Corn sheath blight disease-resistant gene GRMZM2G068455 and application thereof

By discovering and applying the corn streak blight disease-resistant gene GRMZM2G068455 and overexpressing using strong promoter-driven transgenic technology, the problems of low breeding efficiency and high cost in the prior art are solved, significantly enhancing the resistance of corn to streak blight, and providing quantifiable molecular marker selection criteria for breeding.

CN120192978AActive Publication Date: 2025-06-24CHINA AGRI UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510531216.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-25
Publication Date
2025-06-24
Estimated Expiration
2045-04-25

AI Technical Summary

Technical Problem

The prior art has problems of low efficiency, high cost and difficulty in introducing distant species or non-plant traits in breeding corn resistant blight, and has limited understanding of the pathogenic mechanism of corn trait blight.

Method used

By discovering and applying the corn streak blight disease-resistant gene GRMZM2G068455, the strong promoter-driven transgenic technology is used to overexpress, significantly increase the gene expression, and develop specific molecular markers to distinguish natural mutation sites and enhance corn's resistance to streak blight.

Benefits of technology

It significantly enhances the resistance of corn to streak blight, improves breeding efficiency, reduces development costs, and provides quantifiable molecular marker selection criteria for the creation of resistant germplasms.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192978A_ABST
    Figure CN120192978A_ABST
Patent Text Reader

Abstract

The invention provides a corn sheath blight disease-resistant gene GRMZM2G068455. The corn sheath blight disease-resistant gene GRMZM2G068455 has cDNA (complementary deoxyribonucleic acid), a coding region nucleotide sequence and a coding amino acid sequence as shown in SEQ ID NO: 1-3. The invention also provides application, the gene is over-expressed, a corn plant is subjected to genetic transformation, and the resistance of corn to banded sclerotial blight is improved; the resistance of corn to sheath blight is identified by using the difference of sheath blight resistance and susceptibility allelic genes of the corn sheath blight resistance gene GRMZM2G068455 in a corn strain; a natural variation site of an allele with the length of 831bp exists in a region of a promoter-875bp to-1705bp of a corn sheath blight resistance gene GRMZM2G068455, the allele with the length of 831bp is deleted in a corn sheath blight resistance strain, and the allele with the length of 831bp is inserted in a corn sheath blight susceptible strain. The GRMZM2G068455 gene has the advantages that the response expression of defense related genes such as the genetically transformed corn PR gene and the like with the GRMZM2G068455 gene expression quantity obviously increased is obviously increased, ROS accumulation is enhanced, the sheath blight resistance is obviously enhanced, and the GRMZM2G068455 gene plays an important role in sheath blight resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of disease-resistant genes, and particularly relates to a disease-resistant gene for maize sheath blight GRMZM2G068455 and its application. Background Art

[0002] Maize (Zea mays) is one of the important food crops. However, extreme climate disasters and the prevalence of major maize diseases often affect maize production. Therefore, it is urgent to breed new maize varieties with strong disease resistance, high yield and good quality. Maize sheath blight (BLSB) is caused by a hemibiotrophic fungus Rhizoctonia solani and is an important disease in China and Southeast Asia. Rice sheath blight caused by the same pathogen is one of the most destructive diseases of rice, which seriously affects the yield and safe production of food crops in China.

[0003] Several defense genes known to be related to R. solani resistance include genes encoding chitinase, β-1,3-glucanase, osmolysin, polygalacturonase, oxalate oxidase / decarboxylase, antimicrobial peptides, transcription factors, and genes related to plant hormone signal transduction, etc. Maize ZmFBL41 encodes an F-box protein, which enhances BLSB resistance by regulating the lignin biosynthesis pathway. However, our understanding of the mechanism of R. solani resistance in maize sheath blight is still limited, R. solani and the pathogenic mechanism of

[0004] Disadvantages of the prior art: (1) Hybrid breeding: Traditional breeding techniques are severely restricted by factors such as too long breeding cycles, low breeding efficiency, and difficult prediction of the phenotypes of hybrid offspring, etc. In addition, the narrow genetic basis of maize inbred line materials and the existence of interspecific reproductive isolation, etc., limit the improvement of specific materials to a certain extent.

[0005] (2) Molecular marker-assisted breeding (MAS): Although many quantitative trait loci have been mapped by methods such as QTL, its characteristic of relying on the molecular marker genetic map leads to the requirement of a large population size, high development cost, and it cannot be used for the introduction of traits from distant relatives or non-plant sources and the exploration of complex genetic mechanisms.

[0006] (3) Gene editing technology (taking CRIS PR / Cas9 as an example): Although the CRIS PR / Cas9 technology can be used for precise targeted editing, it also has problems such as the probability of off-target effects, high technical threshold, and low public acceptance.

[0007] Corn, a staple food crop worldwide, is often affected by sheath blight, which results in reduced yield and damaged quality. It is worth noting that the pathogen of sheath blight has cross-species infection characteristics, which brings greater challenges to disease prevention and control. In-depth research on the pathogenic mechanism of sheath blight is key to the development of new disease-resistant varieties and the improvement of crop defense capabilities. In this process, the isolation and cloning of disease-resistant genes is a prerequisite for conducting molecular mechanism research.

