Recombinant lactobacillus plantarum method for overexpressing GAPDH and application of recombinant lactobacillus plantarum

Abstract

The invention discloses a recombinant lactobacillus plantarum method for overexpressing GAPDH and application of the recombinant lactobacillus plantarum, and the method comprises the following steps: designing a specific primer according to a GAPDH gene sequence, and amplifying a gene segment containing FLAG; inserting the gene segment into a constitutive shuttle expression vector pMG36e to construct an in-vitro recombinant expression plasmid; transferring the recombinant expression plasmids into E.coli MC1061F competent cells by using a heat shock conversion method, and carrying out mass amplification; and transferring the amplified recombinant expression plasmid into wild competent lactobacillus plantarum by an electric shock conversion method to prepare the recombinant lactobacillus plantarum for overexpressing the GAPDH. The constructed overexpression recombinant lactobacillus plantarum is used for improving the forming speed and capacity of a biological membrane and enhancing the intestinal adhesion colonization capacity. Experiments for measuring the biofilm amount and the intestinal epithelial cell adhesion of paralichthys olivaceus prove that the adhesion and colonization capability of the lactobacillus plantarum LP-PO23 can be enhanced by overexpression of the GAPDH.

Description

Technical Field

[0001] The present invention relates to a method for obtaining highly adherent plant lactobacillus by a recombination method, and in particular to a method for overexpressing GAPDH and an application thereof, belonging to the technical field of molecular biology. Background Art

[0002] Bacterial diseases are a key bottleneck restricting the sustainable development of flatfish aquaculture. Probiotics can prevent and control bacterial diseases by regulating intestinal flora homeostasis and host immune responses, but the difficulty of long-term colonization in the intestine after discontinuation of probiotics is a core challenge for the effective application of probiotics. As an important aquatic probiotic, Lactobacillus plantarum's adhesion and colonization ability is key to its stable colonization in the intestine and is also a prerequisite for its function. Improving the adhesion and colonization ability of Lactobacillus plantarum in the flatfish intestine is of great significance to fully exerting its probiotic function.

[0003] Biofilms are bacterial aggregates with a specific spatial structure formed when microorganisms adhere to solid surfaces by secreting extracellular polymers that encapsulate their cells. In nature, microorganisms universally possess the ability to form biofilms. The formation of this structure enables microorganisms to better survive and thrive in complex and changing environments. Biofilms enhance the adhesion of probiotics to intestinal epithelial cells. This adhesion helps probiotics colonize the intestines and form a stable bacterial community. By tightly binding to intestinal epithelial cells, probiotics can compete for nutrients and adhesion sites, inhibiting the growth of harmful bacteria and maintaining a balanced intestinal microbiome.

[0004] Currently, the methods to obtain highly adhesive probiotics are to isolate and screen them from nature, optimize culture conditions, and use biomaterial encapsulation, prebiotic synergy, and stress pretreatment to enhance their adhesion properties. However, no effective methods to improve the adhesion and colonization ability of probiotics have been found in aquaculture. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for overexpressing GAPDH in recombinant plant lactobacillus, and the obtained recombinant plant lactobacillus has stronger adhesion and colonization ability than ordinary plant lactobacillus.

[0006] Another object of the present invention is to provide the use of the recombinant lactobacillus overexpressing GAPDH, which is used to enhance the adhesion and colonization of probiotics in the intestine of flounder, providing an important tool for further understanding the adhesion and colonization mechanism of Lactobacillus plantarum in the intestine of flounder.

[0007] A method for overexpressing GAPDH by recombinant Lactobacillus plantarum is characterized by comprising the following steps: Step 1) First, the structure and basic properties of the Lactobacillus plantarum GAPDH protein were analyzed and predicted. Specific primers containing a FLAG tag were designed based on the GAPDH gene sequence to amplify the gene fragment containing the FLAG. Step 2) inserting the FLAG-GAPDH gene fragment into the constitutive shuttle expression vector pMG-36e to construct an in vitro recombinant expression plasmid FLAG-GAPDH-pMG36e; Step 3) Preparation E. coli MC1061F competent cells were used to transfer the recombinant expression plasmid into E. coli MC1061F competent cells were then extensively amplified; Step 4) Extract the above E. coli The recombinant expression plasmid amplified in MC1061F was transformed into wild-type competent Lactobacillus plantarum by electroporation to prepare recombinant Lactobacillus plantarum overexpressing GAPDH.

