High-yield BGL aspergillus niger as well as construction method and application thereof

Abstract

The invention discloses high-yield BGL aspergillus niger and a construction method and application thereof.Aspergillus niger An-1 serves as a starting strain, a creA gene is accurately knocked out by means of a CRISPR-Cas9 gene editing technology aiming at a selected target site, a knockout strain delta creA is successfully constructed, and through morphological analysis and BGL enzyme activity evaluation, the high-yield BGL is obtained. The invention finds that the knockout of the creA gene enhances the BGL synthesis capability of the aspergillus niger, reduces the interference of glucose on the BGL secretion of the strain, shows a decarburization repression effect, and improves the BGL production capability of the aspergillus niger.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a high-yield BGL Aspergillus niger fungus and a construction method and application thereof. Background Art

[0002] Agricultural and forestry wastes are rich in cellulose, which is a linear polysaccharide composed of glucose units connected by β (1→4) bonds. Cellulose is hydrolyzed into glucose by endoglucanases, exoglucanases and β-glucosidases (BGL), which is a rich and cheap carbon source that can be used by microorganisms and has the potential to become a good substitute for starch fermentation raw materials. At present, lignocellulose hydrolysate is gradually used to produce bioenergy, bio-based chemicals and bio-based materials, such as ethanol, lactic acid, succinic acid, 3-hydroxypropionic acid, PLA, PHA, etc. Therefore, achieving efficient enzymatic hydrolysis of cellulose will open up the industrial chain of agriculture, forestry and biomanufacturing industries, promote the utilization of agricultural and forestry wastes, reduce carbon emissions and protect the environment, and reduce dependence on food-based raw materials. It will not compete with people for food, and can promote the cost reduction and efficiency improvement of the biomanufacturing industry and promote the green and sustainable development of the bioeconomy.

[0003] BGL can effectively relieve the inhibitory effect of cellobiose accumulation on endo- and exo-cellulase, and become the rate-limiting enzyme in the cellulose saccharification process. Many cellulose-degrading microorganisms in nature can produce β-glucosidase, among which Aspergillus niger has a high enzyme production level and good performance in degrading cellobiose, and is used as an important enzyme source component to enhance the cellobiose degradation ability of Trichoderma reesei cellulase. However, the gene transcription, protein translation, modification, folding and transport of Aspergillus niger are all subject to the restraint and balance of positive and negative transcription regulatory factors, which limits its enzyme production ability. The carbon metabolism repression-related regulatory factor CREA is widely present in many fungi such as Penicillium oxalicum, Trichoderma reesei, and Neurospora crassa, and mainly regulates the expression of cellulolytic enzymes through the carbon repression effect (Carbon Catabolite Repression, CCR). CREA is a C2H2-type zinc finger protein, whose DNA binding domain can specifically recognize and bind to specific DNA sequences in the promoter region of cellulase and other degradation enzyme genes, preventing the binding of RNA polymerase and the formation of transcription initiation complexes, thereby inhibiting the transcriptional expression of these genes. Sun Haiyan et al. cloned the DNA and cDNA sequences of the carbon source metabolism repressor gene creA from a strain of Aspergillus niger that produces starch saccharifying enzymes. The entire site is 1284 bp, does not contain introns, and encodes 427 amino acids. (Sun Haiyan, Li Juanhua, Liu Enshi et al. Cloning and sequence analysis of the creA gene of an Aspergillus niger. Food Research and Development: 2016, 37 (18): 158-162.) In Sclerotinia sclerotiorum and Aspergillus nidulans, CREA is constitutively expressed and exists in the cytoplasm. When cellulose is degraded into a large amount of glucose, CREA is transferred to the nucleus, thereby inhibiting the expression of cellulase genes. Studies have shown that in Penicillium oxalicum and Trichoderma reesei, the inactivation of CREA alleviates the carbon repression effect, increasing the enzyme activity of BGL from 1.8 U / mL to 2.5 U / mL and 1.4 U / mL to 2.0 U / mL, respectively. CreA has thus become an important regulatory target for optimizing the expression of cellulases such as BGL in filamentous fungi. In addition, in Neurospora crassa and Aspergillus nidulans cr Knockout of eA delayed spore formation, shortened hyphae length, and changed the colony morphology to a dense type, indicating that the transcription factor CreA is involved in the regulation of hyphae development.

