Fermentation medium for Cap protein virus-like particles of porcine circovirus type 3

Abstract

The invention relates to a fermentation medium of porcine circovirus type 3 (PCV3) Cap protein virus-like particles and a fermentation method thereof. The fermentation culture medium comprises tryptone, a yeast extract, casein hydrolysate, sorbitol, glycerol, polyoxyethylene mono-tert-octyl phenyl ether and the like. Methanol is supplemented for three times in the fermentation process, so that the expression efficiency of the Cap protein of PCV3 is remarkably improved, and correct folding and self-assembly of the Cap protein into the virus-like particles are promoted. According to the culture medium and the method, generation of impure protein is reduced, the purification cost is reduced, and key technical support is provided for industrial production of PCV3 subunit vaccines.

Description

Technical Field

[0001] The present invention belongs to the technical field of fermentation, and particularly relates to a fermentation medium for porcine circovirus type 3 Cap protein virus-like particles. Background Art

[0002] Porcine circovirus (PCV) is a single-stranded circular DNA virus, which is known to cause a variety of pig-related diseases. In particular, PCV2 virus is associated with reproductive and respiratory diseases in pigs as well as pathological changes such as immunosuppression. PCV3 is a newly discovered porcine circovirus in recent years and has been confirmed to be associated with different types of pig diseases, especially closely related to cardiovascular diseases, respiratory diseases and immune system diseases in pigs. Although the harm of PCV3 has not been fully understood, its wide spread and the diversity of clinical manifestations make the research on its vaccine an urgent need.

[0003] One of the main structural proteins of PCV3 is the Cap protein, which has strong immunogenicity and can induce the host to produce an immune response. The Cap protein self-assembles into virus-like particles (VLPs). VLPs are similar in structure to natural viruses, but due to the lack of viral genetic material, they are not infectious and are therefore ideal candidates as vaccines. In recent years, the production of VLPs of PCV3 Cap protein using recombinant technology has become an effective immunization method. However, there are still some technical problems in the efficient expression, correct folding of the Cap protein and the process of self-assembling into VLPs.

[0004] At present, there are some problems in the fermentation culture method of PCV3 Cap protein, such as low protein expression efficiency, a lot of contaminating proteins and high purification costs. These problems not only affect the production efficiency of the Cap protein, but also limit its application in vaccine development. Most of the existing fermentation media and fermentation methods are for other types of viruses or proteins and are not specifically optimized for the characteristics of PCV3 Cap protein. Therefore, developing an efficient fermentation medium for the production of PCV3 Cap protein to reduce the generation of contaminating proteins and thus reduce the purification difficulty has important social significance and provides technical support for the industrial production of PCV3 vaccines. Summary of the Invention

[0005] In order to solve the technical problems of low protein expression efficiency and a lot of contaminating proteins in the existing fermentation medium, the present invention provides a fermentation medium for porcine circovirus type 3 Cap protein virus-like particles. Fermenting porcine circovirus type 3 Cap protein virus-like particles with the fermentation medium of the present invention can significantly reduce the generation of contaminating proteins, reduce the purification difficulty, and further provide technical support for the industrial production of PCV3 vaccines.

[0006] The present invention solves the above technical problems through the following technical solutions.

[0007] The present invention provides a fermentation medium for porcine circovirus type 3 Cap protein virus-like particles, and the fermentation medium contains components in the following proportions: 12-18 parts by weight of tryptone, 7-13 parts by weight of yeast extract, 6-10 parts by weight of casein hydrolyzate, 6-10 parts by weight of sorbitol, 3-7 parts by weight of glycerol, 0.2-0.8 parts by weight of polyoxyethylene monooctyl phenyl ether, 7-13 parts by weight of sodium chloride, 7-13 parts by weight of dipotassium hydrogen phosphate, 3-7 parts by weight of potassium dihydrogen phosphate, 0.0001-0.001 parts by weight of copper sulfate, 3-7 parts by weight of ferrous sulfate, 3-7 parts by weight of ammonium sulfate, 1-5 parts by weight of zinc chloride, 1-5 parts by weight of magnesium sulfate, 1-4 parts by weight of calcium lactate, 0.0000005-0.000002 parts by weight of coenzyme R.

