Preparation method and application of acipenser baerii irisin recombinant protein

Abstract

The invention discloses a preparation method of acipenser baerii Risin recombinant protein, which comprises the following steps: step 1, RNA extraction and reverse recording to obtain a cDNA template, step 2, pMD19-T-Risin bacterium culture, step 3, monoclonal colony culture, step 4, positive clone bacterium screening culture and recombinant plasmid extraction, step 5, recombinant plasmid in-vitro expression, and step 6, purification of the recombinant plasmid to obtain the acipenser baerii Risin recombinant protein. Step 6, purifying and collecting the irisin recombinant protein; the cDNA sequence of the acipenser sibiricum Risin gene is cloned through reverse transcription polymerase chain reaction, pET-32a-Risin expression plasmid and expression bacteria are constructed, efficient prokaryotic expression is achieved after induction conditions are optimized, fusion protein mostly exists in a soluble form, high-purity Risin recombinant protein is obtained through purification and renaturation, Risin in-vitro recombinant expression is achieved for the first time, and the application prospect is wide. And a foundation is laid for further research on physiological functions and action mechanisms.

Description

Technical Field

[0001] The present invention relates to the field of biological technologies, and in particular, to a method for preparing and applying a recombinant protein of irisin from Acipenser baerii Background Art

[0002] As a newly emerging metabolic regulator, irisin has attracted extensive attention in the field of feeding regulation, bringing a new perspective to understanding the mystery of the body's feeding behavior. Irisin was initially discovered in muscle tissue. During exercise, the expression of the FNDC5 gene in muscle is up-regulated, and after cleavage and modification, active irisin is released. This discovery reveals its subtle connection with energy metabolism, and subsequent research has gradually focused on the level of feeding regulation

[0003] Acipenser baerii belongs to the family Acipenseridae and the genus Acipenser taxonomically. It is an omnivorous animal that can easily adapt to diverse feed types, providing great convenience for aquaculture. Its extremely strong growth potential is particularly prominent. Under suitable environmental conditions, it has a fast growth rate and a strong physique

[0004] Studying the feeding and feeding regulation mechanism of Acipenser baerii helps to improve the aquaculture level and increase the aquaculture benefits. However, the research on the feeding of Acipenser baerii is still in its infancy. There have been reports on appetite factors such as PYY, urocortin 3 (ucn3), CCK, CART, and apelin, but there is no research report on irisin in Acipenser baerii. Therefore, the present invention proposes a method for preparing and applying a recombinant protein of irisin from Acipenser baerii to solve the problems existing in the prior art Summary of the Invention

[0005] To explore whether irisin plays a biological function in regulating feeding in Acipenser baerii, the present invention proposes a method for preparing and applying a recombinant protein of irisin from Acipenser baerii. The preparation of this recombinant protein of irisin from Acipenser baerii uses reverse transcription polymerase chain reaction to clone the cDNA sequence of the irisin gene from Acipenser baerii, constructs a pET-32a-irisin expression plasmid and an expression bacterium, and achieves high-efficiency prokaryotic expression after optimizing the induction conditions. Moreover, the fusion protein mostly exists in a soluble form. After purification and renaturation, a high-purity recombinant protein of irisin is obtained, realizing the in vitro recombinant expression of irisin for the first time, laying a foundation for further studying its physiological functions and action mechanisms

[0006] To achieve the purpose of the present invention, the present invention is realized through the following technical solutions: A method for preparing a recombinant protein of irisin from Acipenser baerii, comprising the following steps:

[0007] Step 1: Sample and store healthy juvenile Amur sturgeon, then extract RNA using a total RNA extraction kit and perform detection and screening. Finally, reverse transcribe the extracted total RNA using a reverse transcription kit to prepare a cDNA template;

[0008] Step 2: Based on the genome of Acipenser ruthenus in NCBI, search for the sequence information of the FNDC5 gene. Subsequently, perform multiple sequence alignments to find the contained Irisin sequence, and design specific primers irisin-yF and irisin-yR for PCR amplification. Excise and recover the target fragment band in the obtained PCR product, then ligate it with the cloning vector pMD19-T, transform it into DH5α competent cells and culture to obtain pMD19-T-irisin bacteria;

[0009] Step 3: Resuscitate the pMD19-T-irisin bacteria and the expression vector pET-32a bacterial solution and culture them overnight at 37°C. Then use a plasmid extraction kit to extract plasmids respectively. Subsequently, perform double digestion using restriction endonucleases BamHⅠ and EcoRⅠ to obtain the digested pET-32a vector and the target fragment. Mix them overnight at 4°C using T4 DNA Ligase, and transform the ligation product into DH5α competent cells for culture to obtain monoclonal colonies;

[0010] Step 4: Perform PCR determination on the monoclonal colonies, screen out the positive clone bacteria for sequencing, expand the culture of the correct recombinant strain, and extract the recombinant plasmid using a plasmid extraction kit;

[0011] Step 5: Transform the recombinant plasmid into Transetta competent cells for culture, select monoclonal colonies for colony PCR to screen out positive clone bacteria for sequencing. After sequencing, activate and expand the culture of the positive engineering bacteria and detect the growth density. Subsequently, perform induction culture and collect the induced-expressed bacteria. Crush the bacteria and centrifuge to collect the supernatant and precipitate;

[0012] Step 6: Take the centrifuged supernatant and purify it using an affinity chromatography column conjugated with nickel ions. Elute with 100 mmol / L imidazole to collect the target protein and obtain the recombinant Irisin protein.

