CRISPRCas9-based mouse TCF15 conditional gene knockout model and construction method thereof
By optimizing the CRISPR/Cas9 technology and electrotransfer system, multiple sgRNAs were designed to coordinate targeting, and a conditioned gene knockout model of mouse TCF15 was constructed, which solved the problems of long cycle, low success rate and high off-target effects in traditional technologies, and achieved efficient and accurate gene knockout effects, providing a reliable tool for the study of embryonic development mechanisms.
Patent Information
- Application Number
- CN202510323703.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-19
- Publication Date
- 2025-06-20
AI Technical Summary
In the prior art, traditional homologous recombination technology constructs a conditioned knockout model with a long period and low success rate, the CRISPR/Cas9 system has a high off-target effect in embryo operation, and the existing model has an excessively high mortality rate of specific knockout embryos.
By optimizing the design of four sgRNA collaborative targeting and optimizing the electrotransfer system, a conditioned knockout model of mouse TCF15 based on CRISPR/Cas9 was constructed. The specific steps include designing sgRNA, preparing electrotransferrol, electrotransferring the fertilized eggs of mice, culture until the blastocyst phase, and genotype identification.
An efficient and accurate conditional knockout model was achieved, breaking through the technical barriers of embryo lethality and space-time control, and the fertilized egg develops to a blastocyst rate of ≥85%, gene editing efficiency is ≥85%, and off-target rate is ≤1.5%, providing a reliable tool for studying the mechanism of TCF15 regulating the early embryo development of mice.
Smart Images

Figure CN120174016A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of genetic engineering technology, and specifically relates to a conditional gene knockout model of mouse TCF15 based on CRISPR / Cas9 and a method for constructing the same. Background Art
[0002] As a basic helix-loop-helix (bHLH) transcription factor, TCF15 is involved in regulating the differentiation of embryonic mesoderm and the formation of germ cells, and interacts with the Wnt signaling pathway and TGF-β signaling pathway. However, due to the technical complexity of constructing gene editing models, the broader functional research on TCF15 has been restricted. The traditional homologous recombination technology has a long cycle (12 - 18 months), low efficiency (positive clone rate < 10%), and cannot achieve conditional knockout; although the CRISPR / Cas9 technology shortens the cycle, the design of a single sgRNA leads to fluctuations in editing efficiency (25% - 75%), small fragment insertions or deletions, and a relatively high off-target rate (5% - 20%). The lethality rate of existing TCF15 full knockout models in embryos is > 80%, making it difficult to achieve specific operations.
[0003] To address the above problems, the present invention aims to construct an efficient and precise conditional knockout model by optimizing the design of four sgRNAs for cooperative targeting and optimizing the electroporation system, breaking through the technical barriers of embryonic lethality and spatio-temporal control, and providing a reliable tool for revealing the mechanism of TCF15 regulating early embryonic development in mice. Summary of the Invention
[0004] The present invention discloses a conditional gene knockout model of mouse TCF15 based on CRISPR / Cas9 and a method for constructing the same, which solves the technical problems in the prior art that the traditional homologous recombination technology has a long cycle, low success rate, high off-target effect of the CRISPR / Cas9 system in embryo manipulation, and too high lethality rate of specific knockout embryos in existing models.
[0005] The method for constructing a conditional gene knockout model of mouse TCF15 based on CRISPR / Cas9 disclosed by the present invention includes the following steps:
[0006] 1) Design four sgRNAs, namely sgRNA1, sgRNA2, sgRNA3, and sgRNA4, wherein sgRNA1 and sgRNA2 target the 5'-end and 3'-end non-coding regions of the second exon of the TCF15 gene, and sgRNA3 and sgRNA4 target the conserved sequence of the bHLH domain;
[0007] 2) Prepare an electroporation solution, which is composed of Cas9 mRNA, the four sgRNAs, and an electroporation buffer;
[0008] 3) Perform electroporation treatment on mouse fertilized eggs;
[0009] 4) Culture the fertilized eggs after electrotransfection until the blastocyst stage;
[0010] 5) Perform genotype identification on the obtained blastocysts.
[0011] Preferably, the sgRNA1 and sgRNA2 are designed to be located at ±50 bp from the cleavage site.
[0012] Preferably, the GC content of the designed sgRNA is 40% - 60%.
[0013] Preferably, the sgRNA is scored using the MIT CRISPR design tool, and its off-target score is greater than 90.
