A Bacillus velez engineered bacterial consortium for controlling tomato bacterial wilt under salt stress and its application

By constructing the engineering flora of the combination of three TnYLB-1 transposons of Bacillus Bacillus T-5, the problem of prevention and control of tomato bacterium wilt under salt stress was solved, and the abundance of beneficial microorganisms was significantly improved and pathogenic bacteria were reduced under salt stress conditions, and the occurrence of bacterium wilt was effectively prevented and controlled.

CN120192901BActive Publication Date: 2025-08-12SANYA INSTITUTE OF NANJING AGRICULTURAL UNIVERSITY +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510672305.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-08-12
Estimated Expiration
2045-05-23

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively prevent and control tomato green wilt under salt stress. Traditional chemical control methods have problems with environmental pollution and pathogen resistance. The prevention and control effect of a single beneficial microorganism under salt stress is unstable.

Method used

Three TnYLB-1 transposons of Bacillus Veles T-5 were constructed to randomly insert the engineered bacterial flora of the mutant strains T5M1, T5M2 and T5M3. The tomato rhizosphere was applied by the root irrigation method to improve the yield of antagonistic substances, biomass and iron carriers, and enhance the biodefense efficacy under salt stress.

Benefits of technology

It significantly improved the abundance of Bacillus vellis in the rhizosphere of tomatoes, reduced the abundance of vellis vellis, effectively prevented and controlled the occurrence of vellis vellis vellis under salt stress, and improved the stability and efficiency of prevention and control effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192901B_ABST
    Figure CN120192901B_ABST
Patent Text Reader

Abstract

The present invention discloses an engineered bacterial group of Bacillus velez for preventing and controlling tomato bacterial wilt under salt stress and its application, which comprises three strains of Bacillus velez ( Bacillus velezensis ) T-5 is composed of TnYLB-1 transposon insertion mutants, and the insertion sites are oh my 、 btr and ykcB The strains are deposited with GDMCC NO: 66119, GDMCC NO: 66120, and GDMCC NO: 66121, respectively. Compared with wild-type T-5, this engineered bacterial consortium significantly increased the abundance of beneficial Bacillus amyloliquefaciens in the rhizosphere and reduced the abundance of the pathogen Bacillus wilt, demonstrating its ability to effectively control tomato bacterial wilt under salt stress.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of microorganisms, and specifically relates to three TnYLB-1 transposon random insertion mutants T5M1 (ndh), T5M2 (btr) and T5M3 (ykcB) of Bacillus Velez T-5 that have antagonistic effects on Ralstonia solanacearum (abbreviated as "Ralstonia solanacearum"). The present invention relates to an engineered Bacillus Velez microbial population for preventing and controlling tomato bacterial wilt under salt stress, and the application of the engineered Bacillus Velez microbial population for preventing and controlling tomato bacterial wilt under salt stress. Background Art

[0002] Crop growth often faces the simultaneous threat of multiple soil stress factors, severely hindering the expansion of food production. Soil stress factors are numerous and can be divided into two categories: one caused by abiotic factors, such as salt stress caused by excessive salt concentration; the other caused by soil pathogens, such as bacterial wilt caused by the soil-borne pathogen Ralstonia solanacearum. However, current research has largely focused on the mechanisms and control strategies of a single stress, overlooking the coexistence of multiple stress factors.

[0003] Tomato (Solanum lycopersicum L.) is an economically important vegetable crop. Its production often faces the combined stresses of bacterial wilt and salt stress. Bacterial wilt occurs in most parts of my country, with the southern region being particularly severe. Traditional control methods primarily rely on chemical fungicides, but these methods are plagued by high costs, environmental pollution, and the development of drug resistance in pathogens. Biological control, as an environmentally friendly and sustainable approach, has garnered widespread attention. Numerous studies have demonstrated that beneficial microorganisms in the rhizosphere, such as Bacillus velezensis, can effectively control tomato bacterial wilt. Bacillus velezensis can inhibit the proliferation of the pathogen by producing secondary metabolites and competing for ecological niches. However, the effectiveness of single beneficial microorganisms in biocontrol is often inconsistent, as abiotic stresses in the soil, such as salt stress, limit the function of these beneficial bacteria.

[0004] Engineering and constructing synthetic beneficial bacterial communities are effective technical means to enhance and stabilize the functions of beneficial bacteria. Engineering involves the use of molecular biology techniques to modify the DNA sequences within a microbial genome, enabling it to perform its intended function. Current studies have used random transposon insertion to create beneficial microorganisms with enhanced biocontrol properties, effectively reducing the incidence of disease. Synthetic bacterial communities primarily combine multiple strains of beneficial microorganisms. Compared to single strains, synthetic communities can perform complex functions that individual strains cannot, and they possess greater stability and resistance to environmental perturbations.