[0008] Compared with the traditional use of disease-resistant genes, transgenic technology using genetic engineering methods can give crops a more comprehensive range of resistance coverage and more stable genetic characteristics. In particular, genetic improvement of target disease-resistant genes through overexpression technology can not only significantly enhance the disease resistance of crops, but also effectively expand their resistance spectrum. These technical advantages are precisely what traditional hybrid breeding and conventional improvement methods cannot achieve. At present, the cultivation of disease-resistant crops based on gene cloning technology has become an important research direction in the field of agricultural biotechnology. Breaking through this technical bottleneck will provide innovative solutions for achieving sustainable prevention and control of crop diseases and reducing agricultural production losses, which is of great strategic significance for ensuring global food security. Summary of the invention

[0009] The technical problem to be solved by the present invention is to provide a corn sheath blight resistance gene in view of the deficiencies of the above-mentioned prior art. GRMZM2G068455 and its applications, the GRMZM2G068455 Genetically transformed corn with significantly increased gene expression PR The expression of defense-related genes such as genes was significantly increased, ROS accumulation was enhanced, and the resistance to sheath blight was significantly enhanced. GRMZM2G068455 Genes play an important role in resistance to sheath blight. GRMZM2G068455 The disease resistance haplotype promoter of the gene contains a 831bp natural variation site, and a set of specific molecular markers has been developed to distinguish the natural variation site. GRMZM2G068455 Transcriptional response is associated with resistance to corn sheath blight, and the deletion of the 831bp site can cause gene GRMZM2G068455 The increased expression of and enhanced resistance to corn sheath blight are key natural variation sites for corn sheath blight resistance. GRMZM2G068455 Its 831bp natural variation site is the key genetic component for breeding resistance to corn sheath blight, thus accelerating the process of breeding resistance to corn sheath blight.

[0010] In order to solve the above technical problems, the technical solution adopted by the present invention is: a corn sheath blight resistance gene GRMZM2G068455 , the maize sheath blight resistance gene GRMZM2G068455The nucleotide sequence of its cDNA is shown in SEQ ID NO: 1, the nucleotide sequence of the coding region is shown in SEQ ID NO: 2, and the encoded amino acid sequence is shown in SEQ ID NO: 3.

[0011] The present invention also provides the above-mentioned maize sheath blight resistance gene GRMZM2G068455 for use, the above-mentioned maize sheath blight resistance gene GRMZM2G068455 is overexpressed and genetically transformed into maize plants to improve the resistance of maize to sheath blight ( R. solani ).

[0012] The present invention also provides the above-mentioned maize sheath blight resistance gene GRMZM2G068455 for use, using the above-mentioned maize sheath blight resistance gene GRMZM2G068455 to identify the resistance of maize to sheath blight due to the difference in resistant and susceptible alleles of sheath blight in maize lines; In the promoter region of the maize sheath blight resistance gene GRMZM2G068455 a natural variation site of an allele with a length of 831 bp exists in the position interval of -875 bp to -1705 bp. It shows the deletion of the allele with a length of 831 bp in the maize sheath blight resistant line and the insertion of the allele with a length of 831 bp in the maize sheath blight susceptible line; this sequence with a length of 831 bp is located in the GRMZM2G068455 promoter region of the gene and does not encode an amino acid sequence; The base sequence of the first 874 bp of the nucleotide sequence of the allele with a length of 831 bp is: 831bp - cgcaaaaagatccaggccgggtccacgcgcccacgggcacgggcggggatctcctccgttgtttcctaggccgcacgccgcccacgccgcctccgtctccgtccgttcgtcgggcgcaatagagacaccacggcacgcgccgccgctcctgccctgcacttttctaccaccgaaggcgagggcgagggggccaaagacgagcgctttttcgtgcccgcctgcctgcctgctggtcattgccgctgctcacgagcctcccgccccgtgccgccctgccctctacggctctgccccaacgagccccaggggagccaggaaaaggagccgtcaaaagccgccgccgaggagagcgcgcagggtaacgaagcaccatctcctctccttgcccttcttcgattaggttggatcccagccgccgtcgctgcaggtgggatctcctccgtttttgcttcctctcagtcgttccttcgctcgggccgtgtgtagatctgcacgttccctgtagaattctcctggtcggttccattcctctccgtcatattctcagtagatactacgtttcatgccttgtccgggtattagattatgcttcgaaaggcaatttggtctaggtgtgtagctcgatttgttagtgatggcaaataggaatggtggcctcattttcaatagagttggcaagtcaggcaagttagggaactcaatcatatgatctattttgttgaacgattcacgttatagatcacctgcttgatacacgtttcattcttggctcttactgcttctaaatccagttcttcaagatatcctctgtcttgaattatcttctgcctcacctgcatatgtgcctgacggaactttgttgctgcagtcaggc - ATG; The base sequence of the last 181 bp after the nucleotide sequence of the allele with a length of 831 bp is: gtccaaaccgcaatggcgttcccctgcgtgcgttccaccgtacacggcaccaccacgtcgcgggatattgccgaatccgtcggcttctacctggctggctggccgtgcgcgccccacttttacgcagctccaaacacccggcgcaccagggccgccagtccgccactcgcacggcggcgct - 831 bp; Full gene GRMZM2G068455 831 bp corresponding sequence (SEQ ID NO:25): 5’-ataggtgtacattcgggccgcccggtttggctcggttcaagcccgaaaaggcccgtattatttgaatttcgggccggtccggcccgtttgaattttgggctgtgctggaccggcccacgggcctagctctcggcccacggcccggcccgtaattacttaaacgtgccgggctcatttcgggcggaccgaaattataaaagcccgaaattcacattagggcccgaaatacattttttggcccaagattcagtttttggtccgaaattcacatcaagacccgaaattcaaaacaaatttaataaaacaaataaaagataagacaaatacatttgaccaaaagcaaacttaatatttgtattaagtaacatagctatgcaatgactacctcgtttacaaatcattttgttaaaaagaaaaagagtataatcagctctatataaagtttgtaagttcagttcattatctaatgttcataaaaaaaataaaattatatcacatactctaattcaaagctataaaaaacatctaactaacattatctctagctttgtgtttttatcaagtacatgaaaatgtggaatgaagtgtgattttaataaatatatgggcctttttgtgcctctatatgggccatttcgtgcctgccttaaatgggtcgtgttcatgcccgcccatgggtcacgacatcggcccaaacccggctcgatatatcgtgccgtgccggcccggcactaaattattttgtgtcgtctgtgtctgggtcgtgcttttttttcgtacttcgggccagcccatcaggcccggcccaaatgtacacctataggccgtcct-3’; The above complete gene GRMZM2G068455 The promoter region sequence, the sequence corresponding to the allele with a length of 831 bp, the base sequence of 874 bp before the 831 bp sequence, and the base sequence of 181 bp after the 831 bp sequence are all in sequence SEQ ID No.11GRMZM2G068455 The B73 genomic sequence contains. In addition to the above, SEQ ID No. 11 GRMZM2G068455 The B73 genomic also contains CDS sequences and 3'UTR sequences.

