A SNP molecular marker related to fiber length of gossypium barbadense and amplification primer and application thereof

Abstract

The application provides a SNP molecular marker related to fiber length of Gossypium barbadense, and an amplification primer and application thereof, and belongs to the technical field of molecular markers. The SNP molecular marker related to fiber length of Gossypium barbadense is a C / T polymorphic site at the 124th base of a DNA fragment with a nucleotide sequence as shown in SEQ ID NO:1. The SNP molecular marker can be used for polymerization breeding and parent screening of fiber length of Gossypium barbadense, lays a foundation for molecular marker assisted selection and precise breeding of fiber length, and promotes production of Gossypium barbadense in Xinjiang.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular markers, and particularly relates to a SNP molecular marker related to fiber length of Gossypium barbadense, and an amplification primer and application thereof. BACKGROUND

[0002] Cotton is one of the most important economic crops in the world, providing 81% of the world's natural fiber and being the main raw material for the textile industry. At present, Gossypium hirsutum and Gossypium barbadense are the two most important heterozygous tetraploid cultivated cotton species, and more than 97% of the fiber yield comes from the two cotton species. Gossypium hirsutum and Gossypium barbadense originated about 1.5 million years ago from the hybridization of diploid cotton in Africa and diploid cotton in the Americas, and genome doubling. Compared with Gossypium hirsutum, Gossypium barbadense has longer, finer and stronger fibers, but lower yield. Cultivating high-quality and high-yield Gossypium barbadense varieties is necessary for the textile industry. Therefore, it is of great significance to mine genes related to fiber quality in Gossypium barbadense.

[0003] Compared with Gossypium hirsutum, Gossypium barbadense has better fiber quality and lower yield. There are few studies on genes related to fiber quality and yield of Gossypium barbadense, and further functional verification is needed for truly effective selection sites or genes. At the same time, due to the narrow genetic basis of Xinjiang Gossypium barbadense with fewer backbone parents, whole-genome association analysis combined with re-sequencing data can fully utilize germplasm resources and break the bottleneck of genetic diversity. The rapid development of high-throughput DNA sequencing technology makes it possible to re-sequence large-scale cotton core germplasm resources, and a large amount of high-quality SNPs can be obtained through data alignment. However, there is no report on SNP molecular markers related to fiber length of Gossypium barbadense. SUMMARY

[0004] Therefore, the purpose of the present application is to provide a SNP molecular marker related to fiber length of Gossypium barbadense, which lays a foundation for assisted selection and precise breeding to improve fiber length.

[0005] The present application provides a SNP molecular marker related to fiber length of Gossypium barbadense, and a C / T polymorphic site exists at the 124th base of the DNA fragment with the nucleotide sequence shown in SEQ ID NO: 1.

[0006] The present application provides a primer for amplifying the SNP molecular marker related to fiber length of Gossypium barbadense, which comprises a primer pair with the nucleotide sequences shown in SEQ ID NO: 2 and SEQ ID NO: 3.

[0007] The present application provides a kit for detecting fiber length of Gossypium barbadense, which comprises the primer.

[0008] Preferably, the kit further comprises a PCR amplification premix.

[0009] The application provides an island cotton SNP gene chip, which comprises probes or primers for detecting the SNP molecular marker.

[0010] The application provides application of the SNP molecular marker related to the island cotton fiber length, the primer, the kit or the island cotton SNP gene chip in island cotton fiber length prediction and / or screening.

[0011] The application provides application of the SNP molecular marker related to the island cotton fiber length, the primer, the kit or the island cotton SNP gene chip in island cotton fiber length prediction and / or screening.

[0012] The application provides a method for analyzing the island cotton fiber length by using the SNP molecular marker, comprising the following steps:

[0013] extracting genomic DNA of a sample to be tested;

[0014] using the extracted genomic DNA of the sample to be tested as material, analyzing the genotype of the SNP molecular marker, and analyzing the island cotton fiber length according to the genotype of the SNP molecular marker.