[0008] In the present invention, the medium contains components in the following proportions: 14-16 parts by weight of tryptone, 9-11 parts by weight of yeast extract, 7-9 parts by weight of casein hydrolyzate, 7-9 parts by weight of sorbitol, 4-6 parts by weight of glycerol, 0.4-0.6 parts by weight of polyoxyethylene monooctyl phenyl ether, 9-11 parts by weight of sodium chloride, 9-11 parts by weight of dipotassium hydrogen phosphate, 4-6 parts by weight of potassium dihydrogen phosphate, 0.0003-0.0008 parts by weight of copper sulfate, 4-6 parts by weight of ferrous sulfate, 4-6 parts by weight of ammonium sulfate, 2-4 parts by weight of zinc chloride, 2-4 parts by weight of magnesium sulfate, 0.5-1.5 parts by weight of calcium lactate, 0.000001 parts by weight of coenzyme R.

[0009] In the present invention, the fermentation medium contains components in the following concentrations: 15 g / L of tryptone, 10 g / L of yeast extract, 8 g / L of casein hydrolyzate, 8 g / L of sorbitol, 5 g / L of glycerol, 0.5 g / L of polyoxyethylene monooctyl phenyl ether, 10 g / L of sodium chloride, 10 g / L of dipotassium hydrogen phosphate, 5 g / L of potassium dihydrogen phosphate, 0.0005 g / L of copper sulfate, 5 g / L of ferrous sulfate, 5 g / L of ammonium sulfate, 3 g / L of magnesium sulfate, 3 g / L of zinc chloride, 1 g / L of calcium lactate, 1 μg / L of coenzyme R.

[0010] The present invention also provides a porcine circovirus type 3 Cap protein virus-like particle, and the amino acid sequence of the porcine circovirus type 3 Cap protein virus-like particle is as shown in SEQ NO.1.

[0011] The present invention also provides a nucleic acid molecule encoding the above porcine circovirus type 3 Cap protein virus-like particle, and the nucleotide sequence of the nucleic acid molecule is as shown in SEQ NO.2.

[0012] The present invention also provides a recombinant expression vector containing the above nucleic acid molecule.

[0013] In the present invention, the recombinant expression vector is the pPICZɑA plasmid. In the present invention, in the recombinant expression vector, the nucleotide sequence of the nucleic acid molecule is integrated between Pst1 and XbaI of the pPICZɑA vector by homologous recombination.

[0014] The present invention also provides a recombinant yeast expressing the above-mentioned porcine circovirus type 3 Cap protein virus-like particles.

[0015] In the present invention, the recombinant yeast uses Pichia pastoris X33 as the host cell.

[0016] The present invention also provides a fermentation culture method for porcine circovirus type 3 Cap protein virus-like particles, which comprises the following preparation steps: inoculating the recombinant yeast expressing the above-mentioned porcine circovirus type 3 Cap protein virus-like particles into the above-mentioned medium for fermentation culture, centrifuging to remove the thalli, obtaining the supernatant containing porcine circovirus type 3 Cap protein virus-like particles, and purifying to obtain the porcine circovirus type 3 Cap protein virus-like particles.

[0017] In the present invention, the purification method is salting-out method, ultrafiltration method, affinity chromatography method or gel filtration chromatography method.

[0018] In the present invention, the recombinant yeast uses Pichia pastoris X33 as the host cell.

[0019] On the basis of conforming to the common knowledge in the art, the above-mentioned preferred conditions can be combined arbitrarily to obtain the preferred examples of the present invention.

[0020] The reagents and raw materials used in the present invention are all commercially available.

[0021] The positive and progressive effects of the present invention are as follows: (1) Using the fermentation medium of the present invention to ferment porcine circovirus type 3 Cap protein virus-like particles has the advantage of less impurity protein.

[0022] (2) Using the fermentation medium of the present invention for the large-scale production of porcine circovirus type 3 Cap protein virus-like particles can reduce the purification cost. Description of the Drawings

[0023] Figure 1 It is the change curve of the cell density and time during the fermentation process, where curves 1, 2 and 3 correspond to Example 3, Comparative Example 1 and Comparative Example 2 respectively.

[0024] Figure 2 It is the electrophoretogram of the supernatant protein of the thalli; M is the control protein, and lanes 1-3 correspond to the samples of Example 3, Comparative Example 1 and Comparative Example 2 respectively.

[0025] Figure 3Electron micrograph of virus-like particles of porcine circovirus type 3 provided for Example 3. Detailed implementation manners

[0026] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the examples described herein. For the experimental methods without specific conditions indicated in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product instructions.

[0027] Example 1: Preparation of fermentation medium.

[0028] The components of the fermentation medium of the present invention are prepared as follows: tryptone 15 g / L, yeast extract 10 g / L, casein hydrolysate 8 g / L, sorbitol 8 g / L, glycerol 5 g / L, polyoxyethylene monooctylphenyl ether 0.5 g / L, sodium chloride 10 g / L, dipotassium hydrogen phosphate 10 g / L, potassium dihydrogen phosphate 5 g / L, copper sulfate 0.0005 g / L, ferrous sulfate 5 g / L, ammonium sulfate 5 g / L, magnesium sulfate 3 g / L, zinc chloride 3 g / L, calcium lactate 1 g / L, coenzyme R 1 μg / L, sterilized at 121 °C for 20 minutes.