[0014] Preferably, the concentration of Cas9 mRNA in the electrotransfection solution is 50 ng / μl, each of the four sgRNAs is 25 nM, and the electrotransfection buffer is 20%.
[0015] Preferably, the parameters of the electrotransfection treatment are: voltage 30 V, 4 - 6 pulses, pulse length 3 ms, and pulse interval 100 ms.
[0016] Preferably, the culture step is carried out in KSOM medium, and the culture conditions are 37°C and 5% CO2.
[0017] Preferably, the genotype identification includes:
[0018] 1) Perform primary screening by nested PCR amplification of the editing region of the second exon of the TCF15 gene;
[0019] 2) Perform in-depth verification by combining ChIP-Seq sequencing with 0.025 restriction endonuclease detection;
[0020] 3) Perform off-target analysis by detecting predicted off-target sites through whole-genome sequencing.
[0021] Preferably, the fertilized eggs of the TCF15 conditional gene knockout mouse model constructed by the method develop to the blastocyst rate ≥85%, the gene editing efficiency ≥85%, and the off-target rate ≤1.5%.
[0022] Preferably, the nucleotide sequence of the second exon of the mouse TCF15 gene is as shown in SEQ ID NO:1.
[0023] Preferably, the sequence of sgRNA1 is as shown in SEQ ID NO:2;
[0024] The sequence of sgRNA2 is as shown in SEQ ID NO:3;
[0025] The sequence of sgRNA3 is as shown in SEQ ID NO:4;
[0026] The sequence of sgRNA4 is shown in SEQ ID NO: 5.
[0027] Preferably, the formula of the electroporation buffer is: 100 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 750 mM KCl, 5 mM MgCl2·6H2O, 5 mM tris(2-carboxyethyl)phosphine, and 50% glycerol, with the rest being double-distilled water, and the pH is adjusted to 7.5 with KOH.
[0028] The present invention also discloses a mouse TCF15 conditional gene knockout model constructed by the above construction method.
[0029] Compared with the prior art, the present invention has at least the following beneficial effects:
[0030] (1) Targeted editing success rate: 85.3% (n = 120 embryos);
[0031] Frameshift mutation efficiency: 91.5% (verified by TA cloning and sequencing).
[0032] (2) In multiple independent experiments, this model achieved an average frameshift mutation efficiency of about 90%.
[0033] (3) After treatment with the optimized CRISPR / Cas9 system and embryo electroporation system, about 80% of the fertilized eggs could be successfully cultured in vitro to the blastocyst stage.
[0034] (4) For the first time, conditional knockout of TCF15 in specific germ layers was achieved (by crossing with tissue-specific Cre mice); the real-time effect of TCF15 deficiency on gastrulation can be dynamically observed.
[0035] By developing a new sgRNA combination strategy and optimizing the fertilized egg electroporation system, the present invention achieved: the blastocyst rate of fertilized eggs was increased to ≥85% (3 times higher than the traditional method); the gene editing efficiency was ≥85%; the off-target rate was controlled at ≤1.5%; it provides a reliable tool model for studying the dynamic regulation mechanism of TCF15 in the differentiation of the three germ layers of early mouse embryos. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 : Schematic diagram of the knockout strategy of the TCF15 gene; DETAILED DESCRIPTION OF THE INVENTION
[0037] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.
[0038] Unless otherwise defined, technical and scientific terms used in this specification have the same meanings as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the experiments or practical applications, the materials and methods are described below. In case of conflict, the present specification, including its definitions, will prevail. In addition, the materials, methods, and examples are for illustrative purposes only and not limiting. The present application will be further described below in conjunction with specific embodiments, but the scope of the present application is not limited thereby.
[0039] Definitions
[0040] As used herein, the terms "polynucleotide", "nucleotide", "nucleotide sequence", "nucleic acid", and "oligonucleotide" are used interchangeably. They refer to polymeric forms of nucleotides (deoxyribonucleotides or ribonucleotides) or their analogs of any length. Examples of polynucleotides include, but are not limited to, coding or non-coding regions of genes or gene fragments, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, any isolated DNA sequence, any isolated RNA sequence, nucleic acid probes, and primers. One or more nucleotides in a polynucleotide can be further modified. The nucleotide sequence can be interrupted by non-nucleotide components. Polynucleotides can also be modified after polymerization, for example, by conjugation with a labeling agent.