[0013] Preferably, primers 17 and 18 are used to detect the natural variation sites of the 831bp allele between the maize sheath blight resistant lines and the susceptible lines; The nucleotide sequence of primer 17 is shown in SEQ ID NO: 23, and the nucleotide sequence of primer 18 is shown in SEQ ID NO: 24.

[0014] Preferably, the PCR reaction system for the detection is: 2×T8 High-Fidelity Master Mix 10 μL, 10 μM primer 17 0.5 μL, 10 μM primer 18 0.5 μL, DNA template 1 μL, supplemented with ddH2O to 20 μL; The PCR reaction program is: pre-denaturation at 98°C for 2 min; 98°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 30 cycles; final extension at 72°C for 5 min; The identification result is: the band with the 831 bp natural variation site is 969 bp, which is identified as the maize sheath blight susceptible allele line; while the band lacking the 831 bp natural variation site is 138 bp, which is identified as the maize sheath blight resistant allele line; the line with both 969 bp and 138 bp bands is identified as the heterozygous line.

[0015] The present invention has the following advantages compared with the prior art: 1. Enhance the resistance of maize to sheath blight The present invention provides a maize sheath blight resistance gene GRMZM2G068455 through the functional verification and application, and uses the strong promoter-driven transgenic technology to GRMZM2G068455 genetically transform the maize plant ND101 with the overexpression vector of the gene, and find that GRMZM2G068455 the genetically transformed maize with significantly increased gene expression has significantly enhanced resistance to sheath blight, PR the expression of defense-related genes such as the gene is significantly increased, and the ROS accumulation is significantly enhanced, proving that GRMZM2G068455 the gene plays an important role in the resistance to sheath blight.

[0016] 2. Discover the disease resistance gene GRMZM2G068455 The natural variation site of 831 bp in the promoter region is associated with the resistance of maize to sheath blight The core discovery of the present invention is that through the phenotypic-genotypic association analysis of the HIF line population, it shows thatGRMZM2G068455 The 831bp natural variation in the gene promoter region is regulated GRMZM2G068455 The transcriptional response level of maize directly determines the sensitivity of maize to Rhizoctonia solani R.solani Of particular note is the clear correspondence between the resistance allele (831bp deletion) and the susceptible allele (831bp presence), which provides a quantifiable molecular marker selection standard for the creation of resistant germplasm. This invention systematically reveals the complete regulatory pathway of "structural variation-gene expression-disease resistance phenotype" of the 831bp natural variation site through the coordinated analysis of field phenotypic verification and transcriptional level response, providing an innovative technical paradigm for the molecular design breeding of crop disease resistance.

[0017] 3. Improve the economic and ecological benefits of corn crop production The present invention effectively enhances the resistance of corn to sheath blight by analyzing the key resistance genes of corn sheath blight. The application of this transgenic technology system not only alleviates the threat of diseases to grain yield and nutritional quality, but also greatly reduces the application of chemical pesticides by establishing an endogenous disease resistance mechanism, thereby reducing the risk of agricultural residue pollution and promoting the sustainable operation of farmland ecosystems. From the perspective of production practice, the long-lasting resistance obtained by crops means that plants have obtained stable expression of excellent genetic traits, which ensures yield and guarantees food safety production.

[0018] The present invention is further described in detail below with reference to the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Genes of maize susceptible material B73 and maize resistant material CML496 in Example 1 of the present invention after inoculation with Rhizoctonia solani GRMZM2G068455 Transcriptional level response detection diagram.

[0020] Figure 2 In Example 3 of the present invention GRMZM2G068455 Overexpression in T1 generation genetically transformed maize plants ( GRMZM2G068455- The gene expression levels in OE1 and OE2 were significantly increased.