[0004] Currently, the CRISPR-Cas9 system has been widely used as a gene editing tool, and has also been used in Aspergillus niger. However, how to cre The editing of the A gene to relieve its carbon repression effect and enhance the ability of Aspergillus niger to produce BGL still needs further study. Summary of the invention

[0005] To solve the above technical problems, the present invention provides a high-yield BGL Aspergillus niger and its construction method and application. A knockout strain Δ cre A was successfully constructed by using CRISPR-Cas9 gene editing technology. Through morphological analysis and BGL enzyme activity evaluation, it was found that cre the knockout of gene A enhanced the ability of Aspergillus niger to synthesize BGL and reduced the interference of glucose on the secretion of BGL by the strain, showing a carbon catabolite repression effect.

[0006] To achieve the above object, the present invention provides a high-yield BGL Aspergillus niger, and the high-yield BGL Aspergillus niger is a gene in which the cre A gene of Aspergillus niger An-1 is knocked out.

[0007] The present invention also provides a construction method of a high-yield BGL Aspergillus niger, including the following steps: (1) Obtaining Aspergillus niger An-1 as the starting strain; (2) Obtaining a CRISPR-Cas9 knockout plasmid targeting the cre A gene; (3) Obtaining a donor DNA fragment; (4) Transferring the CRISPR-Cas9 knockout plasmid and the donor DNA fragment into the starting strain to obtain the high-yield BGL Aspergillus niger.

[0008] Preferably, the construction method of the CRISPR-Cas9 knockout plasmid targeting the cre A gene in step (2) includes the following steps: (1) Introducing a target site: Selecting a target site and introducing the target site sequence to the 3` end of the 5S rRNA promoter sequence and the 5` end of the sgRNA sequence; (2) Constructing an sgRNA expression cassette: Overlap PCR to fuse the 5S rRNA promoter sequence containing the target site and the sgRNA sequence containing the target site; (3) Constructing a CRISPR-Cas9 knockout plasmid: The single enzyme digestion product of the vector plasmid and the sgRNA expression cassette are seamlessly cloned to obtain the CRISPR-Cas9 knockout plasmid.

[0009] More preferably, the target site sequence in step (2) is SEQ ID NO:1.

[0010] More preferably, the molar ratio of the single enzyme digestion product to the sgRNA expression cassette in step (3) is 1:2-3.

[0011] Even more preferably, the molar ratio of the single enzyme digestion product to the sgRNA expression cassette is 1:2.

[0012] Preferably, the method for constructing the donor DNA fragment described in step (3) includes the following steps: (1) Select cre The sequences at both ends of the A gene target site as homologous arms, and amplify the upper and lower homologous arms; (2) Perform fusion PCR on the upper and lower homologous arms to obtain the donor DNA fragment.

[0013] More preferably, the length of the homologous arm described in step (1) is 300 - 1000 bp.

[0014] Even more preferably, the length of the homologous arm is 500 bp.

[0015] Preferably, the mass ratio of the CRISPR-Cas9 knockout plasmid to the donor DNA fragment described in step (4) is 1:1 - 2.

[0016] More preferably, the mass ratio of the CRISPR-Cas9 knockout plasmid to the donor DNA fragment is 1:1.

[0017] The present invention also provides an application of the Aspergillus niger strain with high BGL production, which is the application of the above-mentioned Aspergillus niger strain with high BGL production in the fermentation production of BGL.

[0018] Preferably, the concentration of glucose in the medium during the fermentation production is 1 - 9 g / L.

[0019] The beneficial effects of the present invention are as follows: 1. Utilizing the fusion PCR technology simplifies the construction process of CRISPR-Cas9, constructs a gene editing system capable of precisely knocking out cre the A gene, and realizes the targeted knockout of the A gene in the non-model Aspergillus niger strain An-1, obtaining the Aspergillus niger deletion mutant strain Δ cre A, which increases the BGL activity of the Δ cre A strain to 1.5 - 1.8 times that of the wild-type strain, and at the same time shows a reduced carbon catabolite repression effect. cre A strain to 1.5 - 1.8 times that of the wild-type strain, and at the same time shows a reduced carbon catabolite repression effect.

