of specific specifications).

[0041] 2. Off - season cultivation regulation

[0042] Application scenario: When the shrimp grows slowly naturally in low temperature seasons (such as winter), Mstn inhibitors are used to maintain the basic metabolism of the shrimp, avoid excessive energy consumption, and allow the shrimp to grow rapidly after the water temperature rises.

[0043] Technical approach: Continuously inject low-dose dsRNA (2.5 μg / g / week) in winter to maintain the basic growth rate. Resume routine breeding management in spring.

[0044] Advantages: Shorten the annual breeding cycle and improve capital turnover rate.

[0045] 2. Molting cycle regulation: synchronized breeding management

[0046] 1. Batch production

[0047] Application scenario: Extending the molting cycle by 4.5 days can break the natural molting synchronization of shrimps, and achieve molting in batches and centralized harvesting through artificial control.

[0048] Technical approach: partially inject mutant dsRNA into the shrimp population, so that 50% of the individuals have a longer molting cycle, and the other 50% remain normal. Harvest the shrimp in the extended molting group in batches (e.g., harvest twice with an interval of 7 days) to avoid the risk of "concentrated molting death" in traditional farming.

[0049] Advantages: Improve survival rate (reduce mortality during molting period), increase annual production by 20%.

[0050] 2. Disease prevention and control window period

[0051] Mechanism: The extension of the molting cycle may weaken the shrimp's resistance to pathogens (such as white spot disease, EMS), but this characteristic can also be used to stagger the peak period of disease.

[0052] Application scenarios: According to experimental data, the mortality rate of the mutant group during the high temperature period (28°C) was 12% lower than that of the control group. The mutant dsRNA can be injected in advance during the shrimp disease epidemic period (such as summer) to delay molting to a safe period (such as after the water temperature drops).

[0053] The present application will be described in detail below with reference to embodiments and experimental data.

[0054] Example 1

[0055] 1. Methods

[0056] 1.1 Primer design

[0057] The Mstn gene cDNA sequence was screened out using the transcriptome data of Macrobrachium rosenbergii obtained by our team (GenBank No: PRJNA884099) (sequence see Figure 1)。Specific primers for the target gene Mstn, the reference gene β-actin, and the molting-related genes (Retinoid-X receptor, Krüppel-homolog1, and Ecdysone Receptor) were designed using Primer Premier 5.0 (Premier, Canada) (Table 1).

[0058] Table 1

[0059]

[0060]

[0061] 1.2 Sample collection and spatio-temporal expression detection of Mstn

[0062] Seven tissues, including the brain (including the protocerebrum, midbrain, and hindbrain), stomach, intestine, heart, hepatopancreas, muscle, and gonad of Macrobrachium rosenbergii (body weight 5 ± 0.32 g), were collected for the detection of Mstn in the body tissues of Macrobrachium rosenbergii. Samples at nine different embryonic development stages, including unfertilized eggs, fertilized eggs, cleavage stage (8 cells), early multi-cellular morula stage (64 cells), early multi-cellular morula stage (128 cells), morula stage (256 cells), blastula stage, gastrula stage, and larval stage, were collected according to the method described by Zhao Yunlong (Zhao et al., 1998) for the detection of Mstn expression levels at different embryonic development stages of Macrobrachium rosenbergii. Muscle tissue samples at seven different molting cycles, including pre-molting stages (D1, D2, and D3 stages), molting stage (E stage), post-molting stage 0-5 h (A stage), post-molting stage 5-24 h (B stage), and intermolt stage (C stage), were divided and collected according to the method described by Lu Xubin (Lu et al., 2018). According to the research conclusion of Covi (Covi et al., 2010), the thoracic muscle between the first and second abdominal segments (the same below) was selected as the muscle tissue site for the detection of Mstn expression levels at different molting cycles of Macrobrachium rosenbergii. The specific operation steps for total RNA extraction, cDNA reverse transcription, and fluorescence quantitative PCR detection of the samples were referred to the method of Wang (Wang et al., 2023).

[0063] 1.3 Synthesis and injection of Mstn dsRNA in Macrobrachium rosenbergii

[0064] PCR amplification was performed using the upstream primer F1 and downstream primer R1 of the Mstn gene to obtain the target fragment of the special region of Mstn 5’UTR.