[0041] As used herein, the term "CRISPR / Cas9" is an adaptive immune defense formed by bacteria and archaea during long-term evolution, which can be used to combat invading viruses and foreign DNA. The CRISPR / Cas9 gene editing technology is a technology for specific DNA modification of target genes. Gene editing technologies based on CRISPR / Cas9 have shown great application prospects in a series of gene therapy application fields, such as blood diseases, tumors, and other genetic diseases. The technical achievements have been applied to the precise modification of genomes of human cells, zebrafish, mice, and bacteria.
[0042] The terms "gRNA", "guide RNA", and "CRISPR guide sequence" as used herein are used interchangeably throughout and refer to a nucleic acid that contains a sequence that determines the specificity of the Cas binding protein of the CRISPR / Cas system. The gRNA hybridizes (partially or fully complementary) to a target nucleic acid sequence in the host cell genome. The length of the gRNA or a portion thereof that hybridizes to the target nucleic acid can be between 15-25 nucleotides, 18-22 nucleotides, or 19-21 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid can be 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides. In some embodiments, the length of the gRNA sequence that hybridizes to the target nucleic acid is between 10-30 or 15-25 nucleotides.
[0043] The term "gRNA" as used herein generally refers to a single molecule guide RNA or single-stranded guide RNA in an artificial CRISPR / Cas9 system, which refers to an RNA that guides the specific binding of the Cas protein to a target DNA sequence and is an important component in the CRISPR gene knockout / knock-in system. The gRNA of the present application contains a guiding sequence that targets a target sequence. In a preferred embodiment, the sgRNA of the present application further contains a tracrRNA sequence and a crRNA sequence.
[0044] The "guiding sequence" in the present application refers to a sequence of about 17-20 bp that specifies a target site and can be used interchangeably with the "leading sequence" or "spacer". In the context of forming a CRISPR complex, the "target sequence" is a sequence that the guiding sequence is designed to be complementary to, where hybridization between the target sequence and the guiding sequence promotes the formation of the CRISPR complex. The hybridization requires sufficient complementarity between the "target sequence" and the "guiding sequence" or "leading sequence" to cause hybridization and promote the formation of the CRISPR complex, and perfect complementarity is not required.
[0045] "Complementary" means that the "guide sequence" or "leader sequence" can hybridize with the target nucleotide sequence according to the nucleotide pairing principle discovered by Watson and Crick. Those skilled in the art will understand that as long as there is sufficient complementarity, the "guide sequence" can hybridize with the target nucleotide sequence, and it is not necessary for them to have 100% perfect complementarity. In some embodiments, when optimally aligned using an appropriate alignment algorithm, the degree of complementarity between the guide sequence and its corresponding target sequence can be about or greater than about 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more. Optimal alignment can be determined using any suitable algorithm for aligning sequences, including the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, the algorithm based on the Burrows-Wheeler Transform, etc.
[0046] Generally, in the context of an endogenous CRISPR system, the formation of a CRISPR complex (including hybridization of the guide sequence with the target sequence and association with one or more Cas proteins) results in cleavage of one or both strands in or near the target sequence (e.g., within a range of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). Without wishing to be bound by theory, the tracr sequence can comprise all or a portion of the wild-type tracr sequence (e.g., about or greater than about 20, 23, 26, 29, 32, 35, 38, 41, 44, 47, 50, 53, 56, 59, 62, 65, 70, 75, 80, 85 or more nucleotides of the wild-type tracr sequence) or a tracr sequence composed of the foregoing can also form part of the CRISPR complex, e.g., by hybridizing with all or a portion of the crRNA sequence that is operably linked to the guide sequence along at least a portion of the tracr sequence.
[0047] In some embodiments, the tracr sequence has sufficient complementarity to the crRNA sequence to hybridize and participate in the formation of the CRISPR complex. Similar to the case of hybridization of the "target sequence" and the "guide sequence" or "leader sequence", perfect complementarity is not necessary, as long as it is sufficient to perform its function. In some embodiments, in the case of optimal alignment, the tracr sequence has at least 50%, 60%, 70%, 80%, 90%, 95% or 99% complementarity along the length of the crRNA sequence.
[0048] As used herein, the term "gene knockout" or "knockout" refers to the editing of a gene in a cell (e.g., modification such as insertion, replacement, and / or deletion of the gene) such that the gene loses its original function (e.g., cannot express a functional protein). Various known molecular biology techniques can be used to edit genes in the cell genome (e.g., using zinc finger nuclease-based gene editing techniques, TALEN gene editing techniques, and CRISPR / Cas (such as CRISPR / Cas9) gene editing techniques). Gene knockout is not limited to the complete deletion or removal of an entire gene, but as long as the gene loses its original function. For example, by inserting a foreign DNA fragment into the gene, the gene cannot express a functional protein, or by inserting or deleting one or several bases in the gene, a frameshift mutation occurs in the gene, to achieve the knockout of the gene. For example, in the present application, gene knockout can use the CRISPR / Cas9 gene editing technique.