[0020] 2. The obtained Aspergillus niger deletion mutant strain Δ cre A has an increased BGL secretion amount compared with the wild-type strain, can be used to promote the efficient enzymatic hydrolysis of cellulose, promote the utilization of agricultural and forestry waste, reduce carbon and environmental protection. In addition, it helps to reduce the dependence on food-based raw materials, promote cost reduction and efficiency increase in the bio-manufacturing industry, and promote the green and sustainable development of the bio-economy. Description of the Drawings

[0021] Figure 1Schematic diagram of the construction of the CRISPR-Cas9 targeted knockout plasmid and PCR detection map in Example 1. In the figure, A is the schematic diagram of the construction of the sgRNA expression cassette, B is the schematic diagram of the construction of the CRISPR-Cas9 targeted knockout plasmid, C is the gel electrophoresis diagram of the sgRNA expression cassette, and D is the colony PCR gel electrophoresis diagram of the CRISPR-Cas9 targeted knockout plasmid.

[0022] Figure 2 Schematic diagram of the construction of the donor DNA fragment and PCR detection map in Example 2. In the figure, A is the schematic diagram of the construction of the donor DNA fragment, and B is the fusion PCR gel electrophoresis diagram of the donor DNA fragment.

[0023] Figure 3 For the selection of transformants in Example 3, in the figure, A is the co-transformation system, B is the knockout schematic diagram, C is the PCR gel electrophoresis diagram of the knockout effect, and D is the sequencing result diagram of the knockout effect.

[0024] Figure 4 For the morphological characteristics of the knockout strain in Example 4, in the figure, A is the comparison diagram of the strain morphology, and B is the comparison diagram of the size of the black transparent circle.

[0025] Figure 5 For the fermentation and enzyme activity detection results of the knockout strain in Example 5, in the figure, A is the line graph of BGL enzyme activity with cellobiose as the substrate, B is the line graph of BGL enzyme activity with p-nitrophenyl-α-D-glucopyranoside (p-NPG) as the substrate, and C is the electrophoresis diagram of the extracellular protein secretion in the fermentation broth.

[0026] Figure 6 For the effect of different glucose concentrations on the enzyme activity of the knockout strain in Example 6, in the figure, A is the line graph of BGL enzyme activity at 4 days of fermentation, B is the line graph of BGL enzyme activity at 5 days of fermentation, C is the line graph of BGL enzyme activity at 6 days of fermentation, and D is the line graph of BGL enzyme activity at 7 days of fermentation.

[0027] Figure 7 Line graph showing the effect of the length of the homologous arm on the editing efficiency in Comparative Example 1. Detailed implementation manners

[0028] The technical solutions of the present invention will be further explained and illustrated below with reference to the accompanying drawings and specific embodiments. It should be noted that the following embodiments are only the preferred embodiments of the present invention and should not be construed as limiting the present invention. The protection scope of the present invention shall be subject to the content recorded in the claims. Modifications and substitutions made by those skilled in the art to the technical solutions of the present invention without creative efforts all fall within the protection scope of the present invention.

[0029] Strains and plasmids: Aspergillus niger strain An-1: It is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: M2024768.

[0030] Escherichia coli DH5α: Purchased from Nanjing Novoprotein Scientific Co., Ltd.; pFC332 plasmid: Purchased from Hunan Fenghui Biotechnology Co., Ltd.; pUC-sgRNA: Purchased from Nanjing Genewiz Biotechnology Co., Ltd.; All primers were synthesized by Shanghai Sangon Biotech Co., Ltd.; Culture media: PDA medium: Potato, 200 g / L; Glucose, 20 g / L. Hygromycin B was added when screening for transformants, and the final concentration was 300 μg / mL.

[0031] Esculin solid medium: Sodium carboxymethyl cellulose, 10 g / L; Esculin, 3 g / L; Ferric ammonium citrate, 5 g / L; (NH4)2SO4, 2 g / L; KH2PO4, 1 g / L; MgSO4·7H2O, 0.5 g / L; Yeast extract powder, 1 g / L; Agar 20 g / L; Add water to 1 L, natural pH.

[0032] CD hypertonic solid medium: Sucrose, 342 g / L; NaNO3, 3 g / L; KCl, 2 g / L; MgSO4·7H2O, 0.5 g / L; K2HPO4·3H2O, 1 g / L; FeSO4·7H2O, 0.01 g / L; Agar, 20 g / L; Add water to 1 L, pH 5.5.

