Reversible gene silencing stable cell line construction method based on inducible shRNA expression

Abstract

The invention discloses a reversible gene silencing stable cell line construction method based on inducible shRNA (short hairpin Ribonucleic Acid) expression, which belongs to the technical field of biology and comprises the following steps: (1) transferring a vector containing a drug inducible promoter system and a shRNA sequence of a targeted specific gene into a target cell through lentiviral transfection, screening through puromycin to obtain a monoclonal cell population of a stable integration vector; (2) adding doxycycline into the culture medium of the monoclonal cell population, and inducing shRNA expression to silence target protein; and (3) verifying the expression recovery of the target protein by removing doxycycline, and confirming the reversibility of the system. According to the invention, shRNA expression is controlled through the drug-induced promoter system, reversible silencing of specific genes is realized, and the drug-induced promoter system has the characteristics of high induction efficiency, low background expression and good stability.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to a method for constructing a stable cell line with reversible gene silencing based on inducible shRNA expression. Background Art

[0002] RNA interference (RNAi) technology is an important molecular biology method for specifically inhibiting gene expression through small RNA molecules. Since it was first discovered in Caenorhabditis elegans by Fire and Mello in 1998, it has become a powerful tool for studying gene functions. Short hairpin RNA (shRNA), as a key component of RNAi technology, forms a double-stranded RNA structure through intracellular expression, and is then processed by Dicer enzyme into small interfering RNA (siRNA) of 21-25 nucleotides. Finally, it specifically recognizes and degrades the target mRNA through the RNA-induced silencing complex (RISC), thereby achieving gene silencing.

[0003] With the wide application of RNAi technology, researchers have found that traditional gene silencing methods have obvious limitations. The mainstream shRNA expression systems on the current market mainly rely on two types of technical routes: one is a constitutive expression system driven by constitutive promoters (such as CMV, U6, etc.), and the other is an inducible system that can be regulated by exogenous stimuli (such as tetracycline drugs).

[0004] In terms of the constitutive expression system, the pSUPER vector system developed by Brummelkamp et al. (2002) uses the U6 or H1 promoter to drive the continuous expression of shRNA. Although it achieves effective silencing of the target gene, long-term studies have shown that such systems have significant defects: First, the continuous high expression of shRNA often leads to severe off-target effects, causing non-specific gene silencing; Second, the long-term silencing of essential genes for cell survival will significantly affect cell viability, and even lead to a growth selectivity shift in the experimental cell population; In addition, the long-term high expression of shRNA will competitively occupy the intracellular RNA interference processing mechanism, interfere with the function of endogenous miRNAs, and produce unexpected cell physiological changes. These problems severely limit the application of the constitutive shRNA system in long-term studies and sensitive cell types.

[0005] In view of the limitations of constitutive systems, the Tet-On / Off inducible system pioneered by the Gossen and Bujard teams (1992) provided a new idea for controllable gene expression, and this system was subsequently modified by researchers such as Wiznerowicz and Trono (2003) for shRNA expression regulation. However, existing inducible RNAi systems still face multiple technical bottlenecks: for example, the pSLIK system reported by Zhou et al. (2008) achieved doxycycline regulation, but there was a "leaky expression" (background expression in the uninduced state) as high as 20 - 30%, resulting in unstable experimental baselines; in addition, the pTRIPZ system developed by Shin et al. (2006) required a high concentration of inducer (usually 2 - 5 μg / mL tetracycline drugs) to achieve effective induction, which not only increased the experimental cost, but more importantly, high concentrations of tetracycline drugs often had a significant negative impact on cell metabolism and proliferation, interfering with the biological interpretation of experimental results.

[0006] In addition, multiple studies such as Tang et al. (2009) and Wiederschain et al. (2009) have shown that existing inducible shRNA systems have obvious problems of expression attenuation during long-term subculture, which is mainly due to the chromatin remodeling effect of integrated genes and promoter methylation inhibition. At the same time, the application of existing systems in sensitive cell types such as iPSCs is limited. The research by Zafarana et al. (2009) found that conventional shRNA systems often cause abnormal differentiation and cell cycle disorders in stem cells, seriously affecting the maintenance of stem cell characteristics.