[0005] Therefore, it is urgent to combine the advantages of engineering modification and synthetic microbial community construction, use the mutant strains obtained by engineering beneficial bacteria for synthetic microbial community construction, and use engineered microbial communities to effectively prevent and control the occurrence of tomato bacterial wilt under salt stress. Summary of the Invention

[0006] Because bacterial wilt and salt stress coexist, beneficial microorganisms often struggle to proliferate in large numbers in the soil and achieve the desired control effects. This study used the beneficial microorganism Bacillus velezensis T-5 as the target and generated three mutant strains using random insertion of the TnYLB-1 transposon. These mutants are named Bacillus velezensis T5M1, Bacillus velezensis T5M2, and Bacillus velezensis T5M3, with insertion sites at ndh, btr, and ykcB, respectively. Experiments revealed that under salt stress, compared with the wild-type strain T-5, T5M1 significantly increased its antagonist and siderophore production, T5M2 significantly increased its siderophore production, and T5M3 significantly increased its antagonist production and biomass. The engineered bacterial consortium constructed from the three strains significantly increased its antagonist production, biomass, and siderophore production under salt stress compared with the wild-type strain. In greenhouse pot experiments, root irrigation with the engineered consortium significantly increased the abundance of Bacillus velezensis in the tomato rhizosphere and reduced the abundance of Ralstonia solanacearum, effectively inhibiting the occurrence of tomato bacterial wilt under salt stress. This suggests that constructing an engineered consortium composed of three randomly inserted mutant strains of the TnYLB-1 transposon of Bacillus velezensis T-5, T5M1, T5M2, and T5M3, can enhance the biocontrol efficiency of beneficial microorganisms under salt stress and prevent the occurrence of tomato bacterial wilt under salt stress.

[0007] The present invention aims to provide three TnYLB-1 transposon randomly inserted mutants T5M1, T5M2 and T5M3 of Bacillus velezensis T-5 and the combined application of the mutants T5M1, T5M2 and T5M3 for preventing and controlling tomato bacterial wilt under salt stress.

[0008] The purpose of the present invention is achieved through the following technical solutions:

[0009] In a first aspect, the present invention provides the following strains:

[0010] Bacillus velezensis mutant strain 1, named: Bacillus velezensis T5M1, classified as: Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being ndh. It was deposited in Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, with the culture collection number: GDMCC NO: 66119, and is subsequently referred to as mutant strain T5M1.

[0011] Bacillus velezensis mutant strain 2, named: Bacillus velezensis T5M2, classified as: Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being btr. It was deposited in the Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, with the culture collection number: GDMCC NO: 66120, and is subsequently referred to as mutant strain T5M2.

[0012] Bacillus velezensis mutant strain 3, named: Bacillus velezensis T5M3, classified as: Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being ykcB. It was deposited in the Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, with the culture collection number: GDMCC NO: 66121, and is subsequently referred to as mutant strain T5M3.

[0013] In a second aspect, the present invention provides an engineered bacterial population for preventing and controlling tomato bacterial wilt under salt stress, wherein the engineered bacterial population is composed of at least two of the mutant strain T5M1, the mutant strain T5M2, and the mutant strain T5M3.

[0014] In a third aspect, the present invention provides the use of the aforementioned strains and engineered bacterial populations for preventing and controlling tomato bacterial wilt under salt stress.

[0015] In a fourth aspect, the present invention provides the use of the strains and engineered bacterial populations described above in the preparation of microbial preparations for preventing and controlling tomato bacterial wilt under salt stress.

[0016] In a specific embodiment, the microbial preparation is a live bacterium of the strain or engineered bacterial group described above, or a microbial preparation made from the engineered bacterial group described above.

[0017] In a more specific embodiment, the application is carried out by applying the microbial agent prepared above into the rhizosphere of tomatoes by root irrigation.

[0018] In a fifth aspect, the present invention provides a microbial agent comprising the engineered bacterial population described above.

[0019] In a specific embodiment, the volume ratio of mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 in the microbial agent is 1:1:1.

[0020] In a sixth aspect, the present invention provides the use of the microbial agent described above for preventing and controlling tomato bacterial wilt under salt stress.

[0021] In a specific implementation embodiment, the application includes the step of applying the microbial agent described above into the rhizosphere of tomatoes by root irrigation.