[0029] Example 2: Construction of recombinant plasmid and screening of high-copy strains.

[0030] This example includes the following steps: (1) The strain used in this example is the X33 recombinant yeast strain, and the strain contains the eukaryotic expression vector pPICZɑA carrying the target gene (the gene expressing the Cap protein), and the sequence of the target gene is the mutation of the cap protein of PCV3 according to the prediction website (novopro), and the mutated sequence is shown in SEQ ID NO.1.

[0031] SEQ ID NO.1: MetArgHisArgAlaIlePheArgArgArgProArgProArgArgArgArgArgHisArgArgArgTyrAlaArgArgArgLeuPheIleArgArgProThrAlaGlyThrTyrTyrThrLysLysTyrSerThrMetAsnValIleSerValGlyThrProGlnAsnAsnLysProTrpHisAlaAsnHisPheIleThrArgLeuAsnGluTrpGluThrAlaIleThrPheGluTyrTyrLysIleLeuLysMetLysValThrLeuSerProValIleSerProAlaGlnGlnThrLysThrMetPheGlyHisThrAlaIleAspLeuAspGlyAlaTrpThrThrAsnThrTrpLeuGlnAspAspProTyrAlaGluSerSerThrArgLysValMetThrSerLysLysLysHisSerArgTyrPheThrProLysProLeuLeuAlaGlyThrThrSerAlaHisProGlyGlnSerLeuPhePhePheSerArgProThrProTrpLeuAsnThrTyrAspProThrValGlnTrpGlyAlaLeuLeuTrpSerIleTyrValProGluLysThrGlyMetThrAspPheTyrGlyThrLysGluValTrpIleArgTyrLysSerValLeu。

[0032] The preferred codons required for expression in the Pichia pastoris host were optimized online using the website (novopro) tool, as shown in SEQ ID NO. 2. According to the gene sequence shown in SEQ ID NO. 2, GenScript Biotech Co., Ltd. in Suzhou was commissioned to obtain it by gene synthesis. The synthesized sequence was integrated between Pst1 and XbaI of the pPICZɑA vector by homologous recombination using a seamless cloning kit to obtain a recombinant plasmid.

[0033] SEQ ID NO.2: ATGAGACACA GAGCTATATT TAGACGACGT CCAAGACCCA GACGTCGAAGACGTCATAGG AGAAGATACG CTAGACGTAG GTTGTTTATC AGAAGACCAA CTGCTGGAAC TTACTACACTAAGAAATACT CCACTATGAA CGTAATTAGT GTTGGAACAC CACAAAATAA CAAACCTTGG CACGCTAACCACTTTATTAC TCGTCTAAAC GAATGGGAAA CTGCCATTAC CTTCGAATAT TATAAGATCT TGAAGATGAAAGTTACCCTG TCCCCTGTTA TCTCTCCTGC TCAACAAACT AAGACTATGT TTGGACACAC TGCCATTGATTTGGATGGTG CATGGACAAC TAACACTTGG TTGCAGGATG ATCCATACGC TGAGAGTTCC ACAAGAAAAGTCATGACCAG TAAAAAGAAA CACTCACGTT ACTTTACGCC AAAACCCTTA TTGGCCGGAA CTACATCTGCTCATCCCGGA CAGTCACTGT TTTTCTTCTC TCGACCTACT CCATGGCTTA ATACATACGA CCCTACAGTACAGTGGGGCG CATTGTTGTG GTCCATTTAC GTGCCAGAGA AAACTGGAAT GACAGACTTC TATGGAACTAAAGAGGTGTG GATCAGATAC AAATCAGTAT TG。

[0034] (2)Recombinant plasmid transformation. The obtained recombinant plasmid was transformed into top10 competent cells. 2 ng of the plasmid was mixed with 100 μL of competent cells, incubated on ice for 20 min, heat-shocked at 42 °C for 45 s and then incubated on ice for 2 min, 1 mL of LB antibiotic-free medium was added, and the cells were recovered at 37 °C for 30 min. 20 μL of the bacterial solution was spread on an LB solid medium containing 100 μg / mL bleomycin and cultured in the dark at 37 °C for 16 h. Single colonies were picked and inoculated into an LB antibiotic-free medium containing 50 μg / mL bleomycin and cultured at 32 °C until the absorbance OD 600 = 2.0. After plasmid extraction, it was verified by PmeI digestion. The linearized plasmid was purified by cold ethanol precipitation and dissolved in double-distilled water for later use.

