GRNA, recombinant vector, application of recombinant vector in enhancing hGRK1 promoter activity, and cell line

Abstract

The invention relates to the technical field of biology, in particular to gRNA, a recombinant vector, application of the recombinant vector to enhancement of hGRK1 promoter activity and a cell line. Experiments show that gRNA01 and / or gRNA08 obtained through screening can effectively guide dCas9-VPR to be combined to the hGRK1 promoter, the expression activity of the hGRK1 promoter is specifically improved, then the expression quantity of a target gene is improved, and a good foundation is laid for establishing an in-vitro verification system of ophthalmology department specific AAV drugs and developing more efficient ophthalmology department specific AAV drugs.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to gRNA, recombinant vectors, their applications in enhancing the activity of the hGRK1 promoter, and cell lines. Background Art

[0002] In the past two decades, mankind has achieved a series of milestone breakthroughs in the field of gene therapy. Gene therapy has gradually become one of the hottest treatment fields at present. In particular, adeno-associated virus (AAV) has become the preferred delivery vector for gene therapy and is also recognized as the most promising delivery vector at present. The relevance of AAV vector-based gene therapy in clinical translation has been continuously increasing, and currently accounts for more than 10% of global gene therapy clinical trials.

[0003] As an important application field of AAV gene therapy drugs, with the continuous progress of technology, the requirements for vector design are gradually increasing. One of the main challenges involves the selection of tissue- or cell-specific promoters to control the expression of vector transgenes. These regulatory elements show high specificity for cell targets in in vivo experiments, but may show poor activity when applied in cell-based systems. And the in vitro activity experiment of drugs is one of the important indicators for preclinical evaluation. Therefore, it has become an urgent problem to develop an efficient in vitro system for verifying ophthalmic-specific AAV drugs.

[0004] Human G protein-coupled receptor kinase 1 (hGRK1) can regulate the specific expression of target genes in the retinas of non-human primates. As a commonly used specific promoter for ophthalmic AAV drugs, it has been applied to many ophthalmic AAV drugs in the clinical stage. Some studies have explored the expression of AAV drugs containing the hGRK1 promoter in the 661W cell line. The 661W cell line is derived from a mouse retinal tumor, can express many functional markers indicating the origin of cone cells, and at the same time, this cell line can verify the functions of vectors regulated by non-specific promoters and retina-specific promoters. However, for the expression plasmid of the target gene containing the hGRK1 promoter, this cell line does not show a sufficient level of gene expression; moreover, through detection, it is found that the infection efficiency of the AAV viral vector for this cell line is relatively low. Therefore, it is of great significance to provide an in vitro verification system for ophthalmic-specific AAV drugs with a higher expression level of the target gene. Summary of the Invention

[0005] In view of this, the present invention provides gRNA, recombinant vectors, their applications in enhancing the activity of the hGRK1 promoter, and cell lines. The gRNA can specifically increase the expression activity of the hGRK1 promoter, thereby increasing the expression level of the target gene, and can be used to establish an in vitro verification system for ophthalmic-specific AAV drugs.

[0006] To achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0007] gRNA, including gRNA1 and / or gRNA8;

[0008] The gRNA1 and gRNA8 respectively have the nucleotide sequences shown in SEQ ID NO:1 or SEQ ID NO:8, or nucleotide sequences having at least 80% homology with them and having the same or similar functions.

[0009] The present invention also provides the application of the gRNA in enhancing the transcriptional activity of the hGRK1 promoter / or increasing the expression level of the target gene.

[0010] Among them, the hGRK1 promoter has any one of the following nucleotide sequences:

[0011] 1) The nucleotide sequence shown in SEQ ID NO:11; or

[0012] 2) A nucleotide sequence in which one or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:11 and retaining the hGRK1 promoter activity;

[0013] 3) A nucleotide sequence having at least 80% homology with the nucleotide sequence shown in 1) or 2).

[0014] The present invention also provides a fusion expression cassette 1, including: the gRNA, hGRK1 promoter and target gene of the present invention.