[0013] The further improvement lies in that: during the detection in Step 1, the integrity of RNA is detected by 1.5% agarose gel electrophoresis; the purity and concentration of RNA are detected by a nucleic acid protein analyzer.

[0014] A further improvement lies in that: in the second step, the PCR reaction system contains 5 μL of 2×Taq PCR MasterMix, 3 μL of ultrapure water, 1 μL of the total RNA extract containing the irisin sequence, and 0.5 μL each of the upstream primer irisin-yF and the downstream primer irisin-yR.

[0015] A further improvement lies in that: before excising the target fragment band in the second step, 1.5% agarose gel electrophoresis is used to detect the specificity and brightness of the PCR product band to determine the target fragment band, and after excising the target fragment band, a gel recovery kit is used for DNA recovery;

[0016] After transformation into DH5α competent cells, they are resuscitated and plated on a plate and cultured overnight at 37°C. Single colonies are picked and cultured in an LB liquid medium containing 100 μg / μl ampicillin for 3 - 5 h to obtain pMD19-T-irisin bacteria.

[0017] A further improvement lies in that: in the third step, during double digestion, the double digestion reaction is carried out at a constant temperature of 37°C for 5 - 15 min, then 10 μL of 6×loading buffer is added to terminate the reaction. After the reaction, the digested products are separated by 1.5% agarose gel electrophoresis, and the target-sized fragments are cut off. A gel recovery kit is used for recovery and purification, and the purity and concentration of the recovered products are measured respectively; when culturing competent cells, they are first resuscitated and then spread on an LB solid medium containing ampicillin and cultured overnight at 37°C to obtain monoclonal colonies.

[0018] A further improvement lies in that: the fourth step is specifically to pick monoclonal colonies and inoculate them into an LB liquid medium containing 1‰ ampicillin, place them in a shaker at 37°C for 3 - 5 h for enlarged culture, and then perform PCR determination. PCR identification is carried out with the vector pRT-32a universal sequencing primers T7-F and T7-R. The PCR products are electrophoresed on a 1.5% agarose gel to judge the product size and screen to obtain positive clone bacteria for sequencing. The correctly sequenced recombinant strains are enlarged in culture and the recombinant plasmids are extracted using a plasmid extraction kit.

[0019] A further improvement lies in that: when culturing Transetta competent cells in the fifth step, they are spread on a solid plate containing 1‰ ampicillin and cultured overnight in a 37°C incubator; when screening positive clone bacteria, the colony PCR products are electrophoresed on a 1.5% agarose gel to judge the product size and screen; the activation and enlarged culture are specifically to inoculate the positive clone bacteria into an LB liquid medium containing 1‰ ampicillin and shake them overnight at 200 r / min in a shaker at 37°C for activation, and the next day, transfer them to an LB medium containing 1‰ ampicillin at a ratio of 1:50 - 100 and culture them at 37°C for enlarged culture.

[0020] The further improvement lies in that: in step five, the bacterial cells are collected by centrifuging the bacterial solution at 6000 r / min for 5 min in a centrifuge; the treatment for breaking the bacterial cells is to resuspend and wash the collected bacterial cells 3 - 4 times with 1×PBS and then add lysozyme to break the bacterial cells until they become viscous, and then centrifuge at 12000 r / min for 10 min in a centrifuge.

[0021] The further improvement lies in that: in step six, before eluting with imidazole, the chromatography column is slowly equilibrated with Tris - HCl buffer for 5 - 10 column volumes until the baseline is at a horizontal state to remove the miscellaneous proteins of the bacterial cells.

[0022] Application of the irisin recombinant protein prepared by a preparation method of the irisin recombinant protein of Acipenser baerii in the role of feeding regulation of Acipenser baerii.

[0023] The beneficial effects of the present invention are as follows: the present invention clones the cDNA sequence of the irisin gene of Acipenser baerii by reverse transcription polymerase chain reaction, constructs the pET - 32a - irisin expression plasmid and the expression bacteria, realizes high - efficiency prokaryotic expression after optimizing the induction conditions, and most of the fusion proteins exist in a soluble form. After purification and renaturation, a high - purity irisin recombinant protein is obtained, realizing the in vitro recombinant expression of irisin for the first time, laying a foundation for further studying its physiological functions and action mechanisms;

[0024] Meanwhile, it is applied to the feeding regulation of Acipenser baerii, providing a theoretical basis for studying the role of irisin in the feeding regulation of fish. Brief Description of the Drawings

[0025] Figure 1 It is a flow chart of the preparation method of the irisin recombinant protein of the present invention. Detailed Embodiments

[0026] To deepen the understanding of the present invention, the following will further elaborate on the present invention in combination with embodiments. These embodiments are only used to explain the present invention and do not constitute a limitation to the protection scope of the present invention.