[0035] (3) Screening of high-copy strains. Mix 10 μL of linearized plasmid with 90 μL of competent cells, incubate on ice for 5 min, perform electroporation at 1200 V and 5.5 ms, then immediately add pre-cooled YPD medium at 4°C. After standing at 29°C for 3 h, spread on YPD medium plates containing bleomycin (3 mg / mL) and incubate in the dark at 29°C for 72 h to screen for high-copy integrated bacteria.

[0036] Example 3: High-density fermentation and induction expression.

[0037] Inoculate the high-copy integrated bacteria into a sterilized 10 L fermenter (containing 7.5 L of aqueous medium and 80 μg / mL of bleomycin) at an inoculation amount of 6%. Adjust the pH to 6.8 with ammonia water, incubate at 29°C, the basic rotation speed is 250 rpm, and the aeration rate is controlled to maintain the dissolved oxygen at 40%. During this period, perform dynamic feeding by monitoring the absorbance OD value of the bacterial liquid at a wavelength of 600 nm. The dynamic feeding conditions are as follows: when OD 600 = 5, feed a feeding solution containing 40% glucose + 10% yeast extract (2 mL / min); when OD 600 = 10, switch to exponential feeding (rate = 0.1 × OD value, unit mL / min); when OD 600 = 18, stop feeding, cool down to 25°C. Add 0.5% methanol for induction, and then the fermentation ends.

[0038] Comparative Example 1: Similar to the cultivation and fermentation method of Example 3, the difference is that polyoxyethylene monooctyl phenyl ether and sorbitol are not added to the medium.

[0039] Comparative Example 2: Similar to the cultivation and fermentation method of Example 3, the difference is that a commercially available YPD yeast medium is used instead of the medium used in the present invention for the fermentation medium.

[0040] Example 4: Determination of cell density.

[0041] Every 12 hours, accurately measure 5 mL of the fermentation broth of Example 3, Comparative Example 1, and Comparative Example 2, and measure the absorbance of OD 600 . The changes in cell growth and time during fermentation are as shown in Figure 1 .

[0042] Example 5: Electrophoresis detection.

[0043] Centrifugally collect the bacterial cells obtained in Example 3, Comparative Example 1, and Comparative Example 2 above. After resuspending the bacterial cells with PBS, freeze-thaw them three times repeatedly, disrupt them by ultrasonic waves, and centrifuge to take 20 μL of the supernatant respectively. Mix the sample to be detected with an appropriate amount of loading buffer and heat it in a metal bath at 100°C for 10 min. After cooling at room temperature, load 20 μL of the sample onto an SDS-PAGE gel with a separating gel concentration of 12%. Electrophorese at 80 V for 30 min, then change the voltage to 120 V and continue electrophoresis for 90 min. After electrophoresis, disassemble the gel plate and stain it with Coomassie Brilliant Blue staining solution for 3 h, and then decolorize it with a decolorizing agent until clear bands appear. Examine the expression of PCV3 Cap protein. The electrophoresis detection results are as Figure 2 shown.

[0044] Example 6: Electron microscopy detection.

[0045] Perform negative staining electron microscopy on the supernatant collected in Example 3 without the purification step to observe VLP particles. The results are as Figure 3 shown.

[0046] From Figure 1 it can be seen that in the early stage of fermentation, the biomass continued to increase. Then, with the addition of supplementary liquid, the fermentation broth was diluted and the biomass decreased, but then it increased rapidly. Throughout the fermentation cycle, the biomass in the fermentation broth of Example 3 was slightly higher than that in the fermentation broths of Comparative Example 1 and Comparative Example 2. It can be seen that the fermentation culture medium in the present invention is helpful for the proliferation culture of recombinant Pichia pastoris bacteria.

[0047] SDS-PAGE analysis, as Figure 2 shown, in the supernatant of the lysate of recombinant Pichia pastoris bacteria cultured with the culture medium of the present invention, the PCV3 Cap protein band (about 28 kDa) was significantly and singly colored, and the number of heteroprotein bands was small and the signal was weak; while in the supernatant of the lysate of the commercially available culture medium control group, the non-specific bands were dense and had a high intensity. It can be seen that the culture medium of the present invention has a higher purity compared with the commercially available culture medium.