[0015] In some embodiments, the fusion expression cassette 1 sequentially includes from the 5'-end to the 3'-end: gRNA, gRNA scaffold, hGRK1 promoter and target gene. The target gene is a gene or its fragment for treating eye diseases, or a fluorescent marker gene, such as hrGFP.

[0016] The present invention also provides a fusion expression cassette 2, including: the gRNA (i.e., gRNA1, gRNA8, gRNA1+gRNA8), dCas9 coding sequence and VPR coding sequence of the present invention.

[0017] In some embodiments, the fusion expression cassette 2 sequentially includes from the 5'-end to the 3'-end: promoter 1, the gRNA of the present invention, gRNA scaffold, promoter 2, dCas9 coding sequence, VPR coding sequence and terminator.

[0018] In some specific embodiments, the fusion expression cassette 2 sequentially includes from the 5'-end to the 3'-end: promoter 1, gRNA1, promoter 2, dCas9 coding sequence, VPR coding sequence and terminator;

[0019] Or, promoter 1, gRNA8, promoter 2, dCas9 coding sequence, VPR coding sequence, and terminator;

[0020] Or, promoter 1, gRNA1, gRNA8, promoter 2, dCas9 coding sequence, VPR coding sequence, and terminator.

[0021] Specifically, the VPR coding sequence is as shown in SEQ ID NO: 12;

[0022] The coding sequence of the dCas9 protein is as shown in SEQ ID NO: 13.

[0023] In some embodiments, in the fusion expression cassettes 1 and 2, a gRNA scaffold is further connected to the 3' end of the gRNA for binding to the dCas9 protein. The present invention does not make special requirements on the specific sequence of the gRNA scaffold, as long as it can bind to the dCas9 protein. In some specific embodiments, the nucleic acid sequence of the gRNA scaffold is as shown in SEQ ID NO: 14.

[0024] In the fusion expression cassette of the present invention, there are no special requirements for the types of promoter 1, promoter 2, and terminator, including common types in the art, as long as they can control the transcription of gRNA and dCas9. In some specific embodiments, the promoter 1 is U6 Promoter (the sequence is as shown in SEQ ID NO: 15), and the promoter 2 is EF-1aα Promoter (the sequence is as shown in SEQ ID NO: 16).

[0025] The present invention also provides a recombinant vector, including the gRNA of the present invention or the fusion expression cassette of the present invention.

[0026] In some embodiments, the recombinant vector is a eukaryotic expression vector, and the backbone of the eukaryotic expression vector is the pLentiCRISPR series or a modified pLentiCRISPR series vector, such as Figure 7 the backbone of the shown map.

[0027] In some other embodiments, the recombinant vector is a viral vector, and the viral vector includes a lentiviral vector, an adenoviral vector, or an adeno-associated viral vector.

[0028] The present invention also provides a vector combination, characterized by including the recombinant vector of the present invention and a vector containing the hGRK1 promoter.

[0029] Wherein, the vector containing the hGRK1 promoter further includes a coding sequence of a gene or its fragment for treating eye diseases, an antibody, or its antigen-binding fragment.

[0030] The present invention also provides a stably transfected cell line that enhances the transcriptional activity of the hGRK1 promoter, including any one of the following:

[0031] 1) The gRNA of the present invention;

[0032] 2) The fusion expression cassette 1 or the fusion expression cassette 2 of the present invention;

[0033] 3) The recombinant vector of the present invention;

[0034] 4) The vector combination of the present invention.

[0035] The present invention also provides a recombinant virus, which is obtained by packaging the recombinant vector of the present invention with a packaging cell.

[0036] In some embodiments, the packaging cell includes 293T cells.

[0037] The present invention also provides the use of any one of the following in the in vitro verification system for preparing ophthalmic-specific AAV drugs;

[0038] 1) The gRNA shown in the present invention;

[0039] 2) The fusion expression cassette 1 or the fusion expression cassette 2 of the present invention;

[0040] 3) The recombinant vector of the present invention;

[0041] 4) The vector combination of the present invention.