[0022] In a seventh aspect, the present invention provides a method for preventing and controlling tomato bacterial wilt under salt stress using the aforementioned engineered bacterial community, wherein the aforementioned engineered bacterial community is applied to the rhizosphere of tomatoes by root irrigation, with a concentration of 1×10 6 ~10 8 CFU / g soil of engineered bacterial flora.

[0023] In a specific embodiment, the method comprises the following specific steps:

[0024] (1) The mutant strain T5M1, the mutant strain T5M2 and the mutant strain T5M3 were cultured to obtain the mutant strain T5M1 bacterial solution, the mutant strain T5M2 bacterial solution and the mutant strain T5M3 bacterial solution, respectively, and then the mutant strain T5M1 bacterial solution, the mutant strain T5M2 bacterial solution and the mutant strain T5M3 bacterial solution were mixed in a volume ratio of 1:1:1 to obtain a bacterial solution;

[0025] (2) Apply the mixed bacterial solution obtained in step (1) into the rhizosphere of tomatoes by root irrigation.

[0026] The concentration of the mutant strain T5M1 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0027] The concentration of the mutant strain T5M2 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0028] The concentration of the mutant strain T5M3 bacterial solution is 1×10 6 ~1×10 8 CFU / g soil, preferably 1×10 7 CFU / g soil.

[0029] The mutant bacterial solution is prepared by the following method:

[0030] The mutant strain T5M1 was activated using LB solid medium supplemented with 10 μg / mL kanamycin. A single colony of the mutant strain T5M1 was picked and placed in LB liquid medium and cultured at 37°C and 170-180 rpm for 18-40 h to obtain a bacterial suspension of the mutant strain T5M1.

[0031] The mutant strain T5M2 was activated using LB solid medium supplemented with 10 μg / mL kanamycin. A single colony of the mutant strain T5M2 was picked and placed in LB liquid medium and cultured at 37°C and 170-180 rpm for 18-40 h to obtain a bacterial suspension of the mutant strain T5M2.

[0032] The mutant strain T5M3 was activated using LB solid medium supplemented with 10 μg / mL kanamycin. A single colony of the mutant strain T5M3 was picked and placed in LB liquid medium and cultured at 37°C and 170-180 rpm for 18-40 h to obtain a bacterial suspension of the mutant strain T5M3.

[0033] The tomato bacterial wilt disease is caused by the soil-borne pathogen Ralstonia solanacearum.

[0034] Seven days after healthy tomato seedlings with uniform growth were transplanted into seedling pots, the engineered bacterial solution was applied to the rhizosphere soil of the plants by root irrigation.

[0035] Beneficial effects of the present invention:

[0036] The present invention uses an engineered bacterial consortium constructed by randomly inserting three TnYLB-1 transposons of Bacillus velez T-5 into mutant strains T5M1, T5M2 and T5M3 for the prevention and control of tomato bacterial wilt under salt stress. Under salt stress, the biocontrol properties of the engineered bacterial consortium, such as antagonistic substances, biomass and siderophores, are significantly improved, the abundance of Bacillus velez in the tomato rhizosphere is significantly increased, and the abundance of Ralstonia solanacearum is significantly decreased, thereby effectively preventing and controlling the occurrence of tomato bacterial wilt under salt stress.

[0037] Biodeposit Information:

[0038] Bacillus velezensis mutant strain 1, named: Bacillus velezensis T5M1, classified as: Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being ndh. It was deposited in Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the culture collection number is: GDMCC NO: 66119.

[0039] Bacillus velezensis mutant strain 2, named: Bacillus velezensis T5M2, classified as Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being btr. It was deposited in Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the culture collection number is: GDMCC NO: 66120.

[0040] Bacillus velezensis mutant strain 3, named: Bacillus velezensis T5M3, classified as Bacillus velezensis, is a TnYLB-1 transposon random insertion mutant strain of Bacillus velezensis T-5, with the insertion site being ykcB. It was deposited in Guangdong Provincial Microbiological Culture Collection on April 11, 2025, address: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou City, and the culture collection number is: GDMCC NO: 66121. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 The strain morphologies of Bacillus velez T-5 and its TnYLB-1 transposon insertion mutants T5M1, T5M2, and T5M3.

[0042] Figure 2 The biocontrol characteristics of Bacillus velez T-5 transposon insertion mutants under salt stress, Figure 2 Panel A: evaluation of antagonistic ability; Figure 2 Panel B: biomass evaluation; Figure 2 Panel C: Siderophore production capacity. Comparison between engineered strains and wild-type strains was performed using a t-test: **, P < 0.01; *, P < 0.05. All error bars represent the standard error of the mean.