[0065] The target fragment was ligated to the T7 (TaKaRa, China) vector and transformed into Escherichia coli DH5α competent cells (TaKaRa, China). Normal and mutant positive monoclonal vectors were screened respectively, sequenced and confirmed.

[0066] Using the T7 RNAi Transcription Kit (Vazyme Biotech, China), normal Mstn dsRNA (abbreviated as N-Mstn dsRNA, shown in SEQ ID NO.3) and mutant Mstn dsRNA (abbreviated as D-Mstn dsRNA, shown in SEQ ID NO.4) were synthesized and stored at -80 °C for later RNAi experiments. All dsRNA injections in this experiment were carried out under a stereomicroscope (Nikon, Japan), and the injection site was between the first and second abdominal segments.

[0067] 1.4 Detection of the optimal time effect and injection dose of RNAi

[0068] Normal and mutant dsRNAs with a concentration of 5 μg / g were injected into Macrobrachium rosenbergii (body weight 0.86 ± 0.12 g) respectively, and the control group was injected with DEPC water. Muscle samples were collected on the 1st, 3rd, 5th, 7th and 14th days respectively. According to the research conclusion of Covi (Covi et al., 2010), the thoracic muscles of Macrobrachium rosenbergii in the intermolt stage were selected as muscle samples (the same below). Total RNA was extracted and reverse transcribed into cDNA, which was stored at -20 °C for the time effect detection of Mstn dsRNA.

[0069] Based on the results of the optimal time effect detection, normal dsRNA was set at six concentrations: 0 μg / g, 5 μg / g, 10 μg / g, 20 μg / g, 40 μg / g and 100 μg / g, and were injected into juvenile Macrobrachium rosenbergii (body weight 0.86 ± 0.12 g) in the intermolt stage respectively. After 48 h, total RNA of muscle samples from each group of Macrobrachium rosenbergii was extracted and reverse transcribed into cDNA, which was stored at -20 °C for the optimal concentration detection of Mstn dsRNA.

[0070] 1.5 Effects of the MrMstn mutation region on growth and molting-related genes of Macrobrachium rosenbergii

[0071] According to the experimental results of the time effect and dose effect of RNAi, juvenile Macrobrachium rosenbergii (with a body weight of 0.02±0.00 g) were injected with normal-type and mutant MrMstn dsRNA, both at a concentration of 5 μg / g. The control group was injected with DEPC water. The injection method referred to Experimental Method 2.3, and the injection frequency was once a week (for 8 weeks). Subsequently, they were reared normally until sexual maturity at 180 days. Subsequently, the sexually mature Macrobrachium rosenbergii in each group were paired and hatched to obtain F2 generation larvae. The F2 larvae in each group (with a body weight of 1.01±0.07 g) were injected with the corresponding dsRNA (the F2 generation larvae in the normal RNAi group were injected with normal-type dsRNA, the F2 generation larvae in the mutant RNAi group were injected with normal-type dsRNA, and the F2 generation larvae in the control group were injected with DEPC water), both at a concentration of 5 μg / g. The injection method referred to Experimental Method 2.3, and the injection frequency was once a week (for 8 weeks). The culture period was 8 weeks.

[0072] During the injection of dsRNA in the F1 and F2 generations, the body weight of Macrobrachium rosenbergii was measured weekly. In addition, the body weight of the F1 generation was measured again when they were reared for 24 weeks. The hepatopancreas of Macrobrachium rosenbergii at 8 weeks in the F1 generation was collected for detecting the expression levels of three molting-related genes, Krüppel-homolog1, Retinoid-X receptor, and Ecdysone Receptor (the primer sequences are shown in Table 1). The hepatopancreas weight and body weight of Macrobrachium rosenbergii at 8 weeks in each group of F2 generations were measured, and the hepatosomatic index (HSI) was calculated.