[0042] 5) The recombinant virus of the present invention.

[0043] The present invention also provides an in vitro verification system for ophthalmic-specific AAV drugs, including any one of the following:

[0044] 1) The gRNA shown in the present invention;

[0045] 2) The fusion expression cassette 1 or the fusion expression cassette 2 of the present invention;

[0046] 3) The recombinant vector of the present invention;

[0047] 4) The vector combination of the present invention.

[0048] 5) The recombinant virus of the present invention.

[0049] The present invention provides gRNAs, recombinant vectors, their applications in enhancing the activity of the hGRK1 promoter, and cell lines. Experiments show that the gRNA01 and / or gRNA08 screened in the present invention can effectively direct dCas9-VPR to bind to the hGRK1 promoter, specifically improve the expression activity of the hGRK1 promoter, and further increase the expression level of the target gene, laying a good foundation for establishing an in vitro verification system for ophthalmic-specific AAV drugs and developing more efficient ophthalmic-specific AAV drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Map and restriction enzyme digestion identification of the pdCas9-VPR vector;

[0051] A: Schematic diagram of the pdCas9-VPR vector. The vector contains the EF1α promoter, the dCas9 gene coding sequence, the VPR domain, the puromycin resistance gene (PuroR), and the woodchuck post-transcriptional regulatory element (WPRE);

[0052] B: Identification of the pdCas9-VPR plasmid using different enzyme digestion combinations: 1: AhdI + BamHI; 2: XhoI; 3: AhdI; M: DNA electrophoresis molecular marker. The electrophoresis results are consistent with the expectations;

[0053] Figure 2 PCR identification electrophoresis of the dCas9-VPR HEK293T stable cell line;

[0054] M: DNA electrophoresis molecular marker, NC: negative control cells, 1-7: different cell monoclonal clones. Genomic DNA of different cells was amplified using Cas9-specific primers. No band was observed in the negative control DNA, and specific bands could be amplified from clone 1 to clone 7, with the size consistent with the expectations;

[0055] Figure 3 Schematic diagram of the distribution of gRNAs on the hGRK1 promoter;

[0056] The full length of the hGRK1 promoter is 292 bp. Ten different gRNAs are distributed at different positions on the hGRK1 promoter, and the recognized PAM sequence is NGG. The arrow indicates the direction of the sense strand or the antisense strand

[0057] Figure 4 Map of the gRNA-hGRK1-hrGFP vector

[0058] Schematic diagram of the pdCas9-VPR vector. The vector contains the U6 promoter, the gRNA expression framework, the hGRK1 promoter, the hrGFP gene coding sequence, and the polyA termination signal;

[0059] Figure 5Fluorescence images of the dCas9-VPR stable cell line;

[0060] The dCas9-VPR 293T stable cell line was transfected with different gRNA-hGRK1-hrGFP plasmids, and the cells transfected with the hGRK1-hrGFP plasmid without gRNA were used as the control group. After 48 hours of transfection, the cells in each group were observed under a fluorescence microscope and photographed. The fluorescence in the gRNA01 and gRNA08 groups was significantly enhanced;

[0061] Figure 6 Flow cytometry analysis of the GFP positive rate of the dCas9-VPR stable cell line;

[0062] The dCas9-VPR 293T stable cell line was transfected with different gRNA-hGRK1-hrGFP plasmids, and the cells transfected with the -hGRK1-hrGFP plasmid without gRNA were used as the control group. After 48 hours of transfection, the cells in each group were collected and the GFP positive rate was analyzed using a flow cytometer. The GFP positive rates in the gRNA01 and gRNA08 groups were significantly increased;

[0063] Figure 7 Fluorescence images of the gRNA-dCas9-VPR stable cell line;

[0064] A: Schematic diagram of the pgRNA08-dCas9-VPR vector. The vector contains the U6 promoter, the gRNA08 expression cassette, the EF1α promoter, the dCas9 gene coding sequence, the VPR domain, the puromycin resistance gene (PuroR), and the woodchuck post-transcriptional regulatory element (WPRE);