[0043] Figure 3 The effect of engineered bacterial flora on the prevention and control of tomato bacterial wilt under salt stress, Figure 3 Figure A: Disease status of tomato plants; Figure 3 Figure B in the figure; disease index; Figure 3 Panel C: Abundance of pathogenic Ralstonia solanacearum in the rhizosphere; Figure 3 Panel D: Abundance of beneficial Bacillus amyloliquefaciens in the rhizosphere. Comparisons between treatments were performed using a t-test: ***, P < 0.001; **, P < 0.01; *, P < 0.05. All error bars represent the standard error of the mean. DETAILED DESCRIPTION

[0044] The technical solution of the present invention will be further described below in conjunction with specific embodiments. Reagents or instruments used without manufacturer indicated are considered to be conventional products that can be purchased on the market.

[0045] LB liquid medium: peptone 10.0 g / L, yeast powder 5.0 g / L, NaCl 10.0 g / L, adjust the pH to 7.2-7.4, and autoclave at 115°C for 30 min.

[0046] LB solid medium: Add 20 g / L agar to LB liquid medium and sterilize at 115°C for 30 min.

[0047] NCM medium: K2HPO4 17.4 g / L, NaCl 11.6 g / L, glucose 5.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, trisodium citrate 0.3 g / L, MgSO4·7H2O 0.05 g / L, sorbitol 91.1 g / L, adjusted to pH 7.2, sterilized at 115°C for 30 min.

[0048] NA medium: glucose 10.0 g / L, peptone 5.0 g / L, beef extract 3.0 g / L, yeast powder 0.5 g / L, adjust the pH to 7.2-7.4, and autoclave at 115°C for 30 min.

[0049] NA solid medium: Add 20 g / L agar to NA liquid medium, pH 7.5, and sterilize at 115°C for 30 min.

[0050] MKB medium: K2HPO4 2.5 g / L, MgSO4·7H2O 2.5 g / L, glycerol 15.0 mL / L, casamino acids 5.0 g / L, adjust the pH to 7.2-7.4, and sterilize at 115°C for 30 min.

[0051] Root exudate simulation (recomposed exudate, referred to as RE") culture medium: MgSO4·7H2O 0.5 g / L, K2HPO4 1.0 g / L, KCl 0.5 g / L, yeast powder 1.0 g / L, Fe2(SO4)3 1.2 mg / L, MnSO4 0.4 mg / L, CuSO41.6 mg / L, (NH4)2SO4 2 g / L, glucose 0.8 g / L, fructose 1.3 g / L, maltose 0.2 g / L, ribose 0.02 g / L, citric acid 5.6 g / L, succinic acid 1.4 g / L, malic acid 0.2 g / L, casamino acid 0.8 g / L, adjust the pH to 7.2-7.4, and sterilize by filtration through a 0.22 μM sterile filter membrane.

[0052] Pathogen: Ralstonia solanacearum QL-RS1115, isolated from rhizosphere soil of tomatoes suffering from bacterial wilt in the laboratory, is the model pathogen of the present invention and can grow on NA culture medium.

[0053] Beneficial bacteria: Bacillus velezensis T-5, isolated from the rhizosphere soil of healthy tomatoes in the laboratory, is the model beneficial bacteria of the present invention and can grow on LB or NA medium.

[0054] Plasmid: Thermosensitive shuttle plasmid pMarA, carrying TnYLB-1 transposon, HimarI transposase gene is regulated by P A Promoter control, Kan r 、Amp r 、Erm r (Le Breton et al., 2006).

[0055] Example 1 Construction, screening and identification of mutant strains

[0056] First, Bacillus velezensis T-5 was cultured overnight in NCM medium, and the bacterial solution was diluted 25 times with fresh NCM medium supplemented with 5 mg / mL glycine, and cultured at 30 °C and 170 rpm until the OD 600 The p-value was about 0.8. After ice bathing for 30 min, the cells were collected by centrifugation at 8000 rpm for 6 min at 4°C, and washed four times with electroporation buffer (ETM, 0.5 mol / L sorbitol, 0.5 mol / L mannitol, and 10% glycerol) in an ice bath. The cells were resuspended in ETM buffer containing 10% PEG 6000 and 1 mmol / L MgCl2 to obtain competent cells, which were stored in a -80°C refrigerator for use.