[0033] Liquid growth medium: Yeast extract powder, 6 g / L; Peptone, 3 g / L; Glucose, 20 g / L; KH2PO4, 0.5 g / L; (NH4)2SO4, 0.5 g / L; MgSO4·7H2O, 1 g / L; Add water to 1 L, used for culturing bacteria when extracting genomic DNA.

[0034] Seed liquid medium: Sodium carboxymethyl cellulose, 15 g / L; (NH4)2SO4, 1.6 g / L; KH2PO4, 1 g / L; MgSO4·7H2O, 0.5 g / L; Yeast extract powder, 1 g / L; Mandels trace elements, 0.1 mL / L; Tween 80, 3 mL / L; Add water to 1 L.

[0035] Fermentation medium: (NH4)2SO4 10 g / L, urea 2.5 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 1 g / L, sophoroside compound 7 g / L, add water to 1 L; CaCl2·2H2O, 1.5 g / L (added about 48 h after fermentation).

[0036] Reagents: Restriction endonuclease Bgl Type II was purchased from NEB; Plasmid extraction kit, PCR product purification kit, 2×Rapid Taq Master Mix, 2×Phanta Max Master Mix (Dye Plus), DL5000 DNA Marker, Ultra Gel Red (10,000×) were purchased from Nanjing Novoprotein; Agarose gel was purchased from Shanghai Sangon Biotech Co., Ltd.; SDS-PAGE gel rapid preparation kit, 50×TAE, Coomassie brilliant blue ultra-fast staining solution were purchased from Beyotime Biotechnology; Seamless cloning kit was purchased from Douyou Biotechnology; Genomic extraction kit, hygromycin, snailase and lysozyme were purchased from Beijing Solarbio Science & Technology Co., Ltd.; Cellulase was purchased from Macklin Co., Ltd.; Glucose assay kit was purchased from Nanjing Jiancheng Co., Ltd.

[0037] Example 1 Construction of gene knockout vector (1) Upload the creA gene sequence (gene ID is XM_001399482.3) to the CHOPCHOP (http: / / chopchop.cbu.uib.no / ) website for online design, select GATCGCGTAAGCAGACAAGG (predicted efficiency is 71.34%; no self-complementary formation of special structures, no mismatches) as the target site, and the sequence is SEQ ID NO: 1; (2) Using the target site as the homologous arm, design primers for the 5S rRNA promoter and sgRNA sequence, and amplify the 5S rRNA promoter containing the target site using Aspergillus niger genomic DNA as the template, and amplify the sgRNA sequence containing the target site using the pUC-sgRNA plasmid as the template. The primer sequences are shown in Table 1; (3) Recover and purify the amplified 5S rRNA promoter containing the target site and the sgRNA sequence containing the target site, mix them at a molar ratio of 1:1 as the template, and perform fusion PCR using 5S rRNA-F / sgRNA-R as primers, and purify to obtain the sgRNA expression cassette containing the target site ( Figure 1 A); (4) Use Bgl Type II restriction endonuclease to digest the pFC332 plasmid, and purify to obtain the digestion product; (5) Mix the digested product with the sgRNA expression cassette containing the target site at a mass ratio of 20:3, and perform seamless cloning by reacting at 50 °C for 15 min; (6) Transform the seamless cloning product into Escherichia coli, screen by ampicillin resistance, verify by colony PCR, and sequence to obtain the CRISPR-Cas9 targeted knockout plasmid ( Figure 1 B) and the Escherichia coli strain containing the CRISPR-Cas9 targeted knockout plasmid, where the primers for colony PCR are pFC332-F / R, and the sequences are shown in Table 1.

[0038] Table 1 Primer sequence list

[0039] The results are as Figure 1 shown. The length of the sgRNA expression cassette containing the target site is 559 bp, of which the 5S rRNA promoter is 457 bp, and the length of the target site is 20 bp ( Figure 1 C); the CRISPR-Cas9 targeted knockout plasmid contains the sgRNA expression cassette ( Figure 1 D).