[0008] The specific primers described in step 1) are as follows: Table 1 Specific primers containing FLAG tags Primer name Primer sequence (5'-3') Restriction site GAPDH-F <![CDATA[ GAGCTC GCATGTCTGTAAAAATTGGTATTAATGGTTTCGGACGT]]> I GAPDH-R <![CDATA[ AAGCTT A CTTGTCATCGTCGTCCTTGTAATC AGTGGCGAACTTCAAT]]> Ⅲ .

[0009] The pMG36e is a constitutive plasmid that can be used as a shuttle vector in Lactobacillus-Escherichia coli. E. coli MC1061F and Lactobacillus acidophilus.

[0010] Step 3) The competent cell preparation method is as follows: LP-PO23 stored at -80 °C was inoculated into MRS liquid medium and rejuvenated overnight; 90 mL of MRS medium was taken, 10 mL of 10% glycine stock solution was added, and the fresh bacterial liquid was transferred to the medium until the OD600 reached 0.25; the culture was statically cultured at 37 °C for 2-4 h until the OD600 of the bacterial liquid reached 0.6; the suspension was centrifuged at 5000 rpm and 4 °C for 5 min, and the supernatant was discarded to collect the bacteria; the bacteria were gently resuspended in 50 mL of 1 mM MgCl2 and centrifuged at 5000 rpm and 4 °C for 5 min to collect the bacteria; 50 mL of 30% PEG1500 was added to the precipitate, gently pipetted to resuspend, and centrifuged; the bacteria were resuspended in 1 mL of 30% PEG1500, 40 μL per tube was dispensed into centrifuge tubes, and frozen in a -80 °C refrigerator until use.

[0011] Step 4) The method for electroporation transformation of the re-expression group plasmid into wild-type Lactobacillus plantarum is as follows: Take 40 μL of LP-PO23 competent cells and let it stand on ice for 5 min; add 2 μL of recombinant plasmid DNA (the volume of DNA is ≤ 1 / 20 of the volume of competent cells) and mix gently; transfer the mixed solution to an electric shock cup with a 2 mm electrode spacing (pre-cooled at -20 °C), avoiding the formation of bubbles and ensuring that the cell suspension is evenly distributed at the bottom of the electric shock cup; place the electric shock cup in an electroporator and set the voltage to 1.5 kV for electric shock; after the electric pulse ends, immediately add MRSSM to 1 mL and transfer the bacterial solution to a centrifuge tube; incubate anaerobically at 37 °C for 2 h; centrifuge the bacterial solution and spread it on an MRS plate containing 100 μg / mL EM; place the plate upside down in an anaerobic culture bag and incubate at 37 °C for 3 days; pick a single colony and incubate in 100 μg / mL EMMRS medium for 12 h. The white precipitate at the bottom was collected by centrifugation to extract the plasmid, and PCR was performed using the extracted plasmid as a template. After agarose gel electrophoresis, the PCR products of positive bacteria were sequenced; the recombinant plasmid was double-enzyme digested to verify its correctness.

[0012] The application of the recombinant plant lactobacillus obtained by the method is characterized in that the recombinant plant lactobacillus overexpressing GAPDH is used to improve the speed and ability of biofilm formation.

[0013] The application of the recombinant plant lactobacillus obtained by the method is characterized in that the recombinant plant lactobacillus overexpressing GAPDH is used to enhance the intestinal adhesion and colonization ability.

[0014] The adhesion and colonization of lactobacilli in the intestines underpins their probiotic effects. We have discovered that glyceraldehyde-3-phosphate dehydrogenase (GAPDH) exists on the cell surface of Lactobacillus plantarum. This enzyme, acting as a part-time adhesion protein, effectively enhances probiotic adhesion. GAPDH possesses the ability to adhere to host epithelial mucins or to fibronectin and plasminogen in the cytoplasm, making it an essential mediator of host-microbe interactions. In lactobacilli, GAPDH acts as a part-time adhesin, located free on the cell wall, mediating bacterial adhesion to intestinal mucins, cardiomyocytes, and Caco-2 cells.