[0015] when the genotype of the SNP molecular marker is the CC genotype, the sample to be tested has no fiber length advantage;

[0016] when the genotype of the SNP molecular marker is the TT genotype, the sample to be tested has a fiber length advantage.

[0017] Preferably, the genotype of the SNP molecular marker is analyzed by resequencing or PCR amplification product sequencing.

[0018] Preferably, the PCR amplification product is obtained by using the primer for amplification.

[0019] The application provides an SNP molecular marker related to the island cotton fiber length, wherein a C / T polymorphic site exists at the 124th base of a DNA segment with a nucleotide sequence shown in SEQ ID NO:1. The application uses 240 island cotton varieties from all over the world as material, and uses whole genome association analysis to find the SNP molecular marker significantly related to the island cotton fiber length. The SNP molecular marker can be used for polybreeding and parent screening of the island cotton fiber length. In each period of cotton development, the specific primer PCR amplification method can be used to quickly and batch-screen excellent parents according to whether the SNP base mutation is contained. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 SNPs distribution density map of 240 island cottons;

[0021] Figure 2 SNP-based Manhattan plot, QQ plot of 2017 FL-GWAS

[0022] Figure 3 SNP-based Manhattan plot, QQ plot of 2018 FL-GWAS

[0023] Figure 4 SNP-based Manhattan plot, QQ plot of 2022 FL-GWAS

[0024] Figure 5 SNP-based Manhattan plot, QQ plot of 2023 FL-GWAS

[0025] Figure 6 BLUE (breeding value) based Manhattan plot, QQ plot of FL-GWAS

[0026] Figure 7 Phenotypic results of fiber length of materials with different alleles of Gbar_A06_93397381, wherein Hap1 is REF-CC and Hap2 is ALT-TT

[0027] Figure 8 Phenotypes of fiber length of materials with different alleles of Gbar_A06_93397381 in each year, wherein Hap1 is REF-CC and Hap2 is ALT-TT

[0028] Figure 9 Fiber length of different haplotype varieties planted in Xinjiang in 2024. DETAILED DESCRIPTION

[0029] The present application provides a SNP molecular marker related to the fiber length of island cotton, wherein a C / T polymorphic site exists at the 124th base of a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1.

[0030] In the present application, the SNP molecular marker is screened from a total of 240 island cotton materials from Xinjiang, China and other countries and regions, the phenotypes of fiber length of the materials are determined, and the genomes are resequenced, and through whole genome association analysis, the results show that, with a threshold of at least -log(P)>4 in two environments, the analysis results show that the SNP: Gbar_A06_93397381 on the Gbar_A06 chromosome is significantly related to the fiber length of island cotton, and the resequencing results of other island cotton material groups are verified, the two genotypes of the SNP: Gbar_A06_93397381 are significantly related to the fiber length of island cotton, and specifically, the fiber length of the material carrying the TT genotype is significantly higher than that of the material carrying the CC genotype.

[0031] The application provides a primer for amplifying the SNP molecular marker related to the fiber length of Gossypium barbadense, which comprises a primer pair shown in the nucleotide sequences of SEQ ID NO: 2 (CTTTGTTCCCACACCC) and SEQ ID NO: 3 (TTGCTTTTTCGCCTTA).

[0032] The application provides a kit for detecting the fiber length of Gossypium barbadense, which comprises the primer.

[0033] In the application, the kit preferably further comprises a PCR amplification premix. The PCR amplification premix preferably comprises a PCR buffer, magnesium ions, a DNA polymerase, dNTPs and the like. The application does not have special limitations on the preparation method of the PCR amplification premix, and a PCR amplification premix known in the art can be used.

[0034] In the application, the kit preferably further comprises a plant genomic DNA extraction reagent. The application does not have special limitations on the type of the plant genomic DNA extraction reagent, and a plant genomic DNA extraction kit known in the art can be used.

[0035] The application provides a Gossypium barbadense SNP gene chip comprising a probe or primer for detecting the SNP molecular marker.