[0027] Embodiment 1

[0028] According to Figure 1 shown, this embodiment provides a preparation method of the irisin recombinant protein of Acipenser baerii, including the following steps:

[0029] Step 1: Sample and store healthy juvenile Amur sturgeons, then extract RNA using a total RNA extraction kit and detect the integrity of RNA by 1.5% agarose gel electrophoresis. Detect the purity and concentration of RNA using a nucleic acid protein analyzer, screen according to the results, and finally reverse transcribe the extracted total RNA using a reverse transcription kit to prepare a cDNA template.

[0030] Step 2: Based on the genome of Acipenser ruthenus in NCBI, search for the sequence information of the FNDC5 gene, then perform multiple sequence alignments to find the contained Irisin sequence, and design specific primers irisin-yF and irisin-yR for PCR amplification. Use 1.5% agarose gel electrophoresis to detect the specificity and brightness of the PCR product bands to determine the target fragment band. Excise the target fragment band in the obtained PCR product, use a gel recovery kit for DNA recovery, and then ligate it with the cloning vector pMD19-T, transform it into DH5α competent cells and culture to obtain pMD19-T-irisin bacteria;

[0031] The PCR reaction system contains 5 μL of 2×Taq PCR MasterMix, 3 μL of ultrapure water, 1 μL of the total RNA extraction solution containing the Irisin sequence, and 0.5 μL each of the upstream primer irisin-yF and the downstream primer irisin-yR.

[0032] Step 3: After resuscitating the pMD19-T-irisin bacteria and the expression vector pET-32a bacterial solution, culture them overnight at 37°C, then use a plasmid extraction kit to extract plasmids respectively. Subsequently, use the restriction endonucleases BamHⅠ and EcoRⅠ for double digestion to obtain the digested pET-32a vector and the target fragment. Use T4 DNA Ligase to mix them overnight at 4°C. After transforming the ligation product into DH5α competent cells and resuscitating, coat it on an LB solid medium containing ampicillin and culture it overnight at 37°C. Pick colonies into an LB liquid medium containing 100 μg / μl ampicillin and culture for 3 - 5 h to obtain pMD19-T-irisin monoclonal colonies;

[0033] During double digestion, perform the double digestion reaction at a constant temperature of 37°C for 5 - 15 min respectively, then add 10 μL of 6×loading buffer to terminate the reaction. After completion, separate the digestion products by 1.5% agarose gel electrophoresis, cut out the target size fragment, and use a gel recovery kit for recovery and purification, and measure the purity and concentration of the recovered products respectively.

[0034] Step 4: Perform PCR assay on monoclonal colonies, screen out positive clone bacteria for sequencing, expand the culture of the correct recombinant strain, and use a plasmid extraction kit to obtain the recombinant plasmid.

[0035] Specifically, pick monoclonal colonies and inoculate them into LB liquid medium supplemented with 1‰ ampicillin, place them in a shaker at 37°C for 3 - 5 h for expanded culture, then perform PCR assay. Use the universal sequencing primers T7-F and T7-R of vector pRT-32a for PCR identification. The PCR products are electrophoresed on 1.5% agarose gel, the size of the products is judged, and positive clone bacteria are screened for sequencing. Expand the culture of the recombinant strain with correct sequencing and use a plasmid extraction kit to obtain the recombinant plasmid.

[0036] Step 5: Transform the recombinant plasmid into Transetta competent cells, coat them on a solid plate supplemented with 1‰ ampicillin, place them in an incubator at 37°C for overnight culture, pick monoclonal colonies for colony PCR, electrophorese the colony PCR products on 1.5% agarose gel, judge the size of the products, screen out positive clone bacteria for sequencing. After sequencing, inoculate the positive clone bacteria into LB liquid medium supplemented with 1‰ ampicillin, place them in a shaker at 37°C, and shake overnight at a frequency of 200 r / min for activation. The next day, transfer them to LB medium supplemented with 1‰ ampicillin at a ratio of 1:50 - 100 and culture them at 37°C for expanded culture and detect the growth density. Then perform induction culture, centrifuge the bacterial liquid at 6000 r / min for 5 min in a centrifuge to collect the induced-expressed bacteria. Resuspend and wash the collected bacteria 3 - 4 times with 1×PBS, then add lysozyme to break the bacteria until it becomes viscous. Centrifuge at 12000 r / min for 10 min in a centrifuge and collect the supernatant and precipitate.

[0037] Step 6: Take the centrifuged supernatant and purify it using an affinity chromatography column conjugated with nickel ions. First, slowly equilibrate the chromatography column with Tris-HCl buffer for 5 - 10 column volumes until the baseline is at a horizontal state to remove bacterial impurity proteins. Then, elute with 100 mmol / L imidazole to collect the target protein and obtain the irisin recombinant protein.