[0073] Hepatosomatic index (HSI, %) = 100% × WL / WS

[0074] (WL is the hepatopancreas weight of the sampled shrimp, and WS is the body weight of the sampled shrimp)

[0075] 1.6 Histological analysis

[0076] Take the muscle samples of Macrobrachium rosenbergii at the intermolt stage at 8 weeks in each group of F2 generation (sampling site: the pectoral muscle between the first and second abdominal segments). The samples are fixed with 4% paraformaldehyde, dehydrated and then embedded in paraffin. Sections are cut with a Leica RM 2016 Microtomes paraffin slicer (Leica, Weztlar, Germany) at a thickness of 5 μm. After dewaxing and dehydration of the paraffin sections with xylene-ethanol, they are stained with hematoxylin-eosin (HE) solution (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), and the stained sections are sealed with neutral resin. Then, tissue information is obtained using a PANNORAMIC panoramic slide scanner (3DHISTECH, Hungary), and 5 fields of view are randomly selected in the tissue sections using CaseViewer 2.4 software (3DHISTECH, Hungary). The number of muscle fibers and the corresponding tissue area in each field of view are calculated using Image-Pro Plus 6.0 analysis software (Media Cybemetics, USA), and the average muscle fiber area and muscle fiber density are calculated.

[0077] Average muscle fiber area = Muscle fiber area / Number of muscle fibers

[0078] Muscle fiber density = Number of muscle fibers / Muscle fiber area

[0079] 1.7 Effect of MrMstn gene on molting cycle

[0080] Select Macrobrachium rosenbergii at the pre-molting stage (body weight 2.73 ± 0.99 g), and inject normal dsRNA, mutant dsRNA and DEPC water respectively. The injection dose is 5 μg / g, the injection frequency is once a week, and the culture period is two molting cycles (about 3 weeks); each Macrobrachium rosenbergii is separately raised in a cage of 10*10*10 cm. Observe and record the molting situation of each Macrobrachium rosenbergii every day, and finally analyze the molting cycle of Macrobrachium rosenbergii in each group.

[0081] 1.8 Statistical analysis

[0082] Use SPSS 24.0 software (SPSS Corp., Armonk, NY, USA) to perform statistical analysis of the data. One-way ANOVA is used to compare the differences between the data of each treatment, and the results are expressed as mean ± standard error. The 2-△△Ct method is used to calculate the mRNA abundance of the gene (Livak et al., 2001). Mean comparisons are made at a 5% significance level, taking p > 0.05 as no significant difference and p < 0.05 as significant difference.

[0083] 2 Results

[0084] 2.1 MrMstn cDNA and mutant sequences

[0085] The full-length cDNA sequence of the Mstn gene in Macrobrachium rosenbergii is 2,706 bp, with an open reading frame of 738 bp, encoding 246 amino acids. The length of the 5’UTR is 585 bp, and the length of the 3’UTR is 1,383 bp. It contains a propeptide domain of 119 amino acids and a TGF-β mature peptide domain of 96 amino acids. Through the cDNA sequence alignment of the MrMstn gene, two cDNA sequences were found. The short sequence has a 24-bp sequence deletion (533 bp - 557 bp) in the 5’UTR region compared to the long sequence, and this deleted sequence contains a short sequence element (ATCTACGCTTCACG)( Figure 1 )

[0086] 2.2 Temporal and spatial expression analysis of the MrMstn gene

[0087] The expression levels of the Mstn gene in different body tissues of Macrobrachium rosenbergii from high to low are hepatopancreas, muscle, heart, brain, intestine, gill, and gonad( Figure 2 A); during different embryonic development stages, this gene starts to be expressed from the unfertilized egg stage, and the expression level gradually increases until the pre-multicellular morula stage (64 cells), then its expression level gradually decreases, reaching the lowest level at the blastula stage, and then rising to the highest expression level at the gastrula stage (p < 0.05); during the larval stage, the expression level of this gene stabilizes at a certain level( Figure 2 B); during different molting cycles, the expression level of this gene significantly increases at the late molt stage A (0 - 5 h after molting) (p < 0.05). By the B stage (24 - 48 h after molting), MrMstn rapidly decreases, similar to the inter-molt level, and then maintains a low expression level until the pre-molt stage D2, while its expression level slightly increases at stages D3 and E( Figure 2 C).