[0057] In a 0.2 cm electroporation cuvette, 200 μL of competent cells were mixed with 500 ng of plasmid pMarA. After incubation at room temperature for 1–3 minutes, electroporation was performed using a MicroPulser Electroporator (Bio-Rad Laboratories) at a field strength of 7.5 kV / cm with a pulse duration of 4.6–6 ms. Following this, the cells were quickly transferred to 1 mL of LB liquid medium and cultured at 30°C at 170 rpm for 3–8 hours. The culture was then plated onto solid LB medium supplemented with 10 μg / mL erythromycin and incubated at 30°C for 36–48 hours to obtain transformants. To screen for transposon insertion mutants, erythromycin-resistant colonies carrying the plasmid were individually transferred to fresh LB medium, cultured overnight at 30°C, diluted, plated onto solid medium supplemented with 10 μg / mL kanamycin, and cultured at 46°C for 24 hours before isolation. Since cells carrying the intact pMarA plasmid were resistant to both erythromycin and kanamycin, while cells carrying the integrated transposon were resistant only to kanamycin, the bacteria were cultured on LB solid medium containing 10 μg / mL erythromycin or 10 μg / mL kanamycin, and three strains resistant only to kanamycin were screened and named: Bacillus velezensis T5M1 (also known as mutant strain T5M1), Bacillus velezensis T5M2 (also known as mutant strain T5M2), and Bacillus velezensis T5M3 (also known as mutant strain T5M3) ( Figure 1 ).

[0058] Inverse PCR was used to determine the transposon insertion sites in each mutant strain. First, DNA from the mutant strain was extracted using a bacterial DNA extraction kit (Omega, USA). The resulting DNA was digested with Taq I using a 25 μL digestion system consisting of 1 μL Taq I, 2 μL 10× Taq I buffer, 2 μL 0.1% BSA, 5 μL DNA, and 15 μL sterile water. The reaction was incubated at 65°C for 1–2 h. The digestion product was recovered using a PCR purification kit (Omega, USA) and self-ligated using T4 DNA ligase (Takara, Japan). The ligation system (20 μL) consisted of 1 μL T4 DNA ligase, 2 μL 10× T4 DNA Ligase Buffer, 5 μL digestion product, and 12 μL sterile water. The reaction was incubated at 16°C for 8–9 h. Reverse PCR was performed using the circularized enzyme-linked product, oIPCR1 primer (5'→3': GCTTGTAAATTCTATCATAATTG) and oIPCR2 primer (5'→3': AGGGAATCATTTGAAGGTT GG). The system (25 μL) consisted of 12.5 μL 2× Taq Master Mix, 1 μL oIPCR1, 1 μL oIPCR2, and 10.5 μL of the enzyme-linked product. Amplification conditions included pre-denaturation at 94°C for 5 min, followed by 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 1 min 30 s, and extension at 72°C for 45 s. The cloned sequence was purified using a PCR purification kit (Omega, USA), and the flanking genomic regions surrounding the transposon insertion site were sequenced using primer oIPCR3 (5'→3': GCATTTAATACTAGCGACGCC). The obtained DNA sequence was aligned with the complete genome sequence of Bacillus velez T-5 (Accession: CP061168) to determine the mutation site.

[0059] Mutant strain T5M1 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velezensis T-5, with the insertion site at ndh. It was deposited with the Guangdong Provincial Center for Microbiological Culture Collection on April 11, 2025, at Building 59, 5th Floor, 100 Xianlie Middle Road, Guangzhou, China, under the GDMCC No. 66119.

[0060] Mutant strain T5M2 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velezensis T-5, with the insertion site being btr. It was deposited with the Guangdong Provincial Center for Microbiological Culture Collection on April 11, 2025, at Building 59, 5th Floor, 100 Xianlie Middle Road, Guangzhou, China, under the GDMCC No. 66120.

[0061] Mutant strain T5M3 is a random insertion mutant of the TnYLB-1 transposon of Bacillus velezensis T-5, with the insertion site ykcB. It was deposited on April 11, 2025, at the Guangdong Provincial Center for Microbiological Culture Collection, Building 59, 5th Floor, 100 Xianlie Middle Road, Guangzhou, with the culture collection number GDMCC NO: 66121.

[0062] Example 2

[0063] 1. Preparation of Bacterial Liquid

[0064] Preparation of the mutant T5M1 bacterial suspension: The mutant T5M1 was activated using LB solid medium supplemented with 10 μg / mL of kanamycin. A single colony was picked and placed in LB liquid medium. The culture was cultured at 30°C and 170 rpm for 24 h. The biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M1 bacterial liquid was obtained.

[0065] Preparation of mutant T5M2 bacterial suspension: Activate mutant T5M2 using LB solid medium supplemented with kanamycin 10 μg / mL, pick a single colony and culture in LB liquid medium, culture at 30°C and 170 rpm for 24 h, and adjust the bacterial suspension biomass OD with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M2 bacterial liquid was obtained.