[0065] B: Schematic diagram of the pgRNA01-gRNA08-dCas9-VPR vector. The vector contains the U6 promoter, the gRNA01 expression cassette, the gRNA08 expression cassette, the EF1α promoter, the dCas9 gene coding sequence, the VPR domain, the puromycin resistance gene (PuroR), and the woodchuck post-transcriptional regulatory element (WPRE);

[0066] C: Different gRNA-dCas9-VPR 293T stable cell lines were transfected with the hGRK1-hrGFP plasmid, and the hGRK1-hrGFP plasmid transfected into the ordinary 293T cell line was used as the control group. After 48 hours of transfection, the cells in each group were observed under a fluorescence microscope and photographed. The fluorescence in the gRNA01 and gRNA08 groups was significantly enhanced;

[0067] Figure 8 GFP positive rate and mean fluorescence intensity of the gRNA-dCas9-VPR stable cell line;

[0068] Different gRNA-dCas9-VPR 293T stable transfected cell lines were transfected with the hGRK1-hrGFP plasmid, and the hGRK1-hrGFP plasmid was transfected into ordinary 293T cell lines as a control group. 48 hours after transfection, the cells of each group were collected and analyzed by flow cytometry;

[0069] A: Flow cytometry analysis of the GFP positive rate of each group of cells. The GFP positive rates of the gRNA08 and gRNA01-gRNA08 groups were significantly increased;

[0070] B: Flow cytometry analysis of the mean fluorescence intensity (MFI) of each group of cells. The MFIs of the gRNA08 and gRNA01-gRNA08 groups were significantly increased. Specific embodiments

[0071] The present invention provides gRNAs, recombinant vectors, their applications in enhancing the activity of the hGRK1 promoter, and cell lines. Those skilled in the art can draw on the content of this article and appropriately modify the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate alterations and combinations to the methods and applications in this article without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0072] The test materials used in the present invention are all ordinary commercially available products and can be purchased in the market.

[0073] The present invention uses molecular cloning techniques to construct a plasmid with a specific recognition element dCas9 and a transcriptional driving element VPR domain, and uses this plasmid to construct a stable transfected cell line that can stably co-express the above two elements. Subsequently, a series of gRNAs that can specifically bind to the promoter of human G protein-coupled receptor kinase 1 (hGRK1) were designed, and gRNAs that can efficiently drive the high expression of the hGRK1 promoter in cells were screened using the stable transfected cell line. Finally, the screened gRNAs were constructed into a fusion expression plasmid in a single or 2-combination manner with the dCas9 and VPR elements, and the above fusion expression cassette was successfully integrated into the 293T cell line to construct a stable transfected cell line, which can increase the promoter activity of hGRK1.

[0074] Table 1 Nucleotide sequences

[0075]

[0076]

[0077] The following further elaborates the present invention in conjunction with embodiments:

[0078] Construction of dCas9-VPR Vector and Stable Transfected Cell Line

[0079] Specific recognition of the promoter requires the high specificity of the Cas9 / gRNA system for recognizing the promoter DNA sequence, and at the same time, the nuclease activity of Cas9 needs to be avoided. Therefore, the mutant dCas9 with the endonuclease domain of Cas9 mutated is selected. dCas9 retains the advantage of sequence-specific recognition and avoids DNA double-strand breaks caused by enzymatic cleavage. The driving function of transcriptional activation is provided by the VPR domain. Therefore, the vector structure is the coupling of two main functional domains, dCas9 and VPR( Figure 1 -A).

[0080] Enzyme digestion verification of dCas9-VPR plasmid DNA:

[0081] Prepare the reaction solution according to the following system, incubate at 37 °C for 1 - 4 h, and take an appropriate volume for electrophoresis detection.