[0038] Example 2

[0039] This example provides a preparation method and product analysis of Siberian sturgeon irisin recombinant protein, specifically:

[0040] I. Gene cloning, collection of tissue distribution samples, RNA extraction, and cDNA synthesis

[0041] Randomly select 9 healthy juvenile Amur sturgeons with a weight of about 100 g. Dissect and take tissue samples 1 h after the feeding time point (14:00). Rinse the tissue samples with 0.9% sterile normal saline, blot the water on the surface of the tissues with filter paper, put them into labeled sample bags, wrap them with tin foil, and then temporarily freeze them in liquid nitrogen, and then store them in a -80 °C refrigerator for the study of irisin cloning and tissue distribution. For the isolated tissue samples, use a total RNA extraction kit (Fujie, Chengdu, China) to extract total RNA strictly according to the instructions. The integrity of RNA is detected by 1.5% agarose gel electrophoresis, and the purity and concentration of RNA are detected by a nucleic acid protein analyzer to screen out RNA with qualified quality. Reverse transcribe the obtained total RNA using a reverse transcription kit (Takara, Dalian, China) to prepare a cDNA template for gene cloning and fluorescence quantitative analysis;

[0042] Real-time fluorescence quantitative determination showed that irisin in Amur sturgeon was widely distributed in the central nervous system and peripheral tissues of Amur sturgeon. Among the peripheral tissues, the expression of irisin was the highest in the liver, followed by the pancreas, swim bladder, skin, esophagus and duodenum, and the expression was less in the kidney, rectum, stomach, eyes, muscle, heart, valvular intestine, pyloric caecum, spleen and gills. In the central nervous system, the expression was the highest in the cerebellum and hypothalamus, followed by the midbrain, spinal cord, medulla oblongata and telencephalon.

[0043] II. Cloning and sequence analysis of irisin

[0044] Based on the genome of Acipenser ruthenus published by NCBI, search for the sequence information of the FNDC5 gene. Through literature search and multiple sequence alignment of other species, find the irisin sequence it contains, and design specific primer pairs for amplifying partial sequences, as shown in Table 1 below.

[0045] Table 1 Primers related to irisin cloning and fluorescence quantification of Amur sturgeon

[0046] Primer Primer sequence (5'-3') Use irisin-F GACAATCGAACTGGAATGT clone irisin-R TCTTGTTAGGCTTTGATGA clone irisin-qF GTCATGGGACACCCTGGA qPCR irisin-qR TCCCACAGAGTGCAGGAC qPCR actin-qF GTTGGTATGGGACAGAAGGACA qPCR actin-qR CCAGTTGGTAACAATGCCGT qPCR

[0047] The specificity and brightness of the PCR product bands were detected by 1.5% agarose gel electrophoresis. Then, excise the target fragment bands, use a gel recovery kit for DNA recovery. Subsequently, ligate the obtained target fragment with the cloning vector pMD19-T, transform it into DH5α competent cells. After resuscitation and overnight culture at 37 °C on the plate, pick the bacteria into an LB liquid medium containing 100 μg / μl ampicillin and culture for 3 - 5 hours. After identification by PCR and agarose gel electrophoresis, send the bacterial solution to Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. for sequencing. Finally, use the software DNAman to analyze the partial sequence obtained by cloning to obtain the cDNA sequence of the irisin gene.

[0048] The amino acid sequence and isoelectric point were predicted using DNAman, and the signal peptide of irisin was predicted using SignalP 5.0. The results showed that the isoelectric point of Acipenser baerii irisin was 4.627, and there was no signal peptide. Alignment of the irisin amino acid sequences of different species revealed significant differences among them.

[0049] Multiple sequence alignment of amino acids and phylogenetic tree construction were performed using MEGA. The results showed that the phylogenetic tree constructed with the irisin amino acid sequences of different species indicated that Acipenser baerii irisin was less closely clustered with reptiles and birds and more closely clustered with fish and mammals.

[0050] The tertiary structure of irisin was predicted using SWISS-MODEL, and the results showed the presence of an N-terminal coiled-coil structure and a C-terminal fibrinogen-like structure.

[0051] The transmembrane region of irisin was analyzed using TMpred and TMHMM, and the results showed the absence of transmembrane domains.

[0052] III. In vitro recombinant expression and activity analysis of irisin

[0053] 1. Cloning of irisin: Using the Acipenser baerii irisin cloning bacteria as a template and irisin-yF and irisin-yR as primers. The PCR reaction system was 10 μL, containing 5 μL of 2×Taq PCR MasterMix, 3 μL of ultrapure water, 1 μL of bacterial solution, and 0.5 μL of each upstream and downstream primer. The specificity and brightness of the PCR product bands were detected by 1.5% agarose gel electrophoresis. Subsequently, the target fragment band was excised, and DNA recovery was performed using a gel recovery kit. Thereafter, the obtained target fragment was ligated to the cloning vector pMD19-T, transformed into DH5α competent cells. After shaking and recovery and overnight culture on the plate at 37 °C, the bacteria were picked and cultured in LB liquid medium containing 100 μg / μL ampicillin for 3 - 5 hours to obtain pMD19-T-irisin bacteria. After identification by PCR and agarose gel electrophoresis, the bacterial solution was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0054] 2. Construction of recombinant plasmid: After resuscitating the pMD19-T-irisin bacteria and the expression vector pET-32a bacterial solution, culture them overnight at 37°C. Extract the plasmid according to the instructions of the plasmid extraction kit and measure the purity and concentration. Use the restriction enzymes BamHⅠ and EcoRⅠ to perform double digestion on the PCR-amplified target gene fragment at a constant temperature of 37°C for 5 - 15 minutes, and add 10 μL of 6×loading buffer to terminate the reaction. After the reaction, separate the digested product by 1.5% agarose gel electrophoresis, cut out the target-sized fragment, and use the gel recovery kit for recovery and purification. Similarly, perform double digestion on the expression vector pET-32a with BamHⅠ and EcoRⅠ, and recover the large fragment by gel electrophoresis. Measure the purity and concentration of the recovered product. At 4°C, use T4 DNA Ligase to mix the digested pET-32a vector and the target fragment and connect them overnight at 4°C. Then transform the ligation product into DH5α competent cells, resuscitate them, and spread them on LB solid medium containing ampicillin for overnight culture at 37°C to obtain monoclonal colonies.