[0015] GAPDH is a cytoplasmic protein involved in glycolysis and has numerous other physiological functions. After secretion, GAPDH can reattach to the intestinal epithelial cell wall as a non-anchored protein and act as a moonlighting protein in the colonization of the intestinal mucosa by lactic acid bacteria. GAPDH exists as an anchorless molecule on the surface of Lactobacillus plantarum and Lactobacillus crispatus and participates in the colonization of probiotics in the intestine through its non-glycolytic moonlighting role.

[0016] The present invention constructs a Lactobacillus plantarum that overexpresses GAPDH. Using LP-PO23 bacterial genomic DNA as a template, the FLAG-GAPDH gene is amplified using specific expression primers. After enzyme digestion, the gene is ligated to the Lactobacillus constitutive expression vector pMG36e. The recombinant plasmid is transformed into LP-PO23 using high-voltage pulse electroporation. Positive transformants are screened using erythromycin-resistant MRS solid culture medium, and the positive bacterial plasmids are extracted and sent for sequence determination. Furthermore, the successful transformation of GAPDH is verified by Western blotting and immunofluorescence experiments. Comparative experiments measuring biofilm content and adhesion to intestinal epithelial cells of flounder demonstrate that overexpressing GAPDH enhances the adhesion and colonization ability of Lactobacillus plantarum LP-PO23. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : Agarose gel electrophoresis of PCR-amplified GAPDH gene fragment; Among them, M: Marker; 1: GAPDH gene.

[0018] Figure 2 : pMG36e-GAPDH colony PCR results; Among them, M: Marker; 1: PCR test result.

[0019] Figure 3 : Western-blotting results of recombinant plasmid expressed in Escherichia coli; Among them, M: Marker; 1: MC1061F incubated with mouse anti-Flag monoclonal antibody (negative control); 2: GAPDH-MC1061F incubated with mouse anti-Flag monoclonal antibody; 3: MC1061F incubated with mouse anti-GAPDH polyclonal antibody (negative control); 4: GAPDH-MC1061F incubated with mouse anti-GADPH polyclonal antibody.

[0020] Figure 4 : Immunofluorescence detection of pMG-36e-GAPDH expression in LP-PO23 cells (Scale bar = 10 μm).

[0021] Figure 5 :Western-blotting was used to detect the expression of pMG-36e-GAPDH; Among them, M: Marker; 1: LP-PO23 incubated with mouse anti-GAPDH polyclonal antibody; 2: LP-pMG-36e incubated with mouse anti-GAPDH polyclonal antibody; 3: LP-GAPDH incubated with mouse anti-GAPDH polyclonal antibody; 4: LP-PO23 incubated with mouse anti-Flag monoclonal antibody; 5: LP-pMG-36e incubated with mouse anti-Flag monoclonal antibody; 6: LP-GAPDH incubated with mouse anti-Flag monoclonal antibody.

[0022] Figure 6 : Biofilm formation curve.

[0023] Figure 7 :The difference in adhesion between LP-PO23 and GAPDH-LP-PO23 to intestinal epithelial cells of flounder (scale bar = 5 μm); Among them, A: wild-type strain LP-PO23; B: recombinant strain GAPDH-LP-PO23. DETAILED DESCRIPTION

[0024] The present invention uses bioinformatics software (DNAStar and IEDB software, etc.) to analyze and predict the structure of Lactobacillus plantarum GAPDH protein and the basic properties of the protein.

[0025] Specific primers containing FLAG tags were designed according to the GAPDH gene sequence to amplify the FLAG-GAPDH gene.

[0026] The GAPDH gene fragment was inserted into the constitutive expression vector pMG36e, successfully constructing the in vitro recombinant expression plasmid pMG36e-GAPDH. The plasmid map of pMG36e-GAPDH was generated using Snapgene software.

[0027] The recombinant plasmid pMG36e-GAPDH was transformed into Escherichia coli competent cells by the heat shock method: after culture, the recombinant plasmid pMG36e-GAPDH was extracted and transformed into Escherichia coli DH5α competent cells by the heat shock method and electrotransformed into competent LP-PO23.

[0028] The present invention will be further described below with reference to the accompanying drawings and through specific embodiments.

[0029] Example 1: Method for overexpressing GAPDH recombinant Lactobacillus plantarum 1. Acquisition of GAPDH gene The GAPDH gene sequence of Lactobacillus plantarum was obtained from the NCBI database, and primers containing the FLAG-tag gene sequence were designed.