[0007] To address the above technical problems, the present invention provides an shRNA expression system based on the optimized Tet-On-puro promoter system linked to the miRNA backbone. Through carefully designed vector construction and screening strategies, a method for controllable gene silencing with low background (<5%), high induction efficiency (>95%), strong reversibility, long-term stability, and applicability to multiple cell types is achieved, providing a stable and reliable technical platform for gene function research and disease model construction. Summary of the Invention

[0008] The present invention discloses a method for constructing a stable cell line for reversible gene silencing based on inducible shRNA expression, which solves the technical problems of constitutive expression in traditional shRNA expression vectors in the prior art, such as cell toxicity caused by constitutive expression, leaky expression of the induction system affecting experimental reliability, harmfulness of high-concentration drug induction to cells, insufficient long-term stability, and limited cell applicability.

[0009] The method for establishing a stable cell line based on inducible shRNA expression disclosed by the present invention includes the following steps:

[0010] (1) Transfer a vector containing a drug-inducible promoter system and an shRNA sequence targeting a specific gene into target cells by lentiviral transfection, and obtain a monoclonal cell population stably integrating the vector through puromycin screening;

[0011] (2) Add doxycycline to the culture medium of the monoclonal cell population to induce shRNA expression to silence the target protein;

[0012] (3) Verify the restoration of target protein expression by withdrawing doxycycline to confirm the reversibility of the system.

[0013] Preferably, the drug-inducible promoter system is the Tet-On-puro system.

[0014] Preferably, miRNA backbones are linked to both sides of the shRNA sequence to improve the processing efficiency.

[0015] Preferably, in step (1), the concentration of puromycin is 2 μg / mL and the screening time is 3 days.

[0016] Preferably, in step (2), the concentration of doxycycline is 0.1 - 1 μg / mL and the induction time is 48 hours.

[0017] Preferably, in step (2), the decrease ratio of the target protein expression level is ≥90%.

[0018] Preferably, within 72 hours after drug withdrawal in step (3), the protein expression resumes to the baseline level.

[0019] Preferably, the target cells are mammalian cells, primary cells or iPSCs.

[0020] A stable cell line established by the above method, and the stable cell line still maintains the induction characteristics after continuous passage for more than 20 generations.

[0021] Preferably, the background expression of shRNA is ≤5% without induction, and the silencing efficiency of the target protein is ≥95% after induction.

[0022] Compared with the prior art, the present invention has at least the following beneficial effects:

[0023] (1) The present invention realizes high-precision gene regulation through the combination of the optimized Tet-On-puro promoter system and the shRNA sequence linked with the miRNA backbone. Verified by experiments, when treated with 0.5 - 1.0 μg / mL doxycycline for 48 hours, the silencing efficiency of the target protein is ≥95%, while the background expression is ≤5% in the uninduced state, and the induction ratio exceeds 19:1, significantly higher than the 10:1 level of the traditional system, providing a reliable tool for precise gene function research.

[0024] (2) The stable cell line constructed by the present invention has excellent reversible performance. After removing doxycycline, the expression of the target protein can recover to more than 95% of the baseline level within 72 hours. This characteristic enables researchers to achieve dynamic regulation of specific gene expression in the same cell population, avoiding the interference of cell heterogeneity caused by the need to construct multiple control cell lines in traditional methods, and improving the consistency and comparability of experimental results.

[0025] (3) Through the monoclonal cell strategy of lentivirus-mediated genomic integration and puromycin screening, the stable cell line established by the present invention has long-term stability. After continuous passage for more than 20 generations, it still maintains complete induction characteristics, and the induction efficiency decay does not exceed 5%. This characteristic solves the technical bottleneck that traditional transfection methods are difficult to maintain long-term expression, and provides a stable and reliable cell model for long-term experimental research.

[0026] (4) The method of the present invention has a wide range of applications and has been successfully verified in conventional cell lines such as HEK293, primary cultured cells, and sensitive cell types such as iPSCs. This broad applicability stems from the optimization of vector design and low-toxicity screening strategies, breaking through the bottleneck of the limited application of traditional RNA interference technology in sensitive cells, and providing an accurate gene expression regulation tool for fields such as stem cell differentiation and development research.

[0027] (5) The integrative design of the present invention significantly simplifies the experimental process. It only takes 14 - 21 days from vector construction to obtaining a stable cell line, and the required doxycycline concentration (0.5 μg / mL) is significantly lower than that of traditional systems (usually 2 - 5 μg / mL). This reduces the experimental cost, while reducing the potential interference of high-concentration drugs on cell physiological functions and improving the biological relevance of experimental results. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is the plasmid map of the recombinant vector in Example 1;

[0029] Figure 2 It is the restriction enzyme site map of the vector;

[0030] Figure 3 It is the schematic diagram of the recombinant vector construction process;

[0031] Figure 4 It is the schematic diagram of the lentivirus packaging process;

[0032] Figure 5 It is the Western Blot test result map. DETAILED DESCRIPTION OF THE INVENTION

[0033] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative work belong to the protection scope of the present invention.