[0066] Preparation of the mutant T5M3 bacterial suspension: The mutant T5M3 was activated using LB solid medium supplemented with 10 μg / mL of kanamycin. A single colony was picked and placed in LB liquid medium, cultured at 30°C and 170 rpm for 24 h, and the biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T5M3 bacterial liquid was obtained.

[0067] Preparation of engineered bacterial flora: The bacterial liquid of mutant strain T5M1, the bacterial liquid of mutant strain T5M2 and the bacterial liquid of mutant strain T5M3 were mixed in a volume ratio of 1:1:1 to obtain the bacterial liquid of engineered bacterial flora.

[0068] Preparation of wild-type T-5 bacterial suspension: Activate T-5 using LB solid medium, pick a single colony and culture in LB liquid medium, culture at 37°C and 170 rpm for 24 h, and adjust the bacterial suspension biomass OD with sterile water. 600 0.5 (1×10 7 CFU / mL), and the mutant strain T-5 bacterial liquid was obtained.

[0069] Preparation of bacterial suspension of Ralstonia solanacearum QL-RS1115: QL-RS1115 was activated using NA solid medium, and a single colony was picked and placed in NA liquid medium. The suspension was cultured at 30 °C and 170 rpm for 24 h, and the biomass OD of the bacterial suspension was adjusted with sterile water. 600 0.5 (1×10 7 CFU / mL) to obtain the bacterial solution of Ralstonia solanacearum QL-RS1115.

[0070] 2. Evaluation of Antagonistic Ability

[0071] The engineered bacterial strain and wild-type T-5 bacterial strain were inoculated into NA liquid medium supplemented with 25 g / L NaCl at a 1% inoculation ratio and cultured at 30°C and 170 rpm for 24 h. The bacterial strains were sterilized by filtration using a 0.22 μm sterile filter membrane to obtain the engineered bacterial strain and wild-type T-5 fermentation broths, respectively. 193 μL of NA liquid medium and 2 μL of R. solanacearum QL-RS1115 bacterial strain were added to a 96-well plate. 5 μL of the engineered bacterial strain fermentation broth and wild-type T-5 fermentation broth were added, respectively. 5 μL of fresh NA liquid medium was added instead of the control. The OD values were measured after culture at 30°C and 170 rpm for 24 h. 600 The inhibition rate was calculated to evaluate the ability of the engineered bacterial population and wild-type T-5 to produce antagonistic substances. Each treatment was repeated three times.

[0072] 3. Biomass Evaluation

[0073] The engineered bacterial strain and wild-type T-5 bacterial strain were inoculated into RE medium supplemented with 25 g / L NaCl at a 1% inoculation ratio and cultured at 30°C and 170 rpm for 24 h. OD 600 Used to evaluate the biomass of engineered bacterial colonies and wild-type T-5. Each treatment was replicated three times.

[0074] 4. Siderophore production capacity

[0075] The engineered bacterial strain and wild-type T-5 culture medium were inoculated at a 1% inoculum ratio into MKB medium supplemented with 25 g / L NaCl and cultured at 30°C and 170 rpm for 48 h. The fermentation broths of the engineered bacterial strain and wild-type T-5 were sterilized by filtration through a 0.22 μm sterile filter. Siderophore production was determined using Chrome azurol S (CAS) assay (Schwyn et al., 1987). In a 96-well plate, 100 μL of CAS assay solution was added to 100 μL of each engineered bacterial strain and wild-type T-5 culture medium. For the control, 100 μL of fresh MKB medium was added instead. After incubation at room temperature for 2 h, the absorbance at 630 nm was measured using a microplate reader. The relative siderophore production (siderophore units) was calculated to measure the siderophore production capacity of the engineered bacterial strain and wild-type T-5.

[0076] Biocontrol properties of engineered bacterial consortia under salt stress Figure 2 The results showed that compared with the wild-type T-5, the engineered bacterial community had significantly increased antagonistic substances, biomass, and iron carriers under salt stress (P < 0.05), indicating that the engineered bacterial community can better adapt to the salt stress environment than the wild-type T-5 and more effectively exert its biocontrol properties.