[0055] Pick the monoclonal colonies from the previous step and inoculate them into LB liquid medium supplemented with 1‰ ampicillin, and culture them in a shaker at 37°C for 3 - 5 hours. Then perform colony PCR determination, and use the universal sequencing primers of the vector pET-32a(+) (T7-F and T7-R) for PCR identification. The PCR product is separated by 1.5% agarose gel electrophoresis to judge the product size, screen out the positive clone bacteria, and send them to Shanghai Sangon Biotech Co., Ltd. for sequencing. Verify the nucleotide sequence of the sequencing result with the previously obtained Acipenser baerii irisin cloning sequence. Preserve the strains with completely correct sequencing for later use. Then expand the culture of the correct recombinant strains and extract the recombinant plasmid according to the operation steps of the plasmid extraction kit.

[0056] The result of 1.5% agarose gel electrophoresis shows that there is a single band at approximately 1066 bp as expected, and the sequencing is completely consistent with the expected sequence.

[0057] 3. Expression of the recombinant plasmid in the expression strain: The correctly extracted recombinant expression plasmid was transformed into Transetta (BL21) competent cells, spread on a solid plate containing 1‰ ampicillin, and cultured overnight in a 37°C incubator. The next day, single colonies were selected for colony PCR. The PCR products were electrophoresed on a 1.5% agarose gel to determine the product size, and positive clone bacteria were screened out. Subsequently, they were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The engineered bacteria identified as positive by PCR and with correct sequencing were inoculated into LB liquid medium containing 1‰ ampicillin and cultured overnight at 37°C in a shaker at a frequency of 200 r / min for activation. The next day, they were transferred to LB medium containing 1‰ ampicillin at a ratio of 1:50 or 1:100 and cultured at 37°C for expansion, and the bacterial growth density was detected. When the OD600 value of the bacterial solution reached 0.5, the optimal IPTG induction concentration (set at 0, 0.2, 0.4, 0.6, 0.8, 1.0, and 1.2 mmol / L) and induction time (0, 2, 4, 6, 8, 10, and 12 h) were explored. The bacteria expressing the target protein were collected by centrifugation at 6000 r / min for 5 min, resuspended and washed 3 - 4 times with 1×PBS, and then lysed with lysozyme until viscous. After centrifugation at 12000 r / min for 10 min, the supernatant and precipitate were collected, and then 12% SDS-PAGE electrophoresis was performed for identification to analyze the expression form of recombinant pET-32a-irisin.

[0058] After extracting the recombinant plasmid with correct sequencing and transferring it into Escherichia coli Transetta (BL21), the verified engineered strain was expanded. According to the optimal induction conditions explored previously, 1.2 mmol / L IPTG was added at 37°C for 4 hours to induce the expression, and the bacteria were collected. After repeated freezing and thawing for lysis and centrifugation at high speed for 10 min, the supernatant and precipitate were taken for 12% SDS-PAGE. The results showed that the relative molecular mass of the fusion protein was about 32×103, which was in line with expectations. The expression level accounted for more than 30% of the total bacterial protein. The fusion protein was present in both the supernatant and precipitate after lysis, but mainly in the supernatant. Soluble expression usually represents the correct folding mode of the protein, and the existence form of irisin in the supernatant ensures the spatial conformation of the domain.

[0059] 4. Purification and refolding of the recombinant protein: Take the centrifuged supernatant after lysis and bind it to a nickel ion chelating affinity chromatography column ([ Ni-NTA Resin Kit, TransGen Biotech) at a speed of 1 mL / min. Refer to TransGen Biotech Purification was carried out according to the operation instructions of Ni-NTA Resin column packing. The chromatography column was slowly equilibrated with Tris-HCl buffer for 5-10 column volumes until the baseline was level. The equilibrium buffer (containing 10 mmol / L imidazole) was used for washing to remove bacterial cell impurities. The target protein was eluted with 40, 50, 60, 100, and 150 mmol / L imidazole and collected. The collected eluate was added with 5× protein loading buffer, and boiled for 10 min to denature the protein. The purity of recombinant pET-32a-irisin was analyzed by 12% SDS-PAGE. Take the frozen pET-32a-irisin protein solution, measure the concentration using a BCA protein concentration detection kit, add an appropriate amount of enterokinase, and the ratio of protein to enterokinase is 5 mg:10 U, and mix well. To maximize the preservation of the biological activity of irisin, the enzymatic digestion conditions were selected as a 25 mM Tris-HCl (pH 8.0) buffer system, and enzymatic digestion was carried out at 4°C overnight for 14 h (the optimal enzymatic digestion time explored in preliminary experiments). After enzymatic digestion, a mixed sample was taken for 15% SDS-PAGE electrophoresis to analyze the enzymatic digestion efficiency, enzymatic digestion specificity, and the relative molecular mass of the target protein irisin.