[0040] Example 2 Construction of donor DNA fragment (1) Using the Aspergillus niger genome without selection markers as a template, select cre DNA fragments of 500 bp each on the left and right ends of the target site of gene A as homologous arms; (2) Amplify the upper and lower homologous arms using gtsy-F / R and gtxy-F / R as primers respectively, and purify to obtain the upper and lower homologous arm amplification products; the primers are shown in Table 2; (3) Mix the upper and lower homologous arm amplification products at a molar ratio of 1:1 as a template, and then perform fusion PCR using gtsy-F / gtxy-R as primers, and recover and purify to obtain the donor DNA fragment.

[0041] Table 2 Primer sequence list

[0042] The results are as Figure 2 shown. The length of the donor DNA fragment is only 1000 bp, which is consistent with the designed fragment size.

[0043] Example 3 Protoplast transformation and transformant screening (1) Use 3 μg each of the CRISPR-Cas9 targeted knockout plasmid prepared in Example 1 and the donor DNA fragment prepared in Example 2 as the templates to be transformed; (2) Mix the template to be transformed with 100 μL of protoplasts of Aspergillus niger strain, and perform co-transformation under the mediation of PEG. After the co-transformation is completed, spread the bacterial solution on a hygromycin-resistant CD hypertonic solid culture plate, and incubate it upside down at 28 °C until single colonies grow, which are the transformants; (3) Pick a single colony and inoculate it on a hygromycin-resistant PDA solid plate, and culture it at 28 °C until hyphae grow; (4) Pick an appropriate amount of hyphae and place them in a centrifuge tube containing 45 µL of 2M NaOH solution, shake to disperse the hyphae, react at 95 °C for 10 min, after cooling, add 5 µL of 2M Tris-HCl solution, shake to neutralize the acid and base, and centrifuge at 12000 r / min for 10 min; (5) Pipette 2 µL of the supernatant as a template, and perform PCR detection with creAYZ-F / gtxy-R as primers cre to check the knockout situation of gene A, and select the product with the correct band size for sequencing.

[0044] The results are as Figure 3 shown. The band length of the unknocked-out cre gene A is 2.1 kb, while the band length of the knocked-out cre gene A is only 1.1 kb ( Figure 3 C). After sequencing confirmation, cre gene A was successfully knocked out ( Figure 3 D), and this knocked-out strain was named Δ cre A.

[0045] Example 4 Morphological Characteristics of the Knocked-out Strain (1) Take the knocked-out strain Δ cre A obtained in Example 3, inoculate it on a PDA solid medium, culture it at 28 °C until rich spores grow, then add 0.9% NaCl solution to rinse the medium to obtain a suspension, and filter the suspension to obtain a spore suspension; (2) Pipette 1 μL of the freshly prepared spore suspension and spot it on a PDA solid medium, and culture it statically at 28 °C, and record the colony morphological changes at 48 h, 60 h, and 72 h respectively; (3) Take the wild-type Aspergillus niger strain to prepare a spore suspension and spot it on a PDA solid medium, and culture it statically at 28 °C to record the colony morphological changes; (4) Take the spore suspensions of the knocked-out strain Δ cre A and the wild-type strain and spot them on a esculin solid plate, and culture them statically at 28 °C, and measure the diameters of the colonies and the black halos at 48 h, 60 h, and 72 h respectively.

[0046] The results showed that after 48 h of cultivation, the growth rate of the wild-type strain was relatively fast, and the black spores formed were denser; in contrast, the colony surface of the knockout strain Δ cre A began to show wrinkles, presenting a wheel-like structure, and accompanied by the production of a small amount of black spores. It is worth noting that although the diameter of the wild-type strain increased, its overall morphology showed no obvious abnormality. After 72 h of cultivation, the colony diameter of the wild-type strain was significantly larger than that of the knockout strain Δ cre A, showing a flat and divergent growth on the plate, while the knockout strain Δ cre A formed a protrusion on the surface of the PDA plate, and as the colony grew, its diameter change tended to level off ( Figure 4 A).