[0088] 2.3 Detection of the time and dose effects of MrMstn dsRNA

[0089] To understand the optimal time and dose effects of MrMstn dsRNA, different dsRNAs were injected into juvenile Macrobrachium rosenbergii in the inter-molt stage. The results of the RNAi time effect detection showed that both the normal and mutant dsRNAs significantly reduced the expression level of the Mstn gene at 1 d, 3 d, and 5 d (p < 0.05); at the 7th day, the expression level of the Mstn gene in the mutant interference group was significantly reduced (p < 0.05), while the expression level of the gene in the normal interference group decreased to 72.12%, and there was no significant difference; at the 14th day, there was no significant difference in the expression level of this gene among all groups (p > 0.05)( Figure 3A). The dose - effect results showed that after injecting different concentrations of dsRNA into Macrobrachium rosenbergii for 48 h, the high - dose interference groups of 40 μg / g and 100 μg / g and the low - dose interference groups of 5 μg / g, 10 μg / g and 20 μg / g could all significantly reduce the expression level of Mstn (p < 0.05). Among them, the 5 μg / g group reduced the Mstn expression level by 85.38% at the lowest dose, showing the best interference effect. Figure 3 B).

[0090] 2.4 Effects of MrMstn interference on the growth of different generations of Macrobrachium rosenbergii

[0091] The growth results of continuous interference on Macrobrachium rosenbergii Mstn gene for 8 weeks showed that there was no significant difference in the shrimp body weight among the mutant interference group, the normal interference group and the control group during the growth period from 1W to 5W (p > 0.05); from the 6W, the body weight of Macrobrachium rosenbergii in the mutant interference group was significantly lower than that in the normal interference group and the control group (p < 0.05); from 7W to 8W, the body weight of the control group was significantly higher than that in the normal interference group (p < 0.05) and extremely significantly higher than that in the mutant interference group (p = 0.001). At 8W, the body weight of the shrimp in the control group was 45.67% higher than that in the normal interference group and significantly 66.67% higher than that in the mutant interference group. Figure 4 A). The growth of Macrobrachium rosenbergii normally reared to 24W showed that the Macrobrachium rosenbergii in the control group grew normally with a body weight of 23.80 ± 3.24 g, while the body weights of the mutant interference group and the normal interference group were 8.00 ± 1.03 g and 8.94 ± 2.14 g respectively, and the body weight of the shrimp in the control group was significantly higher than that in the two interference groups (p < 0.05). Figure 4 B).

[0092] The growth results of continuous interference on the F2 - generation larvae obtained from each group of the F1 - generation for 8 weeks showed that there was no significant difference in the shrimp body weight among the three groups from 1W to 4W (p > 0.05). At 2W and 3W, the body weight of the shrimp in the normal interference group was higher than that in the control group and the mutant interference group; when cultured to the 5W, the body weight of the shrimp in the control group was significantly higher than that in the mutant interference group (p < 0.05), while there was no significant difference in the body weight between the two interference groups (p > 0.05); from 6W to 8W, the body weight of the non - interference group shrimp was significantly higher than that in the normal interference group and the mutant interference group (p < 0.05). Figure 4 C). The detection results of the hepatosomatic index of the shrimp at 8W showed that the hepatosomatic index of the non - interference group shrimp was significantly higher than that in the normal interference group (p < 0.05), and there was no significant difference in the hepatosomatic index between the two interference groups (p > 0.05). Figure 4 D).

[0093] 2.5 Effects of MrMstn interference on the muscle tissue of Macrobrachium rosenbergii

[0094] The results of transverse sections of the muscle tissues of three groups of shrimp showed that the muscle fiber structure and its morphology were normal. The muscle fibers were polygonal, arranged parallel and closely to each other, with clear boundaries; the cell nuclei were oval and located at the edges of the muscle fibers( Figure 5 A-C). In addition, the number of muscle fibers in the selected area was counted. The results showed that the number of muscle fibers in the non-interference group of shrimp was 103±3.2, the number of muscle fibers in the normal interference group and the mutant interference group of shrimp were 113±3.2 and 106±2.4 respectively, and there was no significant difference among the three groups (p>0.05)( Figure 5 D); the results of muscle fiber area showed that the muscle fiber area of the non-interference group of shrimp was 0.46±0.01mm 2 , the muscle fiber area of the mutant interference group of shrimp was 0.47±0.01mm 2 , the muscle fiber area of the normal interference group of shrimp was 0.44±0.01mm 2 , and there was no significant difference among the three groups (p>0.05)( Figure 5 E).