[0082] Table 1

[0083] sample volume(μL) 1X Buffer 2 Plasmid DNA 1-2 Restriction Enzyme 1 1 Restriction Enzyme 2 1 <![CDATA[ddH2O]]> Make up to 20 μL

[0084] Extract the plasmid, digest it with different combinations of restriction endonucleases respectively, and observe the band sizes by electrophoresis. It is found that the electrophoretic bands are all in line with expectations( Figure 1 -B), proving the successful construction of the plasmid vector.

[0085] Construction of dCas9-VPR HEK293T stable transfected cell line:

[0086] 1) Culture of 293T cells. When the confluence reaches 80 - 90% after cell resuscitation, discard the culture medium, wash with PBS, digest with trypsin to make a cell suspension, and passage at a ratio of 1 to 4, and inoculate into a 10 cm cell culture dish.

[0087] 2) Cell transfection. Prepare a transfection complex containing the dCas9-VPR plasmid, change the cell culture medium to serum-free medium, add the transfection complex and mix well, and continue to culture for 48 h.

[0088] 3) Antibiotic screening. Digest the transfected cells and inoculate them into a new 10 cm cell culture dish. After the cells adhere, aspirate the original culture medium, add complete medium containing an appropriate concentration of antibiotic, and continue to culture. Change the medium every 48 h until all the cells in the negative control wells die.

[0089] 4) Monoclonal screening. After culturing for about 15 days, digest the cells screened by antibiotics with digestive solution, resuspend them with complete medium, and dilute the cells to a final concentration of 10 cells / mL. Add the diluted cells to a 96-well plate, 100 μL per well, that is, 1 cell per well. After culturing for 10 days, observe under a microscope that cell clones are formed in the well plate, and record the number of clones in each well. During this period, add fresh medium containing antibiotics.

[0090] 5) Monoclonal expansion. Pay attention to observing the cell growth of the selected monoclonal wells. When it grows to >1 / 2 well, it can be expanded to a 24-well plate for culture, and gradually expanded to a 6-well plate.

[0091] 6) Monoclonal identification. Extract the DNA of monoclonal cells and perform PCR identification. After the identification is correct, freeze the cells.

[0092] Extract the DNA of monoclonal cells as a template, design primers to amplify the specific sequence of the dCas9 protein coding gene. As can be seen from Figure 2 it, different monoclonal cells can all amplify the target band, and the size is in line with expectations; on the contrary, the cells used as negative controls were not transfected with the dCas9-VPR plasmid, so the target band could not be amplified. The above results indicate that through plasmid transfection and pressure screening, the dCas9-VPR plasmid was successfully integrated into the genome of 293T cells, and the dCas9-VPR HEK293T stable transfection cell line was successfully constructed.

[0093] Example 2 Screening of gRNAs Recognizing the hGRK1 Promoter

[0094] The promoter of human G protein-coupled receptor kinase 1 (hGRK1), as a photoreceptor cell-specific promoter, has been verified in animal models of different species. Especially in the studies on non-human primate models, it has been proved that the genes driven by this promoter can be well restricted to the photoreceptor cell layer for expression. This result provides strong evidence for the clinical use of this promoter to drive the expression of ophthalmic drugs. In order to ensure that this promoter can be expressed in the cell line constructed in Example 1, it is necessary to screen out appropriate gRNA sequences to guide the binding of the dCas9-VPR conjugate protein to the hGRK1 promoter. Therefore, a series of gRNA sequences were designed. The sequences of the hGRK1 promoter and gRNAs are as follows:

[0095] hGRK1 (SEQ ID NO: 11):

[0096] GGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGT

[0097] GAGGCGGCCCCTTGGAGGAAGGGGCCGGGCAGAATGATCTAATCGGAT

[0098] TCCAAGCAGCTCAGGGGATTGTCTTTTTCTAGCACCTTCTTGCCACTCCT

[0099] AAGCGTCCTCCGTGACCCCGGCTGGGATTTCGCCTGGTGCTGTGTCAGC

[0100] CCCGGTCTCCCAGGGGCTTCCCAGTGGTCCCCAGGAACCCTCGACAGG

[0101] GCCCGGTCTCTCTCGTCCAGCAAGGGCAGGGACGGGCCACAGGCCAAGGGC。

[0102] gRNA01: ACCCCGGCTGGGATTTCGCC (SEQ ID NO: 1);