[0034] The present invention discloses a method for constructing a stable cell line with reversible gene silencing based on inducible shRNA expression, which solves the technical problems existing in the traditional shRNA expression vector in the prior art, such as constitutive expression causing cytotoxicity, leakage expression of the induction system affecting the reliability of experiments, high-concentration drug induction being harmful to cells, insufficient long-term stability, and limited cell application range.

[0035] The method for establishing a stable cell line based on inducible shRNA expression disclosed by the present invention includes the following steps:

[0036] (1) Transfer a vector containing a drug-inducible promoter system and an shRNA sequence targeting a specific gene into target cells by lentiviral transfection, and obtain a monoclonal cell population stably integrating the vector through puromycin screening;

[0037] (2) Add doxycycline to the culture medium of the monoclonal cell population to induce the expression of shRNA to silence the target protein;

[0038] (3) Verify the restoration of the expression of the target protein by withdrawing doxycycline, and confirm the reversibility of the system.

[0039] Preferably, the drug-inducible promoter system is the Tet-On-puro system.

[0040] Preferably, miRNA backbones are connected to both sides of the shRNA sequence to improve the processing efficiency.

[0041] Preferably, in step (1), the concentration of puromycin is 2 μg / mL, and the screening time is 3 days.

[0042] Preferably, in step (2), the concentration of doxycycline is 0.1 - 1 μg / mL, and the induction time is 48 hours.

[0043] Preferably, in step (2), the decrease ratio of the expression level of the target protein is ≥90%.

[0044] Preferably, in step (3), the protein expression is restored to the baseline level within 72 hours after drug withdrawal.

[0045] Preferably, the target cells are mammalian cells, primary cells or iPSCs.

[0046] A stable cell line established by the above method, which still maintains the induction characteristics after being continuously passaged for more than 20 generations.

[0047] Preferably, the background expression of shRNA is ≤5% without induction, and the silencing efficiency of the target protein is ≥95% after induction.

[0048] The present invention provides a method for establishing a stable cell line based on the induction of shRNA expression. This method controls the expression of shRNA through a drug-inducible promoter system to achieve reversible silencing of specific genes, and has the characteristics of high induction efficiency, low background expression, and good stability. The present invention will be further described in detail below with specific embodiments.

[0049] Example 1: Vector construction

[0050] (1) Basic vector material: Select the commercial pLKO-Tet-On vector (Addgene #21915, the vector map of Tet-pLKO-puro is as Figure 1 shown) as the backbone. This vector contains a tetracycline response element (TRE), a minimal CMV promoter, and a puromycin resistance gene.

[0051] (2) shRNA sequence design: For the SMAD5 gene, select the highly efficient sequence ShSMAD5: 5'-CGACTGCTGATGTAGTAATTT-3' from the RNAi Consortium shRNA library. Synthesize this sequence into double-stranded oligonucleotides and add miRNA backbone structures on both sides to improve the processing efficiency of shRNA.

[0052] (3) Enzyme digestion and ligation: Use double enzyme digestion with BamHI and EcoRI to treat the vector (the enzyme digestion site map is as Figure 2 shown), and insert the synthesized shRNA sequence into the vector (as Figure 3 shown).

[0053] The reaction system is: 1 μg of vector DNA, 10 U of BamHI, 10 U of EcoRI, 5 μL of 10× buffer, and deionized water is added to make up to 50 μL, and enzyme digestion is carried out at 37°C for 2 hours.

[0054] (4) Transformation and screening: Transform the ligation product into competent DH5α Escherichia coli, and screen positive clones on an LB plate containing ampicillin (100 μg / mL). Pick monoclonal colonies for bacterial liquid PCR verification. The primers are designed to span the inserted fragment region. The forward primer is 5'-CGTGACTATGGGAACATACGTC-3', and the reverse primer is 5'-CTCGAGAAATTACTACATCAGCAGTCG-3'.

[0055] (5) Sequencing verification: The clones with positive PCR verification were sent for sequencing confirmation. The sequencing results showed that the target shRNA sequence was successfully inserted into the recombinant plasmid:

[0056] ATACGTGATCCTATCAGTGATAGAGACTTATAAGTTCCCTATCAGTGATAGAGACACCGGCGACTGCTGATGTAGTAATTTCTCGAGAAATTACTACATCAGCAGTCGTTTTTGAATTCTCGACCTCGAGACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAGATCCACTTTGGCCGCGGCTCGA.