[0048] As Figure 3 shown, further transmission electron microscopy observation found that a large number of uniform spherical particles with a diameter of about 18 nm were distributed in the supernatant of the unpurified lysate obtained with the culture medium of the present invention, which was consistent with the morphology of the virus-like particles formed by the self-assembly of PCV3 Cap protein. This result confirms that the optimized culture medium not only improves the expression efficiency of the target protein, but also promotes the correct folding and self-assembly of the Cap protein, providing a high-purity precursor for the large-scale preparation of virus-like particles.

[0049] In summary, the present invention realizes the high-efficiency expression of the target protein by regulating the components of the culture medium and the fermentation process, providing technical support for the industrial production of PCV3 subunit vaccine.

Claims

1. A fermentation medium for porcine circovirus type 3 Cap protein virus-like particles, characterized in that: The fermentation medium contains components in the following proportions: 12-18 parts by weight of tryptone, 7-13 parts by weight of yeast extract, 6-10 parts by weight of casein hydrolyzate, 6-10 parts by weight of sorbitol, 3-7 parts by weight of glycerol, 0.2-0.8 parts by weight of polyoxyethylene mono-tert-octylphenyl ether, 7-13 parts by weight of sodium chloride, 7-13 parts by weight of dipotassium hydrogen phosphate, 3-7 parts by weight of potassium dihydrogen phosphate, 0.0001-0.001 parts by weight of copper sulfate, 3-7 parts by weight of ferrous sulfate, 3-7 parts by weight of ammonium sulfate, 1-5 parts by weight of zinc chloride, 1-5 parts by weight of magnesium sulfate, 1-4 parts by weight of calcium lactate, and 0.0000005-0.000002 parts by weight of coenzyme R.

2. The fermentation medium according to claim 1, characterized in that The fermentation medium contains components in the following proportions: 14-16 parts by weight of tryptone, 9-11 parts by weight of yeast extract, 7-9 parts by weight of casein hydrolyzate, 7-9 parts by weight of sorbitol, 4-6 parts by weight of glycerol, 0.4-0.6 parts by weight of polyoxyethylene mono-tert-octylphenyl ether, 9-11 parts by weight of sodium chloride, 9-11 parts by weight of dipotassium hydrogen phosphate, 4-6 parts by weight of potassium dihydrogen phosphate, 0.0003-0.0008 parts by weight of copper sulfate, 4-6 parts by weight of ferrous sulfate, 4-6 parts by weight of ammonium sulfate, 2-4 parts by weight of zinc chloride, 2-4 parts by weight of magnesium sulfate, 0.5-1.5 parts by weight of calcium lactate, and 0.000001 parts by weight of coenzyme R.

3. The fermentation medium according to claim 2, characterized in that The fermentation medium contains components in the following concentrations: 15 g / L tryptone, 10 g / L yeast extract, 8 g / L casein hydrolyzate, 8 g / L sorbitol, 5 g / L glycerol, 0.5 g / L polyoxyethylene mono-tert-octylphenyl ether, 10 g / L sodium chloride, 10 g / L dipotassium hydrogen phosphate, 5 g / L potassium dihydrogen phosphate, 0.0005 g / L copper sulfate, 5 g / L ferrous sulfate, 5 g / L ammonium sulfate, 3 g / L magnesium sulfate, 3 g / L zinc chloride, 1 g / L calcium lactate, and 1 μg / L coenzyme R.

4. A porcine circovirus type 3 Cap protein virus-like particle, characterized in that: The amino acid sequence of the porcine circovirus type 3 Cap protein virus-like particle is shown in SEQ NO.

1.

5. A nucleic acid molecule encoding the porcine circovirus type 3 Cap protein virus-like particle as described in claim 4.

6. The nucleic acid molecule according to claim 5, characterized in that The nucleotide sequence of the nucleic acid molecule is shown in SEQ NO.

2.

7. A recombinant expression vector containing the nucleic acid molecule according to claim 5.

8. A recombinant yeast expressing the porcine circovirus type 3 Cap protein virus-like particles as claimed in claim 4, wherein the recombinant yeast uses Pichia pastoris X33 as a host cell.

9. A fermentation and culture method for porcine circovirus type 3 Cap protein virus-like particles, characterized in that: The method comprises the following preparation steps: inoculating a recombinant yeast expressing porcine circovirus type 3 Cap protein virus-like particles as described in claim 4 into a culture medium as described in any one of claims 1 to 3 for fermentation and culturing, removing the bacteria by centrifugation to obtain a supernatant containing porcine circovirus type 3 Cap protein virus-like particles, and obtaining the porcine circovirus type 3 Cap protein virus-like particles after purification.

10. The fermentation and culture method of circovirus type 3 Cap protein virus-like particles according to claim 9, characterized in that: The recombinant yeast uses Pichia pastoris X33 as a host cell.

Images