[0047] Esculin is decomposed into glucose and esculetin under the action of BGL, and the latter reacts with ammonium ferric citrate Fe 2+ in the medium to form a black compound, making the medium appear black. The larger the ratio of the black transparent circle to the strain diameter, the stronger the ability of the strain to secrete BGL. By inoculating the knockout strain Δ cre A and the wild-type strain on the esculin solid plate respectively and observing their growth conditions, the results showed that: after 48 h of cultivation, the ratio of the black transparent circle to the strain diameter of the wild-type strain was 1.82, while that of Δ cre A was 2.5; at 60 h, the ratios were 1.66 and 2.32 respectively; at 72 h, the ratios were 1.54 and 2.05 respectively ( Figure 4 B). The above research shows that there are differences in the BGL secretion ability between the knockout strain Δ cre A and the wild-type strain. Therefore, cre the knockout of A affected the cell morphology and enzyme production performance of Aspergillus niger.

[0048] Example 5 Fermentation of the knockout strain and determination of BGL enzyme activity (1) Respectively take the spore suspension of the knockout strain Δ cre A and the spore suspension of the wild-type strain, count them using a hemocytometer, and inoculate about 1*10 7 spores into the seed medium, and culture them at 30 °C and 200 r / min on a shaker for 24 h to obtain the bacterial liquid; (2) Transfer the bacterial liquid to the fermentation medium induced to produce enzymes with 0.7% sophoroside compound at an inoculation amount of 10%, and culture it at 30 °C and 200 r / min on a shaker; (3) On days 3 - 7 of cultivation, the fermentation broth was taken daily. After centrifugation at 12,000 r / min for 10 min, the supernatant was collected, and the enzyme activity of β-glucosidase (BGL) was determined using two substrates, cellobiose and p-nitrophenyl-α-D-glucopyranoside (p-NPG). The detection method referred to "Expression and Characteristics of two glucose-tolerant gh1 β-glucosidases from Actinomadura amylolytica YIM 77502T for promoting cellulose degradation" (Yin, Y.-R., et al. Frontiers in Microbiology, 2018, 9:03149.).

[0049] The results are as Figure 5 shown: Δ cre The enzyme activity of A was always higher than that of the wild strain. On the 7th day, the BGL enzyme activity of Δ cre A was 9.32 U / mL, while that of the starting strain was only 6.47 U / mL. The BGL enzyme activity of Δ cre A increased by nearly 1.5 times compared with the wild strain ( Figure 5 A). When p-nitrophenyl-α-D-glucopyranoside was used as the substrate to determine the BGL enzyme activity, the trend was the same as that when cellobiose was used as the substrate. The enzyme activity of Δ cre A was always higher than that of the wild strain. On the seventh day of fermentation, the enzyme activity of Δ cre A was 6.30 U / mL, while that of the starting strain was only 3.51 U / mL. The BGL enzyme activity of Δ cre A increased by nearly 1.8 times compared with the wild strain ( Figure 5 B). The fermentation broth on the seventh day of fermentation was taken, and after treatment, SDS-PAGE was performed. The results showed that the extracellular protein secretion of Δ cre A increased significantly compared with the wild-type strain, and a band of about 120 kD appeared between 95 - 150 kD ( Figure 5 C), which was consistent with the size of BGL, indicating that the BGL secretion of Δ cre A increased significantly compared with the wild-type strain.

[0050] Example 6 Effect of knocking out cre A gene on carbon catabolite repression (1) Spore suspensions of the knockout strain Δ cre A and the wild-type strain were taken respectively, counted using a hemocytometer, and about 1*10 7Inoculate the seed medium with a spore inoculum, and culture it with shaking at 30 °C and 200 r / min for 24 h to obtain a bacterial solution; (2) Transfer the bacterial solution to a fermentation medium induced to produce enzymes with 0.7% sophoroside compound at an inoculum size of 10%, and culture it with shaking at 30 °C and 200 r / min; 1, 3, 5, 7, and 9 g / L of glucose are respectively added to the fermentation medium; (3) Take the fermentation broth on the 4th - 7th day of culture, centrifuge it at 12000 r / min for 10 min, and take the supernatant. Determine the enzyme activity of β-glucosidase (BGL) with two substrates, cellobiose and p-nitrophenyl-α-D-glucopyranoside (p-NPG). The detection method refers to "Expression and Characteristics of two glucose-tolerant gh1 β-glucosidases from Actinomadura amylolytica YIM 77502T for promoting cellulose degradation" (Yin, Y.-R., et al. Frontiers in Microbiology, 2018, 9:03149.).