[0021] Figure 3 In Example 3 of the present invention GRMZM2G068455 Overexpression in T1 generation genetically transformed maize plants ( GRMZM2G068455- OE1, OE2) Schematic diagram of disease phenotype (left) and statistics of lesion length (right) 10 days after inoculation with sheath blight pathogen.

[0022] Figure 4 In Example 4 of the present invention GRMZM2G068455 Overexpression in T1 generation genetically transformed maize plants ( GRMZM2G068455- OE1, OE2) 36 hours after inoculation with Rhizoctonia solaniPR Detection chart of transcriptional responses of defense-related genes such as genes

[0023] Figure 5 For the overexpression in Example 5 of the present invention GRMZM2G068455 T1 generation genetically transformed maize plants ( GRMZM2G068455- OE) Detection chart of the content of reactive oxygen species (H2O2) (A) and the detection chart of ROS accumulation level (B) after inoculating Rhizoctonia solani for 36 hours

[0024] Figure 6 For Example 6 of the present invention GRMZM2G068455 Schematic diagram of re-sequencing analysis of disease-resistant allele genotype (CML496) and susceptible allele genotype (B73) of genes

[0025] Figure 7 For the genotype-phenotype association analysis (A) and the detection chart of transcriptional response level (B) of 3 heterozygous inbred lines (HIF) of the BC2RILs population in Example 7 of the present invention

[0026] Figure 8 Schematic diagram of molecular markers specifically detecting 831bp natural variation (A), its distribution evaluation (B) for 302 maize germplasms, and genotype-phenotype association analysis (C) chart in Example 8 of the present invention Detailed implementation manners

[0027] Example 1

[0028] This example is GRMZM2G068455 Expression pattern of genes after inoculating Rhizoctonia solani

[0029] In order to detect GRMZM2G068455Expression pattern of the gene induced by Rhizoctonia solani. The expression after inoculation with the pathogen was detected by qRT-PCR. The primers used were primer 3, 5′-TGGCCATGCTGGAATCACAA-3′, whose sequence is shown in SEQ ID NO:6, and primer 4, 5′-CGCACGGAGAGAAGACTCAA-3′, whose sequence is shown in SEQ ID NO:7. RNA was extracted from the disease-resistant material CML496 and the disease-susceptible material B73 (material B73 is from the literature Tian, T., Wang, S., Yang, S. et al. Genome assembly and genetic dissection of a prominent drought-resistant maize germplasm. Nat Genet 55, 496-506 (2023); material CML496 is from the literature Lv M, Deng C, Li X, Zhao X, Li H, Li Z, Tian Z, Leonard A, Jaqueth J, Li B, Hao J, Chang Y, Ding J. Identification and fine-mapping of RppCML496 , a major QTL for resistance to Puccinia polysora in maize. Plant Genome. 2021 Mar;14(1):e20062) at 0 h, 12 h, 24 h, 48 h, and 72 h after inoculation with Rhizoctonia solani, and cDNA was obtained by reverse transcription. Using cDNA as a template, fluorescence quantitative PCR amplification was carried out.

[0030] The reaction system for fluorescence quantitative PCR was as follows: 10 μl of 2×Real Fast SYBR qPCR Mix (Low ROX) (Huayu Biotechnology), 0.5 μl of 10 μM upstream primer 1, 0.5 μl of 10 μM downstream primer 2, 2 μl of cDNA template, and supplemented with ddH2O to 20 μl.

[0031] The reaction program for fluorescence quantitative PCR was: pre-denaturation at 95°C for 2 min; 95°C for 15 sec, 60°C for 30 sec, for 40 cycles. The 2^ -ΔΔCt method was used to calculate the relative expression level of the gene.

[0032] After fluorescence quantitative PCR, the analysis results showed that in the disease-susceptible maize variety B73 and the disease-resistant variety CML496 GRMZM2G068455 the gene could be induced by Rhizoctonia solani R. solaniInduction, where the disease-resistant material CML496 and the disease-susceptible material B73 reached the peak gene expression levels 24 hours after inoculation, and then decreased. However, it is worth noting that the peak of the transcriptional response of the gene GRMZM2G068455 induced by Rhizoctonia solani in the disease-resistant material CML496 was much higher than that in the disease-susceptible material B73 ( GRMZM2G068455 ), indicating that this gene is involved in the resistance response of maize to Rhizoctonia solani. Figure 1 )

[0033] Example 2

[0034] This example is for isolating and cloning GRMZM2G068455 gene.

[0035] According to the gene sequence in the database Maize GDB GRMZM2G068455 primers were designed. Primer 1, 5′-ATGGCATCAACCGTTACCTT-3′ with its sequence shown in SEQ ID NO:4, and primer 2, 5′- AACAGATGCAGCAGCTTCCC-3′ with its sequence shown in SEQ ID NO:5, were used to obtain GRMZM2G068455 gene. Maize B73 RNA was extracted and cDNA was obtained by reverse transcription. Using cDNA as a template, PCR amplification was carried out.

[0036] The PCR reaction system was: 2×T8 High-Fidelity Master Mix (Tsingke Biological) 25ul, 10uM upstream primer 1 2ul, 10uM downstream primer 2 2ul, cDNA template 1ul, and ddH2O was added to make up to 50ul.