[0103] gRNA02: ACAAACAACCACCAGGCTTC (SEQ ID NO: 2);

[0104] gRNA03: ACCAGGCGAAATCCCAGCCG (SEQ ID NO: 3);

[0105] gRNA04: TCCGATTAGATCATTCTGCC (SEQ ID NO: 4);

[0106] gRNA05: TCACGGAGGACGCTTAGGAG (SEQ ID NO: 5);

[0107] gRNA06: CGGGGTCACGGAGGACGCTT (SEQ ID NO: 6);

[0108] gRNA07: GTCCCCAGGAACCCTCGACA (SEQ ID NO: 7);

[0109] gRNA08: GGAAAAGTGAGGCGGCCCCT (SEQ ID NO: 8);

[0110] gRNA09: CCGGTCTCTCTCGTCCAGCA (SEQ ID NO: 9);

[0111] gRNA10: GACGCTTAGGAGTGGCAAGA (SEQ ID NO: 10).

[0112] The distribution of gRNA on the hGRK1 promoter is as Figure 3 shown, and a series of vectors co-expressing gRNA and the indicator protein GFP were constructed. The schematic diagram of the vector map is shown in Figure 4 . Different gRNA-hGRK1-hrGFP plasmids were transfected into the cell line constructed in Example 1.

[0113] Cell transfection steps:

[0114] 1) Add 400 ul of nuclease-free water to the tube, shake for 10 seconds to dissolve the lipid. After shaking, store the reagent at -20 °C and shake again before use.

[0115] 2) Select an appropriate mixing ratio (1:1 - 1:2 / liposome volume: DNA mass) to transfect the cells. Add an appropriate volume of serum-free medium to a transfection tube. Add an appropriate mass of MyoD or EGFP DNA, shake, and then add an appropriate volume of transfection reagent and shake again.

[0116] 3) Incubate the mixture at room temperature for 10 - 15 minutes.

[0117] 4) Aspirate the medium in the culture plate and wash once with PBS or serum-free medium.

[0118] 5) Add the mixture and return the cells to the incubator for 1 hour.

[0119] 6) After that, depending on the cell type, decide whether to remove the mixture, and then add complete medium and continue culturing for 48 hours.

[0120] 48 hours after transfection, observe the expression of GFP in the cells under a fluorescence microscope. As Figure 5 shown, dCas9-VPR HEK293T cells transfected with the hGRK1-hrGFP plasmid were used as negative controls, and only a small number of cells had green fluorescence expression; while in dCas9-VPR HEK293T cells transfected with the gRNA01-hGRK1-hrGFP and gRNA08-hGRK1-hrGFP plasmids, the number of GFP-positive cells increased significantly.

[0121] Harvest the above groups of cells separately and analyze the proportion of GFP-positive cells using a flow cytometer.

[0122] Flow analysis steps:

[0123] 1) Preparation of single-cell suspension: Adherent cells can be digested into single cells with trypsin and collected in a centrifuge tube. Suspension cells can be directly collected. After centrifugation (2000 r, 5 min) to remove the residual culture medium, wash with 1xPBS by centrifugation 1 - 2 times, and then resuspend the precipitate with 1xPBS to prepare a single-cell suspension.

[0124] 2) Flow cytometer settings: According to specific experimental requirements, set the parameters of the flow cytometer, such as laser wavelength, light source intensity, beam blocker, filter, etc.

[0125] 3) Sample loading: Inject the cell suspension into the flow cytometer so that single cells pass through the detection channel one by one.

[0126] 4) Cell analysis: The flow cytometer uses the principle of high-speed hydrodynamics to pass single cells through the detector, and simultaneously records the optical parameters of the cells, such as cell size, shape, color, etc., as well as the fluorescence signals of certain specific markers.