[0057] Example 2: Lentivirus packaging and target cell infection (schematic process diagram as Figure 4 shown)

[0058] (1) Lentivirus packaging: The Tet-On-shRNA expression vector constructed in Example 1, lentiviral packaging plasmids psPAX2 and pMD2.G were co-transfected into 293T cells (2×10 6 cells, seeded in a 60 mm culture dish) at a mass ratio of 5:4:1 (total DNA was 4 μg) using Lipofectamine 3000 transfection reagent according to the recommended protocol in the instruction manual.

[0059] (2) Virus collection: After 24 hours of transfection, the medium was replaced with fresh DMEM medium (containing 10% FBS, 1% penicillin-streptomycin), and the culture supernatant containing virus particles was collected after continuous culture for 48 hours. The cell debris was removed by filtration through a 0.45 μm filter membrane.

[0060] (3) Target cell infection: HEK293 cells were seeded in a 6-well plate (5×10 5 cells per well). After the cells adhered, 1 mL of virus supernatant and 1 mL of fresh medium were added, and Polybrene was added simultaneously to a final concentration of 8 μg / mL to improve the infection efficiency. After 24 hours of infection, the medium was replaced with fresh medium and cultured for 48 hours.

[0061] Example 3: Screening and identification of stable cell lines

[0062] (1) Resistance screening: 72 hours after virus infection, puromycin (final concentration 2 μg / mL) was added to the culture medium for screening. After 3 days of screening, the medium was replaced with complete medium without antibiotics to allow the cells to recover for 1 day.

[0063] (2) Monoclonal isolation: The cells were inoculated at an extremely low density (about 100 cells / 100 mm culture dish) and cultured for 10 - 14 days to form visible monoclonal cell colonies with the naked eye.

[0064] (3) Clone amplification: A sterile cloning ring was dipped into trypsin solution, and single cell colonies were digested and transferred to a 24-well plate for amplification culture.

[0065] (4) Genomic PCR verification: Genomic DNA was extracted from some of the amplified cells, and PCR verification was performed using primers specific to the vector sequence to confirm that the vector had been stably integrated into the genome.

[0066] PCR conditions: Pre-denaturation at 95°C for 5 minutes, followed by 30 cycles (denaturation at 95°C for 30 seconds, annealing at 58°C for 30 seconds, extension at 72°C for 45 seconds), and final extension at 72°C for 7 minutes.

[0067] Example 4: Functional verification of the inducible shRNA expression system

[0068] (1) Induction treatment: The stable cell line obtained by screening in Example 3 was inoculated in a 6-well plate. When the cell density reached 60% - 70%, it was divided into four groups for treatment:

[0069] a) Control group: No doxycycline was added;

[0070] b) Low-dose group: 0.1 μg / mL doxycycline was added;

[0071] c) Medium-dose group: 0.5 μg / mL doxycycline was added;

[0072] d) High-dose group: 1.0 μg / mL doxycycline was added.

[0073] (2) RNA level verification: After culturing for 48 hours, total RNA was extracted from the cells of each group using TRIzol reagent according to the standard operation procedure. cDNA was synthesized by reverse transcription, and the mRNA expression level of the target gene was detected by qRT-PCR.

[0074] Primers for the target gene:

[0075] Forward 5'-CCAGGGCTTTGAGGCTGTCTA-3';

[0076] Reverse 5'-GCAAAGGCCCATTCAGGTG-3';

[0077] Primer for internal reference gene GAPDH:

[0078] Forward 5'-GAAGGTGAAGGTCGGAGTC-3';

[0079] Reverse 5'-GAAGATGGTGATGGGATTTC-3'.

[0080] (3) Verification at protein level: Total proteins of each group of cells were extracted using RIPA lysis buffer. After determining the concentration by BCA method, 5× loading buffer was added and denatured at 95°C for 5 minutes. Equal amounts of proteins (20 μg) were taken for SDS-PAGE electrophoresis. After transferring the membrane, it was incubated overnight with rabbit anti-SMAD5 antibody (diluted 1:1000) and mouse anti-β-actin antibody (diluted 1:5000). After incubating with HRP-labeled secondary antibody for 1 hour, the expression level of the target protein was detected by ECL luminescence.

[0081] (4) Experimental results: Western blot analysis showed that the expression levels of the target protein SMAD5 in the groups treated with 0.5 μg / mL and 1.0 μg / mL doxycycline decreased by 92% and 95% respectively, while there was only a 3% background silencing effect in the non-induced group. The results of qRT-PCR were consistent with the changes at the protein level, indicating that this system has high induction silencing efficiency and low background expression characteristics.