[0051] The results are as Figure 6 shown: Compared with the knockout strain Δ cre A, the wild strain is more affected by glucose during fermentation, and when the enzyme activity of BGL is measured with two substrates respectively, the change trends of its enzyme activity are basically the same. In the middle stage of fermentation (4 - 6 d), the enzyme activity of the starting strain decreased significantly with the increase of glucose, and at a high concentration of 9 g / L glucose, the corresponding enzyme activity could not be detected; in the late stage of fermentation (7 d), with the consumption of glucose, the carbon catabolite repression effect was alleviated, resulting in a recovery of the enzyme activity level. In contrast, the enzyme activity level of the knockout strain Δ cre A was always higher than that of the starting strain at different glucose concentrations, and the decreasing trend of enzyme activity was relatively gentle.

[0052] Comparative Example 1 The methods and steps are the same as those in Examples 1 - 3, only changing the homologous arm lengths to 100 bp, 300 bp, and 1000 bp, respectively constructing donor DNA fragments, and then co-transforming them with the CRISPR-Cas9 knockout plasmid into Aspergillus niger An-1. Screen for the transformation and count the editing efficiency. The results are as Figure 7As shown, when the homologous arm length of the donor fragment is 100 bp, the knockout strain of creA cannot be obtained; when the homologous arm length reaches 300 bp, the editing efficiency is 3%; when the homologous arm lengths reach 500 bp and 1000 bp, the editing efficiency reaches 33-36%. An overly long homologous arm length causes difficulty in constructing the donor fragment. Therefore, a donor fragment containing a 500-bp homologous arm is preferably used to construct Δ cre A knockout strain.

Claims

1. A high-yield BGL Aspergillus niger, characterized in that: The Aspergillus niger with high BGL production is Aspergillus niger An-1 cre A is the gene that has been knocked out.

2. A method for constructing a high-yield BGL Aspergillus niger, characterized in that: The steps include: (1) Obtaining Aspergillus niger An-1 as the starting strain; (2) Obtaining targeted cre CRISPR-Cas9 knockout plasmid for gene A; (3) Obtaining donor DNA fragments; (4) The CRISPR-Cas9 knockout plasmid and the donor DNA fragment are transferred into the starting strain to obtain the Aspergillus niger with high BGL production.

3. The construction method according to claim 2, characterized in that: Step (2) of targeting cre The method for constructing a CRISPR-Cas9 knockout plasmid for gene A includes the following steps: (1) Introducing the target site: Select the target site and introduce the target site sequence into the 3' end of the 5SrRNA promoter sequence and the 5' end of the sgRNA sequence; (2) Construction of sgRNA expression cassette: Overlap PCR fusion of the 5SrRNA promoter sequence containing the target site and the sgRNA sequence containing the target site; (3) Construction of CRISPR-Cas9 knockout plasmid: The single enzyme digestion product of the vector plasmid and the sgRNA expression cassette are seamlessly cloned to obtain the CRISPR-Cas9 knockout plasmid.

4. The construction method according to claim 3, characterized in that: The target site sequence described in step (2) is SEQ ID NO:

1.

5. The construction method according to claim 3, characterized in that: The molar ratio of the single enzyme digestion product to the sgRNA expression cassette in step (3) is 1:2-3.

6. The construction method according to claim 2, characterized in that: The method for constructing the donor DNA fragment described in step (3) comprises the following steps: (1) Selection cre The sequences at both ends of the target site of gene A are used as homology arms, and the upper and lower homology arms are amplified; (2) Perform Overlap PCR on the upper and lower homologous arms to obtain the donor DNA fragment.

7. The construction method according to claim 6, characterized in that: The length of the homology arm in step (1) is 300-1000 bp.

8. The construction method according to claim 2, characterized in that: The mass ratio of the CRISPR-Cas9 knockout plasmid and the donor DNA fragment described in step (4) is 1:1-2.

9. An application of Aspergillus niger with high BGL production, characterized in that: Use of the high-BGL-yielding Aspergillus niger described in claim 1 or the high-BGL-yielding Aspergillus niger prepared by the construction method according to any one of claims 2 to 8 in the fermentation production of BGL.

10. The use according to claim 9, characterized in that: The concentration of glucose in the culture medium during the fermentation production is 1-9 g / L.

Images