[0036] The application does not have special limitations on the sequence of the probe or primer, and a probe or primer capable of specifically detecting the SNP molecular marker can be used.

[0037] The application provides application of the SNP molecular marker related to the fiber length of Gossypium barbadense, the primer, the kit or the Gossypium barbadense SNP gene chip in fiber length prediction and / or screening of Gossypium barbadense.

[0038] The application provides a method for analyzing the fiber length of Gossypium barbadense by using the SNP molecular marker, comprising the following steps:

[0039] extracting genomic DNA of a sample to be tested;

[0040] using the extracted genomic DNA of the sample to be tested as a material, analyzing the genotype of the SNP molecular marker, and analyzing the fiber length of Gossypium barbadense according to the genotype of the SNP molecular marker;

[0041] when the genotype of the SNP molecular marker is a CC genotype, the sample to be tested has no fiber length advantage;

[0042] when the genotype of the SNP molecular marker is a TT genotype, the sample to be tested has a fiber length advantage.

[0043] In the present application, the genotype of the SNP molecular marker is preferably analyzed by resequencing. The method of resequencing in the present application is not particularly limited, and the experimental protocol of resequencing well known in the art can be used. The method of analyzing the genotype of the SNP molecular marker also preferably includes sequencing of PCR amplification products. The PCR amplification product is preferably obtained by amplification using the primer. The sequencing of the PCR amplification product is preferably completed by using the Sanger sequencing method. The genotype of the SNP molecular marker is analyzed by analyzing the sequencing results obtained, and when only a C peak appears at the site of the SNP molecular marker, it indicates that the genotype of the sample to be tested is the CC genotype, and when only a T peak appears at the site of the SNP molecular marker, it indicates that the genotype of the sample to be tested is the TT genotype. When a C peak and a T peak appear at the site of the SNP molecular marker, it indicates that the genotype of the sample to be tested is the CT genotype. In the embodiments of the present application, the number of CT genotype materials is only 5, which is relatively small, and therefore the phenotype is not representative. By analyzing the correlation between the fiber length phenotype and the genotype of the island cotton, it is found that the average fiber length of the materials carrying T base in the 240 island cotton materials in 2018, 2022, 2023 and BLUE value is higher than that of the materials carrying C base, and in 2018, 2022 and BLUE value, it reaches the extremely significant difference level. In order to further verify the biological function of the SNP molecular marker, the resequencing results of another batch of island cotton population are analyzed, and the results are consistent with the above results. Therefore, the SNP molecular marker is a SNP molecular marker closely linked to the fiber length trait of island cotton, and can be used for breeding and identification of long fiber varieties of island cotton.

[0044] The present application provides the application of the SNP molecular marker related to the fiber length of island cotton, the primer, the kit or the island cotton SNP gene chip in breeding and / or improving the island cotton variety with fiber length advantage.

[0045] In the present application, the method of breeding and / or improving the island cotton variety with fiber length advantage preferably uses the above method to analyze the genotype of the SNP molecular marker of the island cotton variety, and selects the island cotton material with genotype TT for breeding or improvement.

[0046] The SNP molecular marker related to the fiber length of island cotton, the amplification primer thereof and the application thereof provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0047] Example 1

[0048] Screening of a SNP molecular marker related to the fiber length of island cotton

[0049] Population materials and phenotype statistics

[0050] 1. Population material selection and field trial design

[0051] In this study, a total of 240 Gossypium barbadense L. materials were collected from Xinjiang, China and other countries and regions for fiber length investigation, among which 220 were the main cultivars independently bred in Xinjiang since the end of the 20th century, 3 were perennial semi-wild Gossypium barbadense L. germplasm, and 15 were varieties from abroad, covering representative varieties in Central Asia, the United States and Egypt.

[0052] The population was planted in Yizhou District, Sanya, Hainan Province (HN, 18.23°N, 109.50°E) in 2017, 2018, 2022 and 2023 according to the completely randomized block design with two replicates. Daily field management was carried out according to the local conventional method.