[0127] 5) Data analysis: According to experimental needs, use software to process and analyze the collected data, such as cell counting, subset ratio, fluorescence intensity, etc.

[0128] The flow cytometer can perform absolute quantification of GFP-positive cells in the whole cell population. As Figure 6 can be seen, using 293T cells transfected with the hGRK1-hrGFP plasmid as a control, the GFP-positive rate of this group of cells is 37%; while in dCas9-VPR HEK293T cells transfected with the gRNA01-hGRK1-hrGFP and gRNA08-hGRK1-hrGFP plasmids, the GFP-positive rates increased to 42% and 63% respectively, indicating that the expression levels of GFP in the two groups of cell populations are significantly increased compared to the control.

[0129] Based on the above results, we can judge that gRNA01 and gRNA08 can effectively guide dCas9-VPR in the stable cell line to bind to the hGRK1 promoter and drive the expression of the downstream hrGFP gene.

[0130] Example 3 Construction and expression efficiency verification of gRNA-dCas9-VPR HEK293T stable cell line

[0131] Through screening, both gRNA01 and gRNA08 can significantly improve the activity of the hGRK1 promoter. Therefore, we constructed gRNA-dCas9-VPR plasmids with single gRNA and double gRNA combinations (see Figure 7 -A, Figure 7-B), and transfected 239T cells to obtain two kinds of HEK293T stable transfected cell lines, namely gRNA08-dCas9-VPR HEK293T and gRNA01-gRNA08-dCas9-VPR HEK293T.

[0132] The steps for constructing the cell lines are shown in Example 1.

[0133] To verify the activity of the hGRK1 promoter in the above constructed stable transfected cell lines, the hGRK1-hrGFP plasmid was transfected into ordinary 293T, gRNA08-dCas9-VPR HEK293T and gRNA01-gRNA08-dCas9-VPR HEK293T stable transfected cell lines respectively, and analyzed by flow cytometry 48 hours later.

[0134] The steps for cell transfection and flow analysis are shown in Example 2.

[0135] As Figure 7 shown in -C, ordinary 293T cells transfected with the hGRK1-hrGFP plasmid were used as negative controls, and only a small number of cells showed green fluorescence expression; while in the gRNA08-dCas9-VPR HEK293T and gRNA01-gRNA08-dCas9-VPR HEK293T stable transfected cell lines transfected with the hGRK1-hrGFP plasmid, the number of GFP-positive cells increased significantly, and the fluorescence intensity of different monoclonal cells also increased compared with the negative control.

[0136] As Figure 8 shown in -A, ordinary 293T cells transfected with the hGRK1-hrGFP plasmid were used as a control, and the GFP positive rate of this group of cells was 35.05%; while in the gRNA08-dCas9-VPR HEK293T cells transfected with the hGRK1-hrGFP plasmid, the GFP positive rates of monoclonal 1 and monoclonal 2 increased to 47.64% and 46% respectively; in the gRNA01-gRNA08-dCas9-VPR HEK293T cells transfected with the hGRK1-hrGFP plasmid, the GFP positive rates of monoclonal 1 and monoclonal 2 increased to 43.68% and 39.41% respectively. As Figure 8As shown in Figure -B, the mean fluorescence intensity (MFI) of the control group was 3.07E5. In the gRNA08-dCas9-VPR HEK293T group, the MFIs of monoclonal clones 1 and 2 increased to 5.78E5 and 5.49E5 respectively; in the gRNA01-gRNA08-dCas9-VPR HEK293T group, the MFIs of monoclonal clones 1 and 2 increased to 5.05E5 and 6.26E5 respectively. The above results indicate that after transfection with the same hGRK1-hrGFP plasmid, compared with the ordinary 293T cell line, the expression level of GFP in the four stably transfected cell lines we constructed was significantly increased.