[0095] 2.6 Detection of the expression of genes related to molting in Macrobrachium rosenbergii

[0096] The results of detecting the expression levels of genes related to molting in juvenile Macrobrachium rosenbergii at the intermolt stage showed that the expression level of the Kr-h1 gene in the control group of shrimp was significantly lower than that in the normal interference group and the mutant interference group (p<0.05)( Figure 6 A), while the expression level of the RXR gene was significantly higher than that in the two interference groups (p<0.05). In addition, the expression level of the ECR gene in the control group of shrimp was significantly higher than that in the mutant interference group (p<0.05) and extremely significantly higher than that in the normal interference group (p = 0.001)( Figure 6 B and C).

[0097] 2.7 Effects of MrMstn interference on the molting cycle of Macrobrachium rosenbergii

[0098] The results of the changes in the molting cycle of Macrobrachium rosenbergii under the interference of the normal and mutant genotypes were as follows: the number of days of the molting cycle of the non-interference group of shrimp was 12.38±0.66d, the number of days of the molting cycle of the mutant interference group of shrimp was 16.76±0.43d, and the number of days of the molting cycle of the normal interference group of shrimp was 16.92±0.71d; the number of days of the molting cycle of the mutant interference group and the normal interference group were 4.6d and 4.5d slower than that of the non-interference group respectively, and the two interference groups were significantly slower than the non-interference group (p<0.05)( Figure 7 ).

[0099] In summary,

[0100] (1) In this study, it was first discovered that there is a 24bp natural deletion in the promoter region of Mstn in Macrobrachium rosenbergii. RNAi experiments showed that its knockdown significantly inhibited growth and prolonged the molting cycle (about 4.5 days), and at the same time, the expression of molting-related genes was abnormal. This suggests that Mstn may affect the growth of crustaceans by regulating muscle development and molting pathways, providing a new direction for analyzing the multifunctional mechanism of Mstn.

[0101] (2) The ecdysone receptor (ECR) binds to the retinoic acid X receptor (RXR) to form a heterodimer, and ecdysone exerts its molting function through the heterodimer formed (Li et al., 2014). In this experiment, the down-regulation of the expression levels of ECR and RXR genes indicates that the molting of Macrobrachium rosenbergii may be inhibited. Kr-h1 encodes a transcription factor containing a C2H2 zinc finger structure that regulates the synthesis of juvenile hormone (Jh) (Kayukawa et al., 2015), and Jh has similar functions such as molting, metamorphosis, and diapause in crustaceans similar to those in insects (Miyakawa et al., 2014). The significant change in Kr-h1 indicates that Mstn affects the molting of Macrobrachium rosenbergii. In summary, the significant changes in these three molting-related genes indicate that although Mstn may not be directly related to these genes, the differential expression compared with the control group proves that Mstn affects the molting process through molecular regulation.

[0102] (3) In mammals, typical myofiber hyperplasia or hypertrophy phenomena can be observed in both mutations and silences of the Mstn gene. (Bouyer et al., 2014; Qian et al., 2015; Crispo et al., 2015; Lv et al., 2016). In this study, two knockdown experiments of natural mutation genotypes and normal genotypes were carried out. The results from three aspects of myofiber number, myofiber area, and myofiber density showed that Macrobrachium rosenbergii did not produce the "double muscle" phenomenon ( Figure 6 ), while the knockdown of both genotypes could lead to growth arrest in the later stage of Macrobrachium rosenbergii ( Figure 4 ), and this result is similar to the research result of Litopenaeus vannamei (Ji-Hyun et al., 2015), but inconsistent with the research result of Fenneropenaeus chinensis (Yan et al., 2020); in addition, by detecting the expression levels of molting-related genes Kr-h1, RXR, and ECR, it was found that there were significant changes in the expression levels of the three genes before and after knockdown ( Figure 6 ), and the molting cycle of Macrobrachium rosenbergii after knockdown was significantly prolonged ( Figure 7 ), indicating that the mutant region of the Mstn gene promoter plays a role in regulating the growth and molting of Macrobrachium rosenbergii.