[0053] 2. Identification of fiber length traits and statistical analysis of phenotypic data

[0054] In the boll opening period in March, 50 bolls located in the middle of the plant and normally intact were randomly picked from each row, dried and then rolled by a skin roller. 20 g of fiber was randomly selected and sent to the Cotton Quality Supervision and Inspection Test Center of the Ministry of Agriculture and Rural Affairs. Fiber length traits were detected according to the standard GB / T 20392-2006 "HVI Cotton Fiber Physical Property Test Method".

[0055] The BLUE (best linear unbiased estimate) of fiber length traits in each year was estimated using the lme4 package of R language, and the model is shown in formula I:

[0056] FL = lmer(FL ~ Sample + (1 | Rep) + (1 | Year:Rep) + (1 | Year)) Formula I.

[0057] FL is the dependent variable, Sample is the independent variable, 1 | Rep indicates that the test repetition is treated as a random effect variable, 1 | Year indicates that the individual year is treated as a random effect variable, and 1 | Year:Rep indicates the nested random effect of year and test repetition.

[0058] Example 2

[0059] Obtaining of SNPs

[0060] 1. Library construction and sequencing

[0061] The tender leaf tissues of each material in the population were collected, the sample genomic DNA was extracted by CTAB method, and the purity and integrity of the DNA were determined by agarose gel electrophoresis and ultraviolet absorption method. The qualified DNA samples were sequenced by Beijing Nuoweziyuan Technology Co., Ltd. The sample was randomly broken by a Covaris crusher to form fragments with a length of about 350 bp. Subsequently, a series of operations such as end repair, addition of ploy A tail, connection of sequencing adapter, purification and PCR amplification were carried out in turn to complete the preparation of the whole library. The constructed library was sequenced by using an Illumina HiSeq PE150 sequencing platform. The average sequencing depth reached 10.85x, and a total of 6.3 Tb of raw data was generated.

[0062] 2. Genotyping and filtering

[0063] The high-quality Gossypium barbadense genome (Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1, https: / / www.cottongen.org / species / Gossypium_barbadense / HAU-AD2_genome_v2.0) [1] was used as the reference genome for variant detection. First, the fastq file was filtered by fastp with the parameters "-c-n 15-u 50-q15". The reference genome was indexed by using bwa software, and the filtered fastq file was aligned to the reference genome to obtain a sam format file. The sam file was converted to bam format and sorted and repeated fragments were removed by using samtools and sambamba software. The gatk software was used to identify SNP and Indel variations. The SNP variations were filtered with the standard "QUAL < 60 QD < 20.0 FS > 10.0 MQ < 30.0 MQRankSum < -1.65 ReadPosRankSum < -8.0". Finally, the vcftools was used to filter and remove SNP sites with a minimum allele frequency less than 0.05 and a deletion rate greater than 20%, and 3110663 high-quality SNPs (SNP Figure 1 ) were retained for subsequent whole genome association analysis.

[0064] Example 3

[0065] Whole genome association analysis of fiber length traits of Gossypium barbadense

[0066] The obtained Gossypium barbadense fiber length phenotype data, using the obtained SNP variation information, using GEMMA (Genome-wide Efficient Mixed Model Association algorithm) univariate linear mixed model (Univariate Linear Mixed Model) for association analysis.

[0067] y = W a + x b + u + e Formula II.

[0068] Wherein, u ~ MVN n (0, l a -1 K);e ~ MVN n (0, t -1 I n );

[0069] y represents the phenotype data, W is the covariate matrix, such as the PCA matrix, a is the coefficient vector corresponding to the covariate (including the intercept term), x is the marker genotype vector, b represents the genotype information of each material at each SNP site. u is a random effect vector, which is subject to a multivariate normal distribution with a mean of 0 and a covariance matrix of l a -1 K, K is the kinship matrix (used to consider the genetic correlation and population structure between individuals, to avoid false positive associations due to population stratification and other factors) Corrected population analysis, l is the variance component ratio, t -1 is the residual variance. e is the error vector, which is subject to a multivariate normal distribution with a mean of 0 and a covariance matrix of t -1 I n , which represents the influence of other factors on the phenotype in addition to genotype, covariate and random effect.