[0060] 5. Secondary affinity purification of recombinant protein: The molecular chaperone protein Trx-Tag thioredoxin carries a 6×His tag. The Trx-Tag thioredoxin after enzymatic digestion was removed by Ni-ion chelating affinity column chromatography, and the mixed solution of irisin protein after enzymatic digestion was separated and purified. Take the mixed solution of the fusion protein after enzymatic digestion, repeat the binding to the nickel ion chelating affinity chromatography column 3 times at a speed of 1 mL / min, carefully collect the flow-through fraction. Take the flow-through fraction, and analyze the purity and relative molecular mass of the purified irisin protein by 15% SDS-PAGE. Calculate the purification yield of the target protein irisin after enzymatic digestion. The purified irisin protein was fully concentrated by centrifugation using an ultrafiltration tube. The concentrated target protein was also identified by 15% SDS-PAGE electrophoresis. The purified and concentrated target protein was stored at -80°C for later use.

[0061] After affinity chromatography, the purity of the pET-32a-irisin fusion protein was above 90%. The purified fusion protein was stored at -80°C for later use. Fully considering the biological function of irisin after enzymatic digestion and avoiding the influence of high temperature on the protein biological activity, enterokinase digestion was carried out at 4°C for 14 h (the optimal enzymatic digestion time explored in preliminary experiments), and then the functional fragment was recovered again. The mixed sample after enzymatic digestion and the sample after secondary affinity purification were analyzed by 15% SDS-PAGE. The results showed that the enzymatic digestion efficiency under these conditions was 100%, no non-specific enzymatic digestion phenomenon occurred, and the relative molecular mass of irisin after enzymatic digestion was about 12×10 3 , which was consistent with the theoretical value.

[0062] Example 3

[0063] This example provides an application of the prepared irisin recombinant protein in the feeding regulation of Acipenser baerii, specifically including the following:

[0064] The prepared irisin recombinant protein was applied in the cultivation of juvenile Acipenser baerii. Specifically, 48 healthy juvenile Acipenser baerii (about 26 g) were selected and randomly divided into 4 groups, with 3 replicates in each group and 4 fish in each replicate. Among them, the control group was intraperitoneally injected with PBS buffer at twice the body weight, and the experimental groups were intraperitoneally injected with irisin recombinant protein at the original concentration gradients of 50, 100, and 200 ng / g BW at twice the body weight, respectively. Before the recombinant protein injection experiment started, each group was first intraperitoneally injected with PBS buffer for 2 days to adapt to the acupuncture stimulation. The intraperitoneal injection started at 13:30 on the day of the injection experiment. Before the injection, the fish were anesthetized with 0.02% MS-222. Feed was provided at 14:00. The residual bait of each group was collected at 15:00, 17:00, and 20:00 and dried and weighed. The food intake was calculated based on the amount of residual bait. The concentration and time point with the most significant effect on food intake were used as the optimal concentration and time for subsequent sample collection in the injection experiment.

[0065] To explore the mechanism of action of irisin on the feeding regulation of Acipenser baerii, 24 healthy juvenile Acipenser baerii (about 30 g) were selected again and randomly divided into 2 groups, which were intraperitoneally injected with PBS buffer and the effective dose of irisin at twice the body weight, respectively. There were 3 replicates in each group and 4 fish in each replicate. The intraperitoneal injection started at 13:30 on the day of the injection experiment. Before the injection, the fish were anesthetized with 0.02% MS-222. Feed was provided at 14:00. In the formal experiment, the effective time points obtained after injection were analyzed. After injection, 3 fish were randomly selected from each treatment group, anesthetized, and sampled. Blood was collected via the caudal vein to detect serum glucose, triglyceride, and cholesterol levels. Subsequently, the fish were decapitated and sacrificed, and brain regions (forebrain, midbrain, hypothalamus, cerebellum, and medulla oblongata), liver, stomach, valvular intestine, duodenum, and muscle tissue samples were quickly dissected on an ice plate. After the brain regions were taken out, they were placed in a 1.5 ml centrifuge tube pre-filled with 500 ml RNAlater, permeated overnight at 4 °C, and then stored in a -80 °C refrigerator. After the liver, stomach, duodenum, valvular intestine, and muscle tissues were taken out, they were rinsed with ice-cold physiological saline, blotted dry, bagged, and immediately frozen in liquid nitrogen, and then stored in a -80 °C refrigerator for detecting the changes in the expression levels of appetite factors and signaling pathway factors in each tissue after irisin protein injection.