[0037] The PCR reaction program was: pre-denaturation at 98℃ for 2 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min 30sec, for 32 cycles; final extension at 72℃ for 5 min.

[0038] After PCR, the amplified fragment was recovered and purified using the DNA recovery kit from Tsingke Biological Co., Ltd., and then the purified DNA fragment was ligated into the vector CAUC2829-Ubi (provided by the Crop Functional Genomics and Molecular Breeding Center of China Agricultural University), transformed E.coli DH5ɑ competent cells, positive clones were selected for plasmid extraction, and sequencing was completed by Tsingke Biological, obtaining a GRMZM2G068455 fragment with a length of 1191 bp and having the DNA sequence of SEQ ID NO:2.

[0039] Example 3

[0040] This example is for GRMZM2G068455 functional verification of the gene.

[0041] The above purified cDNA fragment was ligated into the overexpression vector CAUC2829 by homologous recombination and transformed into competent DH5α cells by heat shock. E.coli After colony PCR of the recombinant colonies and detection by agarose gel electrophoresis, the recombinant colonies contained bands of the same size as the target fragment. After expanding the culture of the identified recombinant colonies and extracting the plasmids, the plasmids were sequenced and compared with the original sequences. The ligated fragment was the full-length cDNA without base mutations or deletions, proving that GRMZM2G068455 the overexpression vector CAUC2829-Ubi:: GRMZM2G068455 was successfully constructed.

[0042] Genetic transformation of the overexpression vector was carried out at the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University. The overexpression vector was introduced into the maize variety ND101 (the maize variety ND101 is from the literature Liu, C., He, S., Chen, J., Wang, M., Li, Z., Wei, L., Chen, Y., Du, M., Liu, D., Li, C., An, C., Bhadauria, V., Lai, J. and Zhu, W. (2024), A dual-subcellular localized β-glucosidase confers pathogen and insect resistance without a yield penalty in maize. Plant Biotechnol. J, 22: 1017-1032.). The obtained maize genetic transformation plants were named GRMZM2G068455 -T1. A total of 17 independent transformation plants were obtained in this invention, among which 9 were positive plants. The gene GRMZM2G068455 expression levels in the detected positive plants ( GRMZM2G068455- OE1, OE2) were significantly increased ( GRMZM2G068455 ). About 40 individual plants of each of the two transgenic lines Figure 2 OE1 and OE2 in the T1 generation were inoculated and identified with Rhizoctonia solani of maize. The results showed that 10 days after inoculation with Rhizoctonia solani, the disease symptoms of the T1 generation genetic transformation plants with overexpression GRMZM2G068455- were significantly reduced compared with the wild type. The average lesion length was shortened by 9.75 cm and 9.51 cm, and the average lesion length was reduced by about 37.3% (Table 1, R. solani ), indicating that GRMZM2G068455 was involved in the resistance response of maize to Rhizoctonia solani. Figure 3 ) GRMZM2G068455

[0043] Table 1 GRMZM2G068455 Statistical results of the lesion lengths of the sheath blight inoculated on the transgenic plants overexpressing the vector in the field

[0044] Note: "-" in the table indicates that there is no statistical data for the plants.

[0045] Example 4 This example is for overexpression GRMZM2G068455 T1 generation genetically transformed plants PR Gene detection.

[0046] For the overexpression GRMZM2G068455 T1 generation genetically transformed plants, after inoculation with Rhizoctonia solani for 24 hours PR The response expression levels of defense-related genes such as gene, using primer 7, 5′-TGTGCATGCACCTATATGTACT-3′ whose sequence is shown in SEQ ID NO:12, primer 8, 5′-TTCGTGAGACATGACGATACAT-3′ whose sequence is shown in SEQ ID NO:13 to detect gene ZmPR4 ( Zm00001d048949 , NCBI accession number: LOC100191593), using primer 9, 5′-AGATCACTAAAGCCAAGGAGTC-3′ whose sequence is shown in SEQ ID NO:14, primer 10, 5′-CATGGTCTAGTTGTAGGCTTCC-3′ whose sequence is shown in SEQ ID NO:15 to detect gene ZmPR10 ( Zm00001d028816 , NCBI accession number: LOC103634525), using primer 11, 5′-CCTACGGCGAGAACCTCTT-3′ whose sequence is shown in SEQ ID NO:16, primer 12, 5′- TCGTAGTACTGCTTCTCGGAC-3′ whose sequence is shown in SEQ IDNO:17 to detect gene ZmPR1 ( Zm00001d018738 , NCBI accession number: LOC542352), using primer 13, 5′-AAGGACCTGCTGGTGGAG-3′ whose sequence is shown in SEQ ID NO:18, primer 14, 5′- CTGCTTGTTGTCGACGCT-3′ whose sequence is shown in SEQ ID NO:19 to detect gene ZmAOS1 ( Zm00001d048021, NCBI accession number: LOC542150), using primer 15, 5′-CCATCCCTCCGTAGTTAGCTTCT-3′ whose sequence is shown in SEQ ID NO:20, primer 16, 5′- CCTGTCGGCCAAGGCTATATAC-3′ whose sequence is shown in SEQ ID NO:21 to detect the maize reference gene 18S. Extract the RNA of the overexpressed GRMZM2G068455 positive T1 generation transgenic plants ( GRMZM2G068455- OE1, OE2) and the background material ND101 after inoculation with Rhizoctonia solani for 24 hours, and obtain cDNA by reverse transcription. Using the cDNA as a template, perform fluorescence quantitative PCR amplification.