[0077] Example 3 Investigating the effect of engineered bacterial flora on controlling tomato bacterial wilt under salt stress

[0078] Preparation of engineered bacterial cultures: Referring to the method of Example 2, the mutant strain T5M1 bacterial culture, the mutant strain T5M2 bacterial culture and the mutant strain T5M3 bacterial culture were cultivated separately to prepare mutant strain T5M1 bacterial culture (1×10 8 CFU / mL), mutant strain T5M2 bacterial solution (1×10 8 CFU / mL), mutant strain T5M3 bacterial solution (1×10 8 CFU / mL); mutant strain T5M1 bacterial solution, mutant strain T5M2 bacterial solution and mutant strain T5M3 bacterial solution were mixed at a volume ratio of 1:1:1 to obtain a concentration of 1×10 8 CFU / mL of engineered bacterial culture.

[0079] Preparation of wild-type T-5 bacterial suspension: Activate T-5 using LB solid medium, pick a single colony and culture in LB liquid medium, culture at 37 °C and 170 rpm for 36 h, and add sterile water to a concentration of 1×10 8 CFU / mL, and the mutant strain T-5 bacterial liquid was obtained.

[0080] Preparation of bacterial suspension of Ralstonia solanacearum QL-RS1115: Referring to the method of Example 2, QL-RS1115 was activated using NA solid medium. A single colony was picked and placed in NA liquid medium, cultured at 30°C and 170 rpm for 36 h, and the concentration was adjusted to 1×10 7 CFU / mL, and the bacterial liquid of Ralstonia solanacearum QL-RS1115 was obtained.

[0081] Three treatments were set up in the experiment: (1) inoculation with engineered bacteria and Ralstonia solanacearum QL-RS1115; (2) inoculation with wild-type T-5 and Ralstonia solanacearum QL-RS1115; (3) inoculation with Ralstonia solanacearum QL-RS1115 alone, and replacing beneficial bacteria with an equal volume of sterile water.

[0082] Tomato variety: Red Dwarf.

[0083] First, soak the tomato seeds in a 3% (v:v) NaClO solution, sterilize for 5 minutes, and then wash them several times with sterile water. Place the sterilized filter paper moistened with sterile water on a sterilized plate, and evenly arrange the washed seeds on the filter paper and place them in a 28°C incubator for germination for 2-3 days. Subsequently, sow the germinated seeds into a sterilized seedling medium. After culturing in the seedling medium for the third week (the tomato three-leaf stage), transplant the seedlings with the same growth into six-hole seedling pots with about 100 g of cultivation medium per pot. The greenhouse temperature was maintained at 28-35°C. The six-hole seedling pots were randomly rearranged every 3 days. Five days after transplanting the seedlings, salt (2‰ NaCl) was added, and an equal amount of sterilized water was added to the treatment without salt. Seven days after transplanting, the seeds were inoculated with a final concentration of 10 7 CFU / g soil of engineered bacterial flora and wild-type T-5 bacterial solution, only the treatment of inoculating Ralstonia solanacearum QL-RS1115 was replaced by an equal amount of sterile water. 6 CFU / g soil of Ralstonia solanacearum QL-RS1115. Each treatment had four replicates, with 12 tomato plants per replicate.

[0084] The degree of wilting in tomato plants is categorized into five levels: 0 for no symptoms, 1 for wilting less than 25% of leaves, 2 for wilting between 25% and 50%, 3 for wilting between 50% and 75%, and 4 for wilting greater than 75% or complete plant death. The disease index represents the severity of the disease, calculated using the following formula (Guo et al., 2004):

[0085] Plant disease index = [∑(number of diseased plants at each level × corresponding level) / (total number of plants surveyed × highest level value)] × 100%

[0086] Thirty days after inoculation with the pathogen Ralstonia solanacearum, the disease became stable, and the greenhouse pot experiment was terminated. Approximately 0.3 g of tomato rhizosphere soil was sampled and DNA was extracted using the MP Soil DNA Extraction Kit (MP Biomedicals, USA) according to the manufacturer's instructions. The extracted DNA was tested for quality using a NanoDrop (Thermo Scientific, USA). 260 / A 280 ) and concentration.