[0066] 1. Effect of intraperitoneal injection of irisin on the food intake of Acipenser baerii

[0067] To explore the role of irisin in the appetite regulation of Amur sturgeon, the recombinant irisin protein obtained by prokaryotic expression in the early stage was used to design three different concentration gradients for intraperitoneal injection into Amur sturgeon, and the changes in food intake and cumulative food intake at 1 h, 3 h, and 6 h after injection were measured.

[0068] The results showed that compared with the group intraperitoneally injected with PBS, intraperitoneal injection of 50 ng / g BW and 100 ng / g BW irisin increased the food intake at 0 - 1 h and decreased the food intake at 1 - 3 h and 3 - 6 h, but the differences were not significant; intraperitoneal injection of 200 ng / g BW irisin did not affect the food intake at 0 - 1 h, but significantly inhibited the food intake at 1 - 3 h (P < 0.05), and also inhibited the food intake at 3 - 6 h, but the difference was not significant. The results of the measurement of cumulative food intake showed that compared with the injection of PBS buffer, intraperitoneal injection of 50 and 100 ng / g BW irisin proteins did not affect the cumulative food intake of Amur sturgeon at 1 h, 3 h, and 6 h, but injection of 200 ng / g BW irisin significantly reduced the cumulative food intake at 3 h (P < 0.01) and 6 h (P < 0.05). It can be seen from the above that when the concentration of intraperitoneally injected irisin protein is 200 ng / g BW, it can rapidly inhibit the feeding of Amur sturgeon, and its inhibitory effect on cumulative food intake is more persistent.

[0069] 2. Effects of intraperitoneal injection of irisin on physiological and biochemical indexes of Amur sturgeon

[0070] To explore the energy changes caused by injecting the recombinant irisin protein, the changes in glucose, triglyceride, and cholesterol in serum were detected using related kits 3 h after injecting the recombinant irisin protein. The results showed that the levels of serum glucose, serum triglyceride, and serum total cholesterol in Amur sturgeon were significantly decreased 3 h after injecting irisin (P < 0.05).

[0071] 3. Effects of irisin on appetite regulatory factors of Amur sturgeon

[0072] To clarify the central appetite regulation mechanism of irisin, the expression changes of appetite factors in each brain region of the central nervous system were detected 3 h after intraperitoneal injection of 200 ng / g BW recombinant irisin protein.

[0073] Central nervous system results showed that the expressions of agrp, ghrelin, npy, orexin, cart, and pomc in the hypothalamus were all up-regulated, among which the expressions of npy and cart were significantly up-regulated (P < 0.05), and the expressions of agrp, ghrelin, and pomc were extremely significantly up-regulated (P < 0.01); in the cerebellum, the expressions of agrp, npy, and cart were significantly up-regulated (P < 0.05), while the expressions of ghrelin, orexin, and pomc showed no significant changes.

[0074] 4. Effects of Irisin on Key Signaling Factors in the Feeding Center of Acipenser baerii

[0075] To further explore the mechanism of irisin regulating feeding, this experiment also detected the expressions of related signaling pathway factors and kinases in the hypothalamus after injecting irisin. The results showed that after intraperitoneal injection of 200 ng / g BW irisin protein, the expressions of ampkα1, ampkβ1, ampkγ1, and ampkγ2 were significantly up-regulated, and the expressions of acc, cpt1, jak2, socs3, sk6, mtor, pi3k, and stat3 were all significantly up-regulated.

[0076] The fluorescence quantitative related primers for measuring the influencing factors of appetite factors in Example 3 are shown in Table 2 below.

[0077] Table 2 Fluorescence Quantitative Related Primers for Appetite Factors

[0078]

[0079]

[0080] For the convenience of sequence list software recognition, in the table, Ampk a1 = Ampkα1, Ampk a2 = Ampkα2, Ampk b1 = Ampkβ1, Ampk r1 = Ampkγ1, Ampk r2 = Ampkγ2, ef1 a = ef1α, b-actin = β-actin.

[0081] All data in Example 2 and Example 3 were expressed as mean ± standard error (Mean ± S.E.M). All experimental data were analyzed using statistical software SPSS 27.0. The data were subjected to normal distribution test and homogeneity of variance analysis. The significant difference between two samples was compared by independent sample T-test; the significant difference between every two groups of data was compared by one-way ANOVA, and then multiple comparison analysis was performed by Duncan method. P < 0.05 indicated significance, P < 0.01 indicated extremely significance, and P < 0.001 indicated super significance. Finally, the result charts were drawn using GraphPad 8.0 software according to the requirements.

[0082] The foregoing has shown and described the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited by the above embodiments, and what is described in the above embodiments and the specification is only to illustrate the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention will have various changes and improvements, and these changes and improvements fall within the scope of the present invention claimed. The scope of the present invention claimed is defined by the appended claims and their equivalents.