[0070] The Manhattan plot and QQ plot (quantile-qualtile plot) are drawn using the CMplot software package of R language to represent the P value of each SNP and the association effect, see Figures 2-6 .

[0071] Taking at least two environments -log(P)>4 as the threshold, it is found that the SNP: Gbar_A06_93397381 on the Gbar_A06 chromosome is significantly related to the fiber length of Gossypium barbadense, and the P value of the SNP in each year is shown in Table 1.

[0072] Table 1 GWAS value of SNP site Gbar_A06_93397381 in each year

[0073] Gbar_A06_93397381 2017 2018 2022 2023 Best linear unbiased estimate P value 9.86e-01 2.02e-04 2.54e-05 2.31e-03 4.91e-05 -log10(P value) 0.006 3.694 4.596 2.636 4.309

[0074] The SNP is at base 93397381 of chromosome 6 of Gossypium barbadense A subgenome, mutated from C to T. The homologous gene of the gene in Arabidopsis thaliana is AT4G28500 (NAC073), which is a protein containing secondary wall synthesis related NAC domain.

[0075] Table 2 primer sequences for identifying SNP site Gbar_A06_93397381

[0076] Primer name Primer sequence Gbar_A06_93397381_F CTTTGTTCCCACACCC (SEQ ID NO: 2) Gbar_A06_93397381_R TTGCTTTTTCGCCTTA (SEQ ID NO: 3)

[0077] The sequence of the amplification product (Gbar_A06:93397258-Gbar_A06:9339779) is as follows: CTTTGTTCCCACACCCAATGTGCCGCCACCCTTATTCGATACAGGGTCCTTC ATATATCGGACATAATTATATGCGCACATCAATAATTCTCTATTACAACAATTT CATATAATTATCTAACA[C / T]AATAATTAATTCTCTATTATTCCATCAAACTCAT AATAATTTTACCGTATTAAAATTCATATTCAATAAAATTATTATAACTAATTAAATCAATTTTTACTTTAAATTTTATTATTTAATTACATTCAATTCAGTTTAATTCAAATTTAATTTATATATTAAAAACCCTAAAAAGCGAATCATTATTAATAGTATTAATTTTTTACTCGTAGCTTTAAGAATACTCTAGTTTGACACTGGAGCTGAAGGCCTTTTCTAAAGAGGTAAAACGTCCTCTAAAGAGTACCAGTTTGCCTTCTCTGCACTCCAACTCTTTTTTTCTTTAATCAATTTTTTATTTTATTTATGGTTAAATGTTCTTATTAAGCTTTTAATTAAACCCATCTATAACGTTTAAACCTAAGGCGAAAAAGCAA (SEQ ID NO: 1). Wherein there is a C / T polymorphism site at position 124.

[0078] Example 4

[0079] Correlation analysis of SNP site Gbar_A06_93397381 and fiber length of Gossypium barbadense

[0080] The present embodiment studies the influence of different alleles of SNP site Gbar_A06_93397381 on fiber length traits. According to the resequencing results of 240 Gossypium barbadense materials, the genotypes of each material were analyzed. One of the materials lacked phenotype data, so 239 materials were used for phenotype and genotype statistics. There were 100 CC type materials, 134 TT type materials, and only 5 CT type materials, which were relatively few and the phenotype was not representative. Only CC type materials and TT type materials were analyzed, and the results showed that the fiber length of materials carrying T base was significantly higher than that of materials carrying C base Figure 7 ).

[0081] The average fiber length of materials carrying T base was higher than that of materials carrying C base in 2018, 2022, 2023, and BLUE value in 240 Gossypium barbadense materials in 2018, 2022, 2023, and BLUE value Figure 8 ).