[0087] qPCR was used to quantify the abundance of pathogenic Ralstonia solanacearum in rhizosphere soil samples. The detection gene for the pathogen Ralstonia solanacearum is fliC, which encodes the flagellar subunit. The upstream primer (5'→3'): GGCGGCCTTCAGGGAGGTC, and the downstream primer (5'→3'): GAACGCCAACGGTGCGAACT. The detection gene for the beneficial Bacillus velezensis is gyrA, which encodes bacterial gyrase. The upstream primer (5'→3'): AAATCTGCCCGTATCGTCG, and the downstream primer (5'→3'): GCGTCACGGC GRATCTCAA. qPCR was performed using a qTOWER real-time high-speed fluorescence quantitative PCR instrument (Analytikjena, Germany). The qPCR kit was prepared using TB Green ® Premix Ex Taq ™ (Tli RNaseH Plus) kit (Takara, Japan), the system is 20 μL: 10 μL TBGreen Premix Ex Taq (Tli RNaseH Plus), 6 μL ddH2O, 2 μL DNA template, 0.8 μL upstream primer, 0.8 μL downstream primer, 0.4 μL ROX Reference Dye II. Each DNA sample was repeated 3 times to obtain the CT value. The standard curve was drawn using the product of the gene fliC amplified by Ralstonia solanacearum QL-Rs1115 and the product of the gene gyrA amplified by Bacillus velezensis T-5, respectively, and the CT value was converted into the gene copy number. At the same time, about 0.3 g of rhizosphere sample was weighed, dried at 60 ° C to constant weight, and then weighed to calculate the water content of the sample and determine the dry weight of the rhizosphere sample used for DNA extraction. Finally, the logarithm of the gene copy number per gram dry weight (lg gene copies g -1 dw) to characterize the abundance of Ralstonia solanacearum and Bacillus velez.

[0088] The results are as follows Figure 3The results show that the disease index of the treatment inoculated with R. solanacearum alone was 58.33%. The inoculation of beneficial microorganisms effectively reduced the occurrence of bacterial wilt under salt stress, resulting in an increase in the abundance of Bacillus Velez-likelihood and a decrease in the abundance of R. solanacearum in the tomato rhizosphere. Compared with the wild-type T-5 (disease index 29.17%), the bacterial wilt disease index of the treatment inoculated with the engineered microbial consortium was significantly reduced to only 12.50%. The abundance of B. Velez-likelihood in the rhizosphere was significantly increased, while the abundance of R. solanacearum was significantly decreased. This indicates that the engineered microbial consortium is significantly more effective in controlling bacterial wilt under salt stress than the wild-type T-5 (P < 0.05).

[0089] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the appended claims.

Claims

1. An engineered bacterial population, characterized in that: The engineered bacterial group consists of three mutant strains of Bacillus velezensis, among which: Bacillus velez mutant 1, designated as: Bacillus velezensis T5M1, classified as: Bacillus velezensis , strain deposit number is: GDMCC NO: 66119; Bacillus velez mutant 2, named: Bacillus velezensis T5M2, classified as: Bacillus velezensis , strain deposit number is: GDMCC NO: 66120; Bacillus velez mutant 3, named: Bacillus velezensis T5M3, classified as: Bacillus velezensis , the strain deposit number is: GDMCC NO: 66121.

2. Use of the engineered bacterial population according to claim 1 in preventing and controlling tomato bacterial wilt under salt stress.

3. Use of the engineered bacterial consortium according to claim 1 in the preparation of a microbial preparation for preventing and controlling tomato bacterial wilt under salt stress.

4. The use according to claim 3, characterized in that The microbial preparation is a live bacterium of the engineered bacterial group according to claim 1 or a microbial preparation made from the engineered bacterial group according to claim 1.

5. The use according to claim 4, characterized in that The microbial agent prepared from the engineered bacterial group according to claim 1 is applied to the rhizosphere of tomatoes by root irrigation.

6. A microbial agent comprising the engineered bacterial population according to claim 1.

7. Use of the microbial agent according to claim 6 for preventing and controlling tomato bacterial wilt under salt stress.

8. The use according to claim 7, characterized in that The microbial agent according to claim 6 is applied to the rhizosphere of tomatoes by root irrigation.

9. A method for preventing and controlling tomato bacterial wilt under salt stress using the engineered bacterial population according to claim 1, characterized in that: The method comprises the following steps: (1) Cultivate mutant strain T5M1, mutant strain T5M2, and mutant strain T5M3 to obtain mutant strain T5M1 bacterial solution, mutant strain T5M2 bacterial solution, and mutant strain T5M3 bacterial solution, respectively, and then mix the mutant strain T5M1 bacterial solution, mutant strain T5M2 bacterial solution, and mutant strain T5M3 bacterial solution in a volume ratio of 1:1:1; (2) applying the mixed bacterial solution obtained in step (1) into the rhizosphere of tomatoes by root irrigation; The concentration of the mutant strain T5M1 in each tomato plant was 1×10 6 ~1×10 8 CFU / g soil; the concentration of the mutant strain T5M2 was 1×10 6 ~1×10 8 CFU / g soil; the concentration of the mutant strain T5M3 bacterial solution was 1×10 6 ~1×10 8 CFU / g soil.

Citation Information

Patent Citations

  • Bacillus velezensis and use thereof

    WO2023138678A1