[0030] After the Lactobacillus plantarum culture was amplified and cultured to the logarithmic growth phase, the cells were collected by centrifugation, and the genomic DNA was extracted and amplified to obtain the GAPDH gene fragment containing the FLAG-tag; the agarose gel electrophoresis diagram of the PCR-amplified GAPDH gene fragment is shown in FIG. Figure 1 shown.

[0031] 2. Construction of pMG36e-GAPDH recombinant plasmid (1) Select appropriate restriction endonucleases, establish an enzyme digestion system, and use restriction endonucleases to digest the PCR product of the GAPDH target gene and the pMG-36e empty plasmid. Sac I and Hind III. Simultaneously perform enzyme digestion to recover the target fragment; (2) Sca I / Hind III. The GAPDH gene fragment purified by double enzyme digestion was mixed with the pMG-36e vector, T4 DNA ligase was added, and the ligation was carried out overnight at 16°C in a metal bath to obtain the recombinant plasmid pMG-36e-GAPDH. The correctness of the ligation was verified by colony PCR and restriction enzyme digestion; (3) The recombinant plasmid pMG-36e-GAPDH was transformed into Escherichia coli DH5α competent cells by heat shock method: first, the DH5α competent cells were placed in an ice bath to melt, and then the recombinant plasmid ligation product was added and gently flicked to mix; the bacterial solution was evenly spread on the surface of the MRS solid culture medium plate containing erythromycin, and the plate was inverted and placed in a 37°C constant temperature incubator for overnight culture. After the single colony was formed, a single colony was picked and inoculated into 5 mL of MRS liquid culture medium (containing erythromycin); the plasmid was extracted using a plasmid extraction kit to form the recombinant plasmid pMG36e-GAPDH. The pMG36e-GAPDH colony PCR results are as follows: Figure 2 shown.

[0032] 3. Recombinant plasmid E. coli Expression in MC1061F preparation E. coli Preparation method of MC1061F competent cells: (1) Inoculate LP-PO23 stored at -80 °C into MRS liquid medium and rejuvenate overnight; (2) Take 90 mL of MRS medium, add 10 mL of 10% glycine stock solution, and transfer the fresh bacterial liquid into the medium until the OD600 reaches about 0.25; (3) Cultivate at 37°C for 2-4 hours until the OD600 of the bacterial solution reaches approximately 0.6; (4) Centrifuge at 5000 rpm, 4 °C for 5 min, discard the supernatant and collect the cells; (5) Gently resuspend the cells in 50 mL of 1 mM MgCl2 (pre-cooled at 4 °C) and centrifuge at 5000 rpm at 4 °C for 5 min to collect the cells. (6) Add 50 mL of 30% PEG1500 (pre-cooled at 4 °C) to the precipitate, gently pipette to resuspend, and centrifuge; (7) Resuspend the cells in 1 mL of 30% PEG1500 and dispense 40 μL of the solution into centrifuge tubes (pre-cooled at -20 °C) and store in a -80 °C freezer until ready for use.

[0033] The constructed pMG36e-GAPDH recombinant plasmid was transformed with heat stimulation E. coli After the recombinant plasmid was induced to express, the positive expression strain was selected and named GAPDH-MC1061F. SDS-PAGE and Western analysis showed that the recombinant plasmid was E. coli The Western-blotting results of the recombinant plasmid expressed in E. coli are shown in Figure 2. Figure 3 shown.

[0034] IV. Expression of pMG36e-GAPDH in LP-PO23 The recombinant plasmid pMG36e-GAPDH was transformed into LP-PO23 by electroporation, and protein expression was verified by SDS-PAGE electrophoresis and Western blotting. Figure 4 As shown, Western-blotting was used to detect the expression of pMG-36e-GAPDH. Figure 5 shown.