[0082] Example 5

[0083] Verification of SNP site Gbar_A06_93397381

[0084] Test method:

[0085] 218 Gossypium barbadense varieties bred in Xinjiang were selected, including 86 varieties containing Gbar_A06_93397381(C) and 132 varieties containing Gbar_A06_93397381(T). They were planted in Xinjiang Alar Tarim River Seed Company Limited (XJ, 40.55°N, 81.27°E) in 2024. They were sowed in mid-to-late April and harvested in mid-to-late October. According to the completely randomized block design, the row spacing was 38.33 cm, the plant spacing was 10.49 cm, 12-15 plants were planted in each row, and 2 repetitions were set, with each material planted in one row in each repetition.

[0086] At the boll opening stage, 50 test bolls from the middle and upper parts of the cotton were randomly collected. After ginning, the cotton fibers without impurities were measured for fiber length (mm) using HVI9000. The fiber length of each variety was obtained by averaging the values of the two repetitions (Table 3).

[0087] Table 3 Fiber length of materials planted in Xinjiang in 2024

[0088]

[0089]

[0090]

[0091]

[0092] The phenotypic results show that the FL average of the Gbar_A06_93397381 (C) haplotype is 38.46 mm, and the FL average of the Gbar_A06_93397381 (T) haplotype is 39.31 mm, and the Gbar_A06_93397381 (T) is significantly longer than the Gbar_A06_93397381 (C) (p = 6.8 x 10 -05 ) (see Figure 9 ).

[0093] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. A SNP molecular marker related to fiber length of Gossypium barbadense, characterized in that, The SNP molecular marker is a DNA fragment with nucleotide sequence as shown in SEQ ID NO:1, and a C / T polymorphism exists at the 124th base of the DNA fragment; the genotype of the SNP molecular marker is analyzed to analyze the fiber length of the upland cotton: When the genotype of the SNP molecular marker is CC genotype, the sample to be tested has no fiber length advantage; when the genotype of the SNP molecular marker is TT genotype, the sample to be tested has fiber length advantage.

2. Application of the primer or kit for detecting the SNP molecular marker in claim 1 in the prediction and / or screening of the fiber length of the upland cotton; The kit comprises the primer; The primer is a primer pair with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:

3. The genotype of the SNP molecular marker is analyzed to analyze the fiber length of the upland cotton: When the genotype of the SNP molecular marker is CC genotype, the sample to be tested has no fiber length advantage; when the genotype of the SNP molecular marker is TT genotype, the sample to be tested has fiber length advantage.

3. Application of an upland cotton SNP gene chip in the prediction and / or screening of the fiber length of the upland cotton, wherein the upland cotton SNP gene chip comprises reagents for detecting the SNP molecular marker in claim 1; the genotype of the SNP molecular marker is analyzed to analyze the fiber length of the upland cotton: When the genotype of the SNP molecular marker is CC genotype, the sample to be tested has no fiber length advantage; when the genotype of the SNP molecular marker is TT genotype, the sample to be tested has fiber length advantage.

4. A method for analyzing fiber length of upland cotton by using the SNP molecular marker of claim 1, characterized in that, The method comprises the following steps: Extracting genomic DNA of the sample to be tested; Using the extracted genomic DNA of the sample to be tested as material, the genotype of the SNP molecular marker is analyzed, and the genotype of the SNP molecular marker is analyzed to analyze the fiber length of the upland cotton: When the genotype of the SNP molecular marker is CC genotype, the sample to be tested has no fiber length advantage; When the genotype of the SNP molecular marker is TT genotype, the sample to be tested has fiber length advantage.

5. The method of claim 4, wherein, The analysis of the genotype of the SNP molecular marker comprises resequencing or sequencing of a PCR amplification product.

6. The method of claim 5, wherein, The PCR amplification product is obtained by amplification with primers; the primers are a primer pair with nucleotide sequences as shown in SEQ ID NO:2 and SEQ ID NO:3.

Images