[0049] As used herein, the term "vector" refers to a nucleic acid vehicle into which a polynucleotide can be inserted. When the vector enables the expression of the protein encoded by the inserted polynucleotide, the vector is called an expression vector. The vector can be introduced into a host cell by transformation, transduction, or transfection, so that the genetic material elements carried by it are expressed in the host cell. Vectors are well known to those skilled in the art, including but not limited to: plasmids; phagemids; artificial chromosomes, such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), or P1-derived artificial chromosomes (PACs); bacteriophages such as λ phage or M13 phage, and animal viruses, etc. Animal viruses that can be used as vectors include but are not limited to retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpesviruses (such as herpes simplex virus), poxviruses, baculoviruses, papillomaviruses, polyomaviruses (such as SV40). A vector can contain various elements for controlling expression, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. In addition, the vector can also contain an origin of replication.
[0050] As used herein, the term "delivery" refers to the introduction of biological macromolecules such as nucleic acids and proteins from outside the cell membrane into the cell membrane through certain pathways. The "delivery" includes, for example, electroporation, liposome transfection, lipid-nanoparticle delivery, virus delivery, exosome delivery, and other methods.
[0051] The method for constructing a CRISPR / Cas9-based conditional gene knockout model of mouse TCF15 disclosed in the present invention includes the following steps:
[0052] 1) Design four sgRNAs, where sgRNA1 and sgRNA2 target the 5'-end and 3'-end non-coding regions of the second exon of the TCF15 gene, and sgRNA3 and sgRNA4 target the conserved sequence of the bHLH domain;
[0053] 2) Prepare the electroporation solution, which consists of Cas9 mRNA, the four sgRNAs, and the electroporation buffer;
[0054] 3) Perform electroporation on mouse fertilized eggs;
[0055] 4) Culture the electroporated fertilized eggs until the blastocyst stage;
[0056] 5) Perform genotype identification on the cultured blastocysts.
[0057] Preferably, sgRNA1 and sgRNA2 are designed to be located at ±50 bp from the cleavage site.
[0058] Preferably, the GC content of the designed sgRNAs is 40% - 60%.
[0059] Preferably, the sgRNAs are scored using the MIT CRISPR design tool, and their off-target score is greater than 90.
[0060] Preferably, the concentration of Cas9 mRNA in the electroporation solution is 50 ng / μl, each of the four sgRNAs is 25 nM, and the electroporation buffer is 20%.
[0061] Preferably, the parameters of the electroporation treatment are: voltage 30 V, 4 - 6 pulses, pulse length 3 ms, and pulse interval 100 ms.
[0062] Preferably, the culture step is carried out in KSOM medium, and the culture conditions are 37°C and 5% CO2.
[0063] Preferably, the genotype identification includes:
[0064] 1) Perform primary screening by nested PCR amplification of the edited region of the second exon of the TCF15 gene;
[0065] 2) Perform in-depth verification by ChIP-Seq sequencing combined with 0.025 restriction endonuclease detection;
[0066] 3) Perform off-target analysis by detecting predicted off-target sites through whole-genome sequencing.
[0067] Preferably, for the conditional gene knockout mouse model of TCF15 constructed by the method, the development rate of fertilized eggs to blastocysts is ≥85%, the gene editing efficiency is ≥85%, and the off-target rate is ≤1.5%.
[0068] Preferably, the nucleotide sequence of the second exon of the mouse TCF15 gene is as shown in SEQ ID NO:1.
[0069] Among them, SEQ ID NO:1 is:
[0070] ACCTGGCACTCTGGCCTAGCTAACTGGAAAATGGGAAAGGTGACAGCAGGAAGGCCCTGCCCCTGCCTACAGGCTGCAGACCAGTCCATCTGTGCCCACCAACTCAGCAGTCAGAATGGGGGCTCCTTTGTAGGACGGGGGACTGACCCATAGTTCATAGGGTCTGGCCTGTGGCTGACTGTTGCCTTGGAATCTGTCTGTGGGATTAAGAACCCAGCCAAATTTGGTTATAGAAGCCATGCTCAGTCACACAGGCTCCTCTGGGAATAGGCCAGAGGGGTGATCCTCGCCAGTGCTGGCCCCTCCAGGACTTGTCTGGAAGATGATAGATGTTTTGGGAAGCCCCTACACACCTCTGAGCTCCAAGGCCCCAGACCCCATTCCATCCCAGGCTACTACCTCCTTCTGATCCTGAATGGTCTGGGGTTGAACATGTTCCCTACAGCTCAGGGATGTGATTAAGTTACCTCTGTGGTAACAGTATTGAGAGGAAAGTGAACTCTTGTCTCTGCCTTGTTTTCCCTCTGTCCCC.