[0035] The method for electroporation transformation of the recombinant plasmid into wild-type Lactobacillus plantarum is as follows: (1) Take 40 μL of LP-PO23 competent cells and place on ice for 5 min; (2) Add 2 μL of recombinant plasmid DNA (the volume of DNA should be ≤ 1 / 20 of the volume of competent cells) and mix gently; (3) Transfer the mixed solution to an electric shock cup with a 2 mm electrode spacing (pre-cooled at -20 °C), avoiding the formation of bubbles and ensuring that the cell suspension is evenly distributed on the bottom of the electric shock cup; (4) Place the shock cup into the electroporator and set the voltage to 1.5 kV for electric shock; (5) After the electric pulse ends, immediately add MRSSM to 1 mL and transfer the bacterial solution to a centrifuge tube; (6) Anaerobic incubation at 37 °C for 2 h; (7) Centrifuge the bacterial solution and spread it on an MRS plate containing 100 μg / mL EM; (8) Place the plate upside down in an anaerobic culture bag and incubate at 37 °C for 3 days; (9) Pick a single colony and culture it in 100 μg / mL EM MRS medium for 12 h; (10) Collect the white precipitate at the bottom by centrifugation to extract the plasmid, use the extracted plasmid as a template for PCR, and sequence the PCR products of positive bacteria after agarose gel electrophoresis; (11) The recombinant plasmid was double-digested to verify its correctness.

[0036] 2: Detection of GAPDH-LP-PO23 biofilm formation of the present invention (1) Inoculate LP-PO23 and GAPDH-LP-PO23 strains into MRS medium and culture overnight; (2) Dilute the cultured bacterial solution to OD 600 =1; (3) Take a 96-well plate and accurately add 200 μL of diluted LP-PO23 or GAPDH-LP-PO23 bacterial solution to each well. Then, place the culture plate in a 37°C incubator and incubate for 6 h, 12 h, 24 h, 48 h, and 72 h respectively; (4) After incubation for different periods of time, the supernatant in the culture plate was aspirated, washed twice with 200 μL PBS, and dried; (5) Add 200 μL of methanol to each well for 10 min. After aspirating the methanol, wash with 200 μL of PBS and air-dry. (6) Add 100 μL of 0.1% crystal violet staining solution to each well and let it stand for 10 minutes; (7) After staining, add PBS and wash three times to remove floating color; (8) Add 100 μL of acetic acid solution to each well and mix thoroughly. Use a microplate reader to measure the OD value of the sample. 600 The absorbance value at .

[0037] (9) The results showed that the amount of biofilm formed by the two strains gradually increased with the increase of incubation time. Compared with the wild-type strain, the recombinant strain had a faster and more stable biofilm formation rate. The biofilm formation curve is shown in Figure 2. Figure 6 shown.

[0038] 3: Adhesion of GAPDH-LP-PO23 of the present invention to intestinal epithelial cells of flounder 1. Extraction of intestinal epithelial cells of flounder: (1) Disinfect the fish surface with 75% ethanol and dissect the fish; (2) Remove the intestine, remove the mesentery and place it in sterile D-Hanks solution to wash off the surface mucus; (3) Gently irrigate the intestine with digestive fluid A to clear intestinal contents; (4) Slowly inject digestion solution B into the intestinal cavity, seal both ends with sterile dovetail clips, and incubate on a horizontal shaker for 10 minutes. After incubation, drain the digestion solution B. (5) Inject the digestion solution C into the intestine, place it on a shaker and incubate for 2 minutes, and collect the digestion solution C in a centrifuge tube; (6) Repeatedly inject digestive fluid C into the intestine, incubate for 4 min, 6 min, 10 min, and 15 min, and collect digestive fluid C; (7) The collected digestion solution C was centrifuged at 300 g for 10 min at 4°C and washed twice with PBS; (8) Use a blood cell counting plate to count the number of epithelial cells extracted.

[0039] 2. Adhesion of Lactobacillus to Intestinal Epithelial Cells in Vitro: (1) Adjust the intestinal epithelial cell density to 1×10 8 cells / mL; (2) Pipette 100 μL of cell suspension and drop it onto the center area of ​​a clean glass slide. Place the slide in a humidified chamber and let it stand at room temperature for 30 minutes to allow the cells to fully settle. Then gently remove the supernatant and air-dry the slide. (3) Block the cell slides with 4% BSA in PBS for 2 h and then wash three times with PBS; (4) Add 100 μL of bacterial solution (5×10 8 CFU / mL) were incubated with cells at 37°C for 2 h. After the incubation was completed, the excess liquid on the surface was poured off. (5) Add an appropriate amount of PFA to the cell slide and fix the bacteria for 30 min. Then wash the slide three times with PBST and air-dry it. (6) After Gram staining, the adhesion of the wild-type strain LP-PO23 and the recombinant strain GAPDH-LP-PO23 to the intestinal epithelial cells was observed under a microscope. The results showed that the number of GAPDH-LP-PO23 adhering to the intestinal epithelium was 33.75±5.32, and the number of LP-PO23 adhering to the intestinal epithelial cells of the flounder was 23.50±4.65, which was about 2 / 3 of the number of the recombinant strain. The difference in adhesion between LP-PO23 and GAPDH-LP-PO23 to the intestinal epithelial cells of the flounder is shown in Figure 2. Figure 7 shown.