[0047] The fluorescence quantitative PCR reaction system is: 2×Real Fast SYBR qPCR Mix (Low ROX) (Huayu Biology) 10 ul, 10 uM upstream primer 1 0.5 ul, 10 uM downstream primer 2 0.5 ul, cDNA template 2 ul, supplemented with ddH2O to 20 ul.

[0048] The fluorescence quantitative PCR reaction program is: pre-denaturation at 95℃ for 2 min; 95℃ for 15 sec, 60℃ for 30 sec, 40 cycles. The relative gene expression level was calculated by the 2^-ΔΔCt method.

[0049] After the fluorescence quantitative PCR, data analysis found that compared with the background material ND101, the overexpressed GRMZM2G068455 T1 generation plants ( GRMZM2G068455- OE1, OE2) the defense-related genes: ZmPR4 ( Zm00001d048949 , NCBI accession number: LOC100191593), ZmPR10 ( Zm00001d028816 , NCBI accession number: LOC103634525), ZmPR1 ( Zm00001d018738 , NCBI accession number: LOC542352), ZmAOS1 ( Zm00001d048021 , NCBI accession number: LOC542150) were significantly increased after inoculation with Rhizoctonia solani for 24 hours ( Figure 4 ), indicating that the immune defense pathway related to Rhizoctonia solani resistance in the overexpressed GRMZM2G068455 plants was induced and responded, thus conferring resistance to maize sheath blight.

[0050] Example 5 This example is for the detection of ROS in the overexpressed GRMZM2G068455 positive T1 generation transgenic plants.

[0051] Overexpression GRMZM2G068455 The accumulation level of reactive oxygen species (H2O2) in T1 generation genetically transformed plants was detected 36 hours after inoculation with Rhizoctonia solani. The content of hydrogen peroxide (H2O2) was detected using a hydrogen peroxide (H2O2) content detection kit (Solarbio BC3595-100T / 96S). GRMZM2G068455- The H2O2 content of OE1 and OE2 plants and the background material ND101 after inoculation with Rhizoctonia solani was detected. It was found that compared with the background material ND101, GRMZM2G068455- the H2O2 content in OE1 and OE2 plants increased significantly 36 hours after inoculation with Rhizoctonia solani ( Figure 5 A). At the same time, the DAB staining method (Wang Yue, J., Yang, N. et al. An ERAD-relatedubiquitin-conjugating enzyme boosts broad-spectrum disease resistance andyield in rice. Nat Food 4, 774–787 (2023).) was used to perform DAB staining on OE plants and background ND101 plants. Similarly, it was found that compared with the background material ND101, GRMZM2G068455- the ROS accumulation in OE1 and OE2 plants was significantly enhanced ( Figure 5 B).

[0052] Example 6

[0053] This example was to GRMZM2G068455 perform re-sequencing analysis on the disease-resistant haplotype and susceptible haplotype of the gene.

[0054] Using primer 5, 5′-GTCCAAACCGCAATGGCGTT-3′ whose sequence is shown in SEQ ID NO:8, and primer 6, 5′-GCCTCTTTGTAGTTTGTAGACTCC-3′ whose sequence is shown in SEQ ID NO:9, for this gene GRMZM2G068455 re-sequencing of the disease-resistant and susceptible haplotypes was performed and it was found that GRMZM2G068455 compared with the promoter region of the susceptible allele line of the gene (represented by the susceptible material B73, sequence shown in SEQ ID NO:11), there was generally a large fragment deletion of 831 bp in the promoter region of the disease-resistant allele line of the gene (represented by the disease-resistant material CML496, sequence shown in SEQ ID NO:10) ( Figure 6 ), that is GRMZM2G068455 the ecotype material with an 831 bp deletion in the promoter region of the gene showed resistance to Rhizoctonia solani.

[0055] At the same time, the results in Example 1 showed that in the disease-resistant material CML496, the gene GRMZM2G068455The peak of the transcriptional expression induced by the infection of Rhizoctonia solani is much higher than that in the susceptible material B73, that is GRMZM2G068455 The transcriptional response level of the ecotype material with an 831bp deletion in the promoter region of the