[0082] Example 5: Verification of the reversibility of the inducible shRNA expression system

[0083] (1) Induction treatment: The stable cell line was treated with the optimal induction concentration of 0.5 μg / mL doxycycline for 48 hours, and part of the cells were collected as samples of the induction group (time point 0 h).

[0084] (2) Withdrawal of drug and recovery: The remaining cells were washed 3 times with PBS and then replaced with complete medium without doxycycline for continued culture. Cell samples were collected at 24 h, 48 h, 72 h, and 96 h after drug withdrawal respectively.

[0085] (3) Detection of protein expression: Western blot was performed according to the method in Example 4 to detect the expression level of SMAD5 protein at each time point.

[0086] (4) Experimental results: The results showed that after withdrawing doxycycline, the expression level of the target protein SMAD5 gradually recovered. It recovered to about 40% of the basal level at 24 h, about 70% at 48 h, and more than 95% of the basal level at 72 h. It indicates that this system has good reversibility and is suitable for dynamic regulation-related research.

[0087] Example 6: Verification of the long-term passage stability of the stable cell line

[0088] (1) Long-term subculture: The obtained stable cell line was subcultured by the conventional method, with a subculture ratio of 1:5 and subcultured every 3 - 4 days.

[0089] (2) Regular detection: Samples were taken at the 5th, 10th, 15th, and 20th passages respectively, and treated with doxycycline induction (0.5 μg / mL, 48 hours) according to the method in Example 4. The expression level of SMAD5 protein was detected by Western blot (as Figure 5 shown).

[0090] (3) Experimental results: It can be seen from Figure 5 that after 20 passages, the stable cell line still maintained high induction characteristics (the silencing efficiency of the target protein after induction > 90%) and low background characteristics (background expression < 5% without induction), indicating that this system has long-term stability and is suitable as a stable tool for gene function research and disease model construction.

[0091] Example 7: Verification of the applicability of the system in different cell types

[0092] (1) Infection of different cell types: Human embryonic kidney cells (HEK293), human hepatoma cells (HepG2), mouse fibroblasts (NIH / 3T3), and human induced pluripotent stem cells (iPSCs) were respectively subjected to virus infection and stable cell line screening according to the methods in Examples 2 - 3.

[0093] (2) Verification of induction effect: According to the method in Example 4, the cells were treated with 0.5 μg / mL doxycycline for 48 hours, and the silencing efficiency of SMAD5 protein in each cell type was detected by Western blot.

[0094] (3) Experimental results: In all tested cell types, this system showed high target gene silencing efficiency (> 90%) and low background expression characteristics (< 5%), indicating that this system has good universality and is suitable for gene function research of multiple cell types.

[0095] Although the embodiments of the present invention have been shown and described, for those of ordinary skill in the art, it can be understood that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made within the scope of the present invention application shall still fall within the scope covered by the patent of the present invention.

Claims

1. A method for establishing a stable cell line based on inducing shRNA expression, characterized in that: The following steps are involved: (1) A vector containing a drug-inducible promoter system and a shRNA sequence targeting a specific gene is transferred into the target cells through lentiviral transfection, and a monoclonal cell population with stable integration of the vector is obtained through puromycin selection; (2) adding doxycycline to the culture medium of the monoclonal cell population to induce shRNA expression to silence the target protein; (3) By withdrawing doxycycline, the target protein expression was verified to be restored and the reversibility of the system was confirmed.

2. The method according to claim 1, characterized in that The drug-inducible promoter system is a Tet-On-puro system.

3. The method according to claim 1, characterized in that The shRNA sequence is flanked by miRNA backbones to improve processing efficiency.

4. The method according to claim 1, characterized in that: The concentration of puromycin in step (1) was 2 μg / mL and the screening time was 3 days.

5. The method according to claim 1, characterized in that The concentration of doxycycline in step (2) is 0.1-1 μg / mL, and the induction time is 48 hours.

6. The method according to claim 1, characterized in that In step (2), the decrease ratio of the target protein expression level is ≥ 90%.

7. The method according to claim 1, characterized in that In step (3), protein expression returns to baseline levels within 72 hours after drug withdrawal.

8. The method according to claim 1, characterized in that The target cells are mammalian cells, primary cells or iPSCs.

9. A stable cell line established by the method according to any one of claims 1 to 8, characterized in that: The stable cell line maintained its inducible properties after continuous passage for more than 20 generations.

10. The stable cell line according to claim 9, characterized in that The shRNA background expression was ≤5% when not induced, and the target protein silencing efficiency was ≥95% after induction.

Images