Claims

1. A method for overexpressing GAPDH in recombinant Lactobacillus plantarum, characterized in that The following steps are involved: Step 1) First, the structure and basic properties of the Lactobacillus plantarum GAPDH protein were analyzed and predicted. Specific primers containing a FLAG tag were designed based on the GAPDH gene sequence to amplify the gene fragment containing the FLAG. Step 2) inserting the FLAG-GAPDH gene fragment into the constitutive shuttle expression vector pMG-36e to construct an in vitro recombinant expression plasmid FLAG-GAPDH-pMG36e; Step 3) Preparation E. coli MC1061F competent cells were used to transfer the recombinant expression plasmid into E. coli MC1061F competent cells were then extensively amplified; Step 4) Extract the above E. coli The recombinant expression plasmid amplified in MC1061F was transformed into wild-type competent Lactobacillus plantarum by electroporation to prepare recombinant Lactobacillus plantarum overexpressing FLAG-GAPDH.

2. The method for overexpressing GAPDH in recombinant Lactobacillus plantarum according to claim 1, wherein the specific primers in step 1) are as follows: Table 1 Specific primers containing FLAG tags 。 3. The method for overexpressing GAPDH in plant lactobacillus according to claim 1, wherein Step 3) The competent cells of Lactobacillus plantarum are prepared by the following method: LP-PO23 stored at -80°C was inoculated into MRS liquid medium and rejuvenated overnight. 90 mL of MRS medium was added with 10 mL of 10% glycine stock solution, and the fresh bacterial suspension was transferred to the medium until the OD600 reached 0.

25. The culture was incubated at 37°C for 2-4 h until the OD600 of the bacterial suspension reached 0.

6. The suspension was centrifuged at 5000 rpm at 4°C for 5 min, and the supernatant was discarded to collect the cells. The cells were gently resuspended in 50 mL of 1 mM MgCl2 and centrifuged at 5000 rpm at 4°C for 5 min to collect the cells. 50 mL of 30% PEG1500 was added to the precipitate, which was gently pipetted to resuspend and centrifuged. The cells were resuspended in 1 mL of 30% PEG1500, aliquoted into centrifuge tubes (40 μL each), and stored in a -80 °C freezer until use.

4. The method for overexpressing GAPDH in recombinant Lactobacillus plantarum according to claim 1, wherein the method for electroporation transformation of the recombinant expression plasmid into wild-type Lactobacillus plantarum in step 4) is as follows: Take 40 μL of LP-PO23 competent cells and let it stand on ice for 5 min; add 2 μL of recombinant plasmid DNA and mix gently; transfer the mixed solution to an electric shock cup with a 2 mm electrode spacing to avoid bubbles and ensure that the cell suspension is evenly distributed at the bottom of the electric shock cup; place the electric shock cup in an electroporator and set the voltage to 1.5 kV for electric shock; after the electric pulse ends, immediately add MRSSM to 1 mL and transfer the bacterial solution to a centrifuge tube; incubate anaerobically at 37 °C for 2 h; centrifuge the bacterial solution and spread it on an MRS plate containing 100 μg / mL EM; place the plate upside down in an anaerobic culture bag and incubate at 37 °C for 3 days; pick a single colony and incubate it in 100 μg / mL EM MRS medium for 12 h.

5. The use of the recombinant plant lactobacillus obtained by the method of claim 1, 2, 3 or 4, characterized in that The recombinant Lactobacillus plantarum that overexpresses GAPDH is used to improve the speed and ability of biofilm formation.

6. Use of the recombinant plant lactobacillus obtained by the method of claim 1, 2, 3 or 4, characterized in that The application of the recombinant Lactobacillus plantarum that overexpresses GAPDH in enhancing intestinal adhesion and colonization ability.

Images