[0071] Preferably, the nucleotide sequence of the sgRNA is as shown in SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 or SEQ ID NO:5.
[0072] Among them, SEQ ID NO:2 is:
[0073] CCCATGAATTATTACTGACC;
[0074] SEQ ID NO:3 is:
[0075] GGGTCACGGTCAAATGGTAT;
[0076] SEQ ID NO:4 is:
[0077] CAAAGGCTCTACATCTCGGA;
[0078] SEQ ID NO:5 is as follows:
[0079] CCTTGAGGTGGCTCAACCAT.
[0080] For the second exon region of the mouse TCF15 gene, four sgRNAs for knockout were designed, namely sgRNA1, sgRNA2, sgRNA3 and sgRNA4. Among them:
[0081] The sequence of sgRNA1 is as shown in SEQ ID NO:2;
[0082] The sequence of sgRNA2 is as shown in SEQ ID NO:3;
[0083] The sequence of sgRNA3 is as shown in SEQ ID NO:4;
[0084] The sequence of sgRNA4 is as shown in SEQ ID NO:5.
[0085] The said sgRNA1 and sgRNA2 are used to target the 5' / 3' non-coding regions of the second exon, and the said sgRNA3 and sgRNA4 are used to target the conserved sequences of the bHLH domain.
[0086] Preferably, the formula of the electroporation buffer is: 100 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 750 mM KCl, 5 mM MgCl2·6H2O, 5 mM tris(2-carboxyethyl)phosphine and 50% glycerol, and the rest is double-distilled water, and the pH is adjusted to 7.5 with KOH.
[0087] The present invention also discloses a mouse TCF15 conditional gene knockout model constructed by the above construction method.
[0088] Example 1
[0089] sgRNA Design
[0090] For the second exon region of the TCF15 gene, four sgRNAs for knockout were designed, namely sgRNA1, sgRNA2, sgRNA3 and sgRNA4. Among them:
[0091] The sequence of sgRNA1 is: CCCATGAATTATTACTGACC (SEQ ID NO:1);
[0092] The sequence of sgRNA2 is: GGGTCACGGTCAAATGGTAT (SEQ ID NO:2);
[0093] The sequence of sgRNA3 is: CAAAGGCTCTACATCTCGGA (SEQ ID NO:3);
[0094] The sequence of sgRNA4 is: CCTTGAGGTGGCTCAACCAT (SEQ ID NO:4).
[0095] Preparation of gene editing solution
[0096] Synthesize sgRNA1 and sgRNA4, and prepare a sgRNA mixture by mixing sgRNA1 and sgRNA4 at a molar ratio of 1:1; then mix Cas9 mRNA and the sgRNA mixture at a final concentration of 50 ng / μl of Cas9 mRNA and 25 nM for each of the four sgRNAs, and add 20% electroporation buffer to prepare the gene editing solution.
[0097] The formula of the electroporation buffer is: 100 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 750 mM KCl, 5 mM MgCl2·6H2O, 5 mM tris(2-carboxyethyl)phosphine, and 50% glycerol, with the rest being double-distilled water, and the pH is adjusted to 7.5 with KOH.
[0098] Electroporate the gene editing solution into fertilized eggs. The electroporation parameters are a voltage of 30 V, 4 - 6 pulses, a pulse length of 3 ms, and a pulse interval of 100 ms.
[0099] After electroporation, wash the fertilized eggs three times with M2 culture solution, transfer the fertilized eggs to KSOM medium, culture them in an incubator at 37°C and 5% CO2 until the blastocyst stage, and then transplant them into the oviduct of surrogate mother mice. After the mice are born, take the mouse tails for identification.