Claims

1. A method for preparing a recombinant protein of Acipenser sibiricus irisin, characterized in that: The following steps are involved: Step 1: Sampling and storing healthy Siberian sturgeon juveniles, then using a total RNA extraction kit to extract RNA and perform detection and screening, and finally reversely transcribing the extracted total RNA using a reverse transcription kit to prepare a cDNA template; Step 2: Based on the genome of Acipenser sterlete in NCBI, the sequence information of the FNDC5 gene was found, and then multiple sequence alignment was performed to find the Irisin sequence contained therein, and specific primers were designed for PCR amplification of irisin-yF and irisin-yR. The target fragment band in the obtained PCR product was excised and recovered, and then connected with the cloning vector pMD19-T, transformed into DH5α competent cells and cultured to obtain pMD19-T-irisin bacteria; Step 3: After the pMD19-T-irisin bacteria and the expression vector pET-32a were revived, they were cultured at 37°C overnight, and then plasmids were extracted using a plasmid extraction kit. Then, restriction endonucleases BamHⅠ and EcoRⅠ were used for double digestion to obtain the digested pET-32a vector and target fragment, and T4 DNA Ligase was used to mix them overnight at 4°C. The ligation products were transformed into DH5α competent cells for culture to obtain monoclonal colonies; Step 4: Perform PCR assay on the monoclonal colonies, screen out positive clones for sequencing, expand the correct recombinant strains, and use a plasmid extraction kit to extract the recombinant plasmid; Step 5: Transform the recombinant plasmid into Transetta competent cells for culture, select monoclonal colonies for colony PCR screening and sequencing of positive clones, activate and expand the positive engineering strains after sequencing and detect the growth density, then perform induction culture and collect the induced expression bacteria, break the bacteria and centrifuge them to collect the supernatant and precipitate; Step 6: Take the centrifuged supernatant and purify it using an affinity chromatography column combined with nickel ion chelation, use 100 mmol / L imidazole to elute and collect the target protein to obtain irisin recombinant protein.

2. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: In the step 1, the RNA integrity is detected by 1.5% agarose gel electrophoresis; the purity and concentration of the RNA are detected by a nucleic acid protein analyzer.

3. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: The PCR reaction system in step 2 includes 5 μL 2×Taq PCR MasterMix, 3 μL ultrapure water, 1 μL total RNA extract containing irisin sequence, and 0.5 μL each of upstream primer irisin-yF and downstream primer irisin-yR.

4. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: Before the target fragment band is cut off in step 2, 1.5% agarose gel electrophoresis is used to detect the specificity and brightness of the PCR product band to determine the target fragment band, and a gel recovery kit is used to recover DNA after the target fragment band is cut off; After transformation into DH5α competent cells, the cells were revived and plated and cultured overnight at 37°C. The cells were selected and cultured in LB liquid medium containing 100 μg / μl ampicillin for 3-5 hours to obtain pMD19-T-irisin bacteria.

5. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: In the step 3, the double enzyme digestion reaction is carried out at a constant temperature of 37° C. for 5-15 minutes, and then 10 μL 6×loading buffer is added to terminate the reaction. After the end, the digestion products are separated by 1.5% agarose gel electrophoresis, and the target size fragments are cut out, and the gel recovery kit is used to recover and purify, and the purity and concentration of the recovered products are respectively measured; when the competent cells are cultured, they are first revived and then coated on LB solid culture medium containing ampicillin and cultured overnight at 37° C. to obtain monoclonal colonies.

6. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: The step 4 specifically comprises picking a monoclonal colony and inoculating it into LB liquid culture medium with 1‰ ampicillin, placing it in a 37°C shaker for expansion culture for 3-5 hours, and then performing PCR determination, using the universal sequencing primers T7-F and T7-R of the vector pRT-32a for PCR identification, subjecting the PCR product to 1.5 agarose gel electrophoresis to determine the product size and screen out positive clones for sequencing, expanding the culture of the correctly sequenced recombinant strain, and using a plasmid extraction kit to extract the recombinant plasmid.

7. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: In the step 5, when culturing the Transetta competent cells, they are spread on a solid plate with 1‰ ampicillin, and placed in a 37°C incubator for overnight culture; when screening positive clones, the colony PCR products are subjected to 1.5% agarose gel electrophoresis to determine the product size and screen; the activation and expansion culture is specifically inoculating the positive clones in LB liquid culture medium with 1‰ ampicillin, placing them in a 37°C shaker at a frequency of 200 r / min for overnight culture for activation, and the next day they are transferred to LB culture medium containing 1‰ ampicillin at a ratio of 1:50-100 and expanded at 37°C.

8. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: In step 5, the bacterial cell collection is performed by centrifuging the bacterial solution in a centrifuge at 6000 r / min for 5 minutes; The bacterial cell disruption treatment is to resuspend the collected bacterial cells in 1×PBS, wash them 3-4 times, add lysozyme to disrupt the bacterial cells until they become viscous, and centrifuge them in a centrifuge at 12000 r / min for 10 minutes.

9. The method for preparing a recombinant protein of Acipenser sibiricus irisin according to claim 1, characterized in that: In the step 6, before using imidazole for elution, Tris-HCl buffer is first used to slowly balance the chromatography column for 5-10 column volumes until the baseline is in a horizontal state to remove bacterial impurities.

10. Use of the irisin recombinant protein prepared by the method for preparing the irisin recombinant protein of Siberian sturgeon according to claim 1 in regulating the feeding of Siberian sturgeon.

Images