[0137] Based on the above results, we successfully constructed a gRNA-dCas9-VPR HEK293T stably transfected cell line with significantly enhanced hGRK1 promoter activity. This cell line utilizes the specific recognition of the hGRK1 promoter by the dCas9 protein under the guidance of gRNA, which can specifically enhance the expression activity of the hGRK1 promoter and increase the expression level of the target gene, laying a good foundation for the establishment of an in vitro verification system for ophthalmic-specific AAV drugs.

[0138] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. gRNA, characterized in that, Comprising gRNA1 and / or gRNA8; The gRNA1 and gRNA8 respectively have nucleotide sequences as shown in SEQ ID NO:1 or SEQ ID NO:8, or nucleotide sequences having at least 80% homology therewith and the same or similar functions.

2. Use of the gRNA according to claim 1 in enhancing the transcriptional activity of the hGRK1 promoter and / or increasing the expression level of a target gene.

3. The application according to claim 2, wherein The hGRK1 promoter has: 1) A nucleotide sequence as shown in SEQ ID NO:11; or 2) A nucleotide sequence in which one or more bases are substituted, deleted or added in the nucleotide sequence shown in SEQ ID NO:11 and retaining the hGRK1 promoter activity; 3) A nucleotide sequence having at least 80% homology with the nucleotide sequence shown in 1) or 2).

4. Fusion expression cassette 1, characterized in that, Comprising: The gRNA, hGRK1 promoter and target gene according to claim 1.

5. Fusion expression cassette 2, characterized in that, Comprising: The gRNA, dCas9 coding sequence and VPR coding sequence according to claim 1.

6. Recombinant vector, characterized in that, Comprising: The gRNA according to claim 1; Or, the fusion expression cassette 2 according to claim 4 or 5.

7. The recombinant vector according to claim 6, wherein The recombinant vector is a eukaryotic expression vector, and the backbone of the eukaryotic expression vector is the pLentiCRISPR series.

8. The recombinant vector according to claim 6, characterized in that, The recombinant vector is a viral vector, and the viral vector includes a lentiviral vector, an adenoviral vector or an adeno-associated viral vector.

9. Carrier combination, characterized in that, Comprising the recombinant vector containing the fusion expression cassette 2 according to any one of claims 6-8 and the vector containing the hGRK1 promoter.

10. The carrier combination according to claim 9, characterized in that, The vector containing the hGRK1 promoter further includes the coding sequence of a target gene or its fragment, an antibody or its antigen-binding fragment for treating eye diseases.

11. A stable cell line with enhanced transcriptional activity of the GRK1 promoter, characterized in that, The stably transfected cell line includes any one of 1)-4): 1) The gRNA according to claim 1; 2) The fusion expression cassette 1 according to claim 4 or the fusion expression cassette 2 according to claim 5; 3) The recombinant vector according to any one of claims 6-8; 4) The vector combination according to claim 9 or 10.

12. The stable cell line according to claim 11, wherein The stably transfected cell line is derived from the HEK293T cell line.

13. Recombinant virus, characterized in that, Obtained by packaging the recombinant vector according to any one of claims 6-8 with a packaging cell.

14. The recombinant virus according to claim 13, wherein, The packaging cell includes 293T cells.

15. Use of any of the following in an in vitro verification system for preparing an ophthalmic-specific AAV drug; 1) The gRNA shown in claim 1; 2) The fusion expression cassette 1 according to claim 4 or the fusion expression cassette 2 according to claim 5; 2) The recombinant vector according to any one of claims 6-8; 3) The vector combination according to claim 9 or 10; 4) The stably transfected cell line according to claim 11 or 12; 5) The recombinant virus according to claim 13.

16. An in vitro verification system for an ophthalmic-specific AAV drug, characterized in that, Comprising any of the following: 1) The gRNA shown in claim 1; 2) The fusion expression cassette 1 according to claim 4 or the fusion expression cassette 2 according to claim 5; 2) The recombinant vector according to any one of claims 6-8; 3) The vector combination according to claim 9 or 10; 4) The stably transfected cell line according to claim 11 or 12; 5) The recombinant virus according to claim 13.

Images