[0100] Genotype identification of TCF15 gene knockout mice
[0101] Five days after the birth of F0 generation mice, collect 0.5 cm of mouse tails, put them into sterile centrifuge tubes, and complete the crude extraction of mouse tail DNA after lysis. Using the mouse tail DNA as a template, perform nested PCR to amplify the editing region of the second exon of the TCF15 gene. Among them:
[0102] The sequence of the outer primer F1 is: GTCTAGGACCTGACAAGTTGC (SEQ ID NO:7)
[0103] The sequence of the outer primer R1 is: CTGACTGAAGCATGCAGTCAG (SEQ ID NO:8)
[0104] The sequence of the inner primer F2 is: ACCTGGCACTCTGGCCTAG (SEQ ID NO:9)
[0105] The sequence of the internal primer R2 is: GGGGACAGAGGGGAAAACAA (SEQ ID NO:10)
[0106] The PCR products were identified by 1% agarose gel electrophoresis and sequencing. The initially screened positive samples were subjected to ChIP-Seq sequencing combined with 0.025 restriction endonuclease detection, and the predicted off-target sites were mainly detected by whole-genome sequencing (30× coverage). Finally, a conditional TCF15 gene knockout model with an editing success rate of 85.3% (n = 120 embryos), a frameshift mutation efficiency of 91.5% (verified by TA cloning and sequencing), and an off-target rate ≤ 1.5% was obtained.
[0107] Phenotypic identification of TCF15 gene knockout mice
[0108] The expression levels of triploblastic marker genes in the obtained conditional TCF15 gene knockout mice were analyzed, and the expression levels of SOX2 (ectoderm), Brachyury (mesoderm), and FOXA2 (endoderm) were quantitatively detected by qRT-PCR. The results showed that compared with wild-type mice, the expression level of the mesoderm marker gene Brachyury in conditional TCF15 gene knockout mice was significantly downregulated (p < 0.01), indicating that TCF15 plays a key regulatory role in mesoderm development. At the same time, it was confirmed by immunofluorescence staining with TCF15 antibody and confocal microscopy that the expression level of TCF15 protein was significantly reduced in the conditional TCF15 gene knockout mouse model, further verifying the effectiveness of gene knockout.
[0109] Although the embodiments of the present invention have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. All equivalent changes and improvements made within the scope of the present invention's application shall still fall within the scope covered by the patent of the present invention.
Claims
1. The method for constructing a mouse TCF15 conditional gene knockout model based on CRISPR / Cas9 includes the following steps: 1) Four sgRNAs were designed, namely sgRNA1, sgRNA2, sgRNA3 and sgRNA4, where sgRNA1 and sgRNA2 targeted the 5' and 3' non-coding regions of the second exon of the TCF15 gene. sgRNA3 and sgRNA4 target the conserved sequences of the bHLH domain; 2) preparing an electroporation solution consisting of Cas9 mRNA, the four sgRNAs and an electroporation buffer; 3) Electroporation of mouse fertilized eggs; 4) Cultivating the electroporated fertilized eggs to the blastocyst stage; 5) Conduct genotyping on the blastocysts obtained through culture.
2. The construction method according to claim 1, characterized in that: The sgRNA1 and sgRNA2 were designed to be located at ±50 bp from the splicing site.
3. The construction method according to claim 1, characterized in that: The GC content of the sgRNA design is 40% to 60%.
4. The construction method according to claim 1, characterized in that: The sgRNA was scored using the MIT CRISPR design tool with an off-target score greater than 90.
5. The construction method according to claim 1, characterized in that: The concentration of Cas9 mRNA in the electrotransfer solution was 50 ng / μl, the concentration of each of the four sgRNAs was 25 nM, and the electrotransfer buffer was 20%.
6. The construction method according to claim 1, characterized in that: The parameters of the electroporation treatment are: voltage 30V, 4 to 6 pulses, pulse length 3ms, and pulse interval 100ms.
7. The construction method according to claim 1, characterized in that: The culture step is carried out in KSOM medium at 37° C. and 5% CO 2 .
8. The construction method according to claim 1, characterized in that: The genotype identification includes: 1) Primary screening was performed by nested PCR amplification of the editing region of the second exon of the TCF15 gene; 2) Deep verification by ChIP-Seq sequencing combined with 0.025 restriction endonuclease detection; 3) Predict off-target sites through whole genome sequencing and conduct off-target analysis.
9. The construction method according to claim 1, characterized in that: The TCF15 conditional gene knockout mouse model constructed by the method has a fertilized egg development to blastocyst rate of ≥85%, a gene editing efficiency of ≥85%, and an off-target rate of ≤1.5%.
10. A mouse TCF15 conditional gene knockout model constructed according to the construction method according to any one of claims 1 to 9.