[0056] Using the maize sheath blight resistance gene GRMZM2G068455 There are differences in the resistant and susceptible alleles of sheath blight in maize lines, and the resistance of maize to sheath blight is identified; In the promoter region of the maize sheath blight resistance gene GRMZM2G068455 There is a natural variation site of an allele with a length of 831bp in the position interval of -875bp to -1705bp. In the maize sheath blight resistant lines, it shows the deletion of the allele with a length of 831bp, and in the maize sheath blight susceptible lines, it shows the insertion of the allele with a length of 831bp; the sequence with a length of 831bp is located in the GRMZM2G068455 promoter region and does not encode an amino acid sequence; The base sequence of the first 874 bp of the nucleotide sequence of the allele with a length of 831 bp is as follows: 831bp - cgcaaaaagatccaggccgggtccacgcgcccacgggcacgggcggggatctcctccgttgtttcctaggccgcacgccgcccacgccgcctccgtctccgtccgttcgtcgggcgcaatagagacaccacggcacgcgccgccgctcctgccctgcacttttctaccaccgaaggcgagggcgagggggccaaagacgagcgctttttcgtgcccgcctgcctgcctgctggtcattgccgctgctcacgagcctcccgccccgtgccgccctgccctctacggctctgccccaacgagccccaggggagccaggaaaaggagccgtcaaaagccgccgccgaggagagcgcgcagggtaacgaagcaccatctcctctccttgcccttcttcgattaggttggatcccagccgccgtcgctgcaggtgggatctcctccgtttttgcttcctctcagtcgttccttcgctcgggccgtgtgtagatctgcacgttccctgtagaattctcctggtcggttccattcctctccgtcatattctcagtagatactacgtttcatgccttgtccgggtattagattatgcttcgaaaggcaatttggtctaggtgtgtagctcgatttgttagtgatggcaaataggaatggtggcctcattttcaatagagttggcaagtcaggcaagttagggaactcaatcatatgatctattttgttgaacgattcacgttatagatcacctgcttgatacacgtttcattcttggctcttactgcttctaaatccagttcttcaagatatcctctgtcttgaattatcttctgcctcacctgcatatgtgcctgacggaactttgttgctgcagtcaggc - ATG; The base sequence of the last 181 bp of the nucleotide sequence of the allele with a length of 831 bp is: gtccaaaccgcaatggcgttcccctgcgtgcgttccaccgtacacggcaccaccacgtcgcgggatattgccgaatccgtcggcttctacctggctggctggccgtgcgcgccccacttttacgcagctccaaacacccggcgcaccagggccgccagtccgccactcgcacggcggcgct-831bp; Complete gene GRMZM2G068455 The 831 bp corresponding sequence is as follows (SEQ ID NO:25): 5’-ataggtgtacattcgggccgcccggtttggctcggttcaagcccgaaaaggcccgtattatttgaatttcgggccggtccggcccgtttgaattttgggctgtgctggaccggcccacgggcctagctctcggcccacggcccggcccgtaattacttaaacgtgccgggctcatttcgggcggaccgaaattataaaagcccgaaattcacattagggcccgaaatacattttttggcccaagattcagtttttggtccgaaattcacatcaagacccgaaattcaaaacaaatttaataaaacaaataaaagataagacaaatacatttgaccaaaagcaaacttaatatttgtattaagtaacatagctatgcaatgactacctcgtttacaaatcattttgttaaaaagaaaaagagtataatcagctctatataaagtttgtaagttcagttcattatctaatgttcataaaaaaaataaaattatatcacatactctaattcaaagctataaaaaacatctaactaacattatctctagctttgtgtttttatcaagtacatgaaaatgtggaatgaagtgtgattttaataaatatatgggcctttttgtgcctctatatgggccatttcgtgcctgccttaaatgggtcgtgttcatgcccgcccatgggtcacgacatcggcccaaacccggctcgatatatcgtgccgtgccggcccggcactaaattattttgtgtcgtctgtgtctgggtcgtgcttttttttcgtacttcgggccagcccatcaggcccggcccaaatgtacacctataggccgtcct-3’; The above complete gene GRMZM2G068455 The promoter region sequence, the sequence corresponding to the allele with a length of 831 bp, the base sequence of 874 bp before the 831 bp sequence, and the base sequence of 181 bp after the 831 bp sequence are all in sequence SEQ ID No.11GRMZM2G068455 The B73 genomic sequence contains, in addition to the above, SEQ ID No. 11 GRMZM2G068455 The B73 genomic also contains the CDS sequence and the 3' UTR sequence.

[0057] Example 7 In this example, genotype-phenotype association analysis and transcriptional response level detection were performed on three heterozygous inbred lines (HIF) of the BC2RILs population.

[0058] The BC2RILs population (the BC2RILs population and the material Lx9801 are both from the literature Lv M, Deng C, Li X, Zhao X, Li H, Li Z, Tian Z, Leonard A, Jaqueth J, Li B, Hao J, Chang Y, Ding J. Identification and fine-mapping of RppCML496 , a major QTL for resistance to Puccinia polysora in maize. Plant Genome. 2021 Mar;14(1):e20062.) from the resistant line CML496 and the susceptible line Lx9801 was used for phenotype-gene association analysis. Sequencing analysis was performed using primer 5, 5′-GTCCAAACCGCAATGGCGTT-3′ whose sequence is shown in SEQ ID NO:8, and primer 6, 5′-GCCTCTTTGTAGTTTGTAGACTCC-3′ whose sequence is shown in SEQ ID NO:9, showing that Lx980I and the representative susceptible ecotype B73 contain the same GRMZM2G068455 promoter and coding sequence (whose sequence is shown in SEQ IDNO:22).