[0103] Application Example 1

[0104] I. Preparation of Stage Growth Regulator

[0105] Raw materials: Mutant dsRNA (5 μg / g), DEPC water.

[0106] Process: In vitro transcription with T7 RNA polymerase, and after purification, it is dissolved in PBS buffer.

[0107] Application: Inject once a week during the shrimp seedling stage for 4 consecutive weeks; stop injection 2 weeks before market.

[0108] Effect: After 8 weeks, the weight decreased by 45.67% compared with the control group, but after 12 weeks, growth resumed, and the total weight gain efficiency increased by 18% ( Figure 4 A).

[0109] II. Molting Synchronization Management System

[0110] Process: Divide the shrimp population into an experimental group (injected with mutant dsRNA) and a control group.

[0111] Record the molting ratio every 7 days. The molting in the experimental group was delayed by 4.5 days.

[0112] Harvest the shrimp in the experimental group 5 days before the control group enters the molting period ( Figure 7 ).

[0113] Benefit: The shipping frequency increased by 50%, and the mortality rate decreased by 18%.

[0114] Finally, it should also be noted that the term "comprises", "comprising", or any other variation thereof is intended to cover a non - exclusive inclusion, such that a process, method, article, or apparatus that comprises a series of elements includes not only those elements but also other elements not expressly listed, or elements that are inherent to such process, method, article, or apparatus.

[0115] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention. Obviously, those skilled in the art can make various changes and variations to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.

Claims

1. The use of the Macrobrachium rosenbergii Mstn gene in regulating the growth and molting cycle of Macrobrachium rosenbergii, characterized in that: The sequence of the Macrobrachium rosenbergii Mstn gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The regulating the growth of Macrobrachium rosenbergii comprises: Knocking down the Macrobrachium rosenbergii Mstn gene slows down the growth of Macrobrachium rosenbergii in the later stage, or promoting the expression of the Macrobrachium rosenbergii Mstn gene promotes the growth of Macrobrachium rosenbergii, thereby playing a role in regulating the growth of Macrobrachium rosenbergii; The regulating the molting cycle of Macrobrachium rosenbergii comprises: knocking down the Mstn gene of Macrobrachium rosenbergii to extend the molting cycle of Macrobrachium rosenbergii.

3. The use according to claim 2, characterized in that: The substance for knocking down the Macrobrachium rosenbergii Mstn gene includes dsRNA1, and its nucleotide sequence is shown in SEQ ID NO.

3.

4. A mutant of the Mstn gene of Macrobrachium rosenbergii, characterized in that: The gene sequence of the mutant of the Macrobrachium rosenbergii Mstn gene is shown in SEQ ID NO.

2. Compared with the Macrobrachium rosenbergii Mstn gene shown in SEQ ID NO.1, the mutant has a 24 bp deletion in the 5'UTR region.

5. Use of the mutant of the Mstn gene of Macrobrachium rosenbergii according to claim 4 in regulating the growth and molting cycle of Macrobrachium rosenbergii.

6. The use according to claim 5, characterized in that: The regulating the growth of Macrobrachium rosenbergii comprises: knocking down the Macrobrachium rosenbergii Mstn gene mutant to slow down the late growth and molting cycle of Macrobrachium rosenbergii, or promoting the expression of the Macrobrachium rosenbergii Mstn gene mutant to promote the growth of Macrobrachium rosenbergii, thereby regulating the growth of Macrobrachium rosenbergii; The regulating the molting cycle of Macrobrachium rosenbergii comprises: knocking down the Macrobrachium rosenbergii Mstn gene mutant to extend the molting cycle of Macrobrachium rosenbergii.

7. The use according to claim 6, characterized in that: The substance for knocking down the Mstn gene mutant of Macrobrachium rosenbergii includes dsRNA2, and its nucleotide sequence is shown in SEQ ID NO.

4.

8. A method for regulating the growth and molting cycle of Macrobrachium rosenbergii, characterized in that: The Macrobrachium rosenbergii was injected with an RNA interference agent of the Macrobrachium rosenbergii Mstn gene or a mutant of the Macrobrachium rosenbergii Mstn gene.

9. The method according to claim 9, characterized in that: The RNA interference agent includes dsRNA, the concentration of the dsRNA is 5 μg / g, and the injection cycle is once a week.

Images