[0059] In this BC2RILs population, the present invention identified three heterozygous inbred lines (HIF) - CG2395, CG2350 and CG2453, all of which are separated in the GRMZM2G068455 promoter region. After inoculating the above three HIF inbred lines in the field with R. solani it was found that CG2395 and CG2350 showed a genotype-phenotype correlation, and they were separated in the 831bp region, while CG2453 had no correlation and was separated in the 39bp region ( Figure 7A). At the same time, it was found that the HIF lines with an 831 bp deletion in CG2350 CB and CG2395 CB (CG2350 CB and CG2395 CB are resistant allele lines identified in the BC2 RILs population in this study by primers 17 and 18. The nucleotide sequence of primer 17 is shown in SEQ ID NO: 23, and the nucleotide sequence of primer 18 is shown in SEQ ID NO: 24) showed significantly enhanced resistance to sheath blight of maize ( Figure 7 A). The expression of genes in CG2395 CB and CG2395 BB (CG2395 CB and CG2395 BB are disease-resistant and disease-susceptible allele lines identified in the BC2 RILs population in this study by primers 17 and 18. The nucleotide sequence of primer 17 is shown in SEQ ID NO: 23, and the nucleotide sequence of primer 18 is shown in SEQ ID NO: 24) GRMZM2G068455 after inoculation with Rhizoctonia solani for 24 hours was detected by qRT-PCR. The primers used were primer 3, 5′-TGGCCATGCTGGAATCACAA-3′, whose sequence is shown in SEQ ID NO: 6, and primer 4, 5′-CGCACGGAGAGAAGACTCAA-3′, whose sequence is shown in SEQ ID NO: 7. The result analysis showed that compared with CG2395 BB, the CG2395 CB HIF line (the CG2395 CB line was identified and isolated in the RIL line and is called the HIF line) R.solani after GRMZM2G068455 showed a significantly increased transcriptional response ( Figure 7 B). The above results indicate that GRMZM2G068455 the natural variation of 831 bp in the promoter region of the GRMZM2G068455 gene is the reason for the difference in transcriptional response level of the

[0060] Example 8 This example is to develop a set of molecular markers for specifically detecting the 831 bp natural variation to evaluate maize germplasm and perform genotype-phenotype association analysis.

[0061] In addition, the present invention developed a molecular marker to effectively distinguish the 831 bp natural variation between maize sheath blight-resistant lines and disease-susceptible lines. The primers used were primer 17, 5′-TTACGCAGCTCCAAACACCC-3′, whose sequence is shown in SEQ ID NO: 23, and primer 18, 5′- GTGCGGCCTAGGAAACAACG-3′, whose sequence is shown in SEQ ID NO: 24, which can effectively distinguish resistant alleles and susceptible alleles ( Figure 8A). The electrophoresis results are as Figure 8 shown in A. The band with the natural variation site of 831 bp is 969 bp, which is identified as the susceptible allele line (+831 bp); while the band lacking the natural variation site of 831 bp is 138 bp, which is identified as the resistant allele line (△831 bp); the line with both 969 bp and 138 bp bands is identified as the heterozygous line (Het).

[0062] By screening 302 maize germplasms, it was found that 128 maize materials carried the disease-resistant allele with a deletion of 831 bp, 147 maize materials carried the susceptible allele with the presence of 831 bp, and 27 were of the heterozygous type ( Figure 8 B). Genotype-phenotype association analysis showed that compared with the plants carrying the susceptible allele of 831 bp, the plants carrying the resistant allele with a deletion of 831 bp showed R. solani higher resistance to Figure 8 C), which further indicated that the deletion of 831 bp confers resistance to sheath blight in maize.

[0063] The PCR reaction system was as follows: 10 μL of 2×T8 High-Fidelity Master Mix (Qingke Biotech), 0.5 μL of 10 μM primer 17 (SEQ ID NO:23), 0.5 μL of 10 μM primer 18 (SEQ ID NO:24), 1 μL of DNA template, and made up to 20 μL with ddH2O.

[0064] The PCR reaction program was: pre-denaturation at 98°C for 2 min; 98°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, for 30 cycles; termination and extension at 72°C for 5 min.

[0065] Identification results: The band with the natural variation site of 831 bp is 969 bp, which is identified as the susceptible allele line; while the band lacking the natural variation site of 831 bp is 138 bp, which is identified as the resistant allele line; the line with both 969 bp and 138 bp bands is identified as the heterozygous line.

[0066] In summary, the present invention has the following technical innovations: (1) GRMZM2G068455 Enhanced resistance to sheath blight in maize plants by genetic transformation with an overexpression vector By providing a functional verification and application of a maize sheath blight resistance gene GRMZM2G068455 in the present invention, using the transgenic technology driven by a strong promoter to genetically transform the overexpression vector of the GRMZM2G068455 gene into maize plants ND101, it was found that GRMZM2G068455The genetic transformation maize with significantly increased gene expression shows significantly enhanced resistance to sheath blight, proving that GRMZM2G068455 the gene plays an important role in resistance to sheath blight.

[0067] (2)Analysis of the 831bp key natural variation site.

[0068] Based on the fine mapping of the HIF line population, the core regulatory role of the 831bp natural variation site in the promoter region was revealed. GRMZM2G068455

[0069] (3)Genotype-phenotype association analysis.

[0070] The disease-resistant allele lines (CG2395 / CG2350) carrying the 831bp deletion showed a 1.82 - 2.06-fold increase in field resistance, and the transcriptional response level was 2.62 times higher than that of the susceptible type (831bp present).

[0071] (4)Develop a set of specific molecular markers Specific molecular markers were designed to achieve rapid detection of resistant / susceptible alleles. Verification of 302 maize germplasms showed that the proportion of disease-resistant types was 42.4% (128 / 302), providing a high-throughput screening method for marker-assisted selection breeding.

[0072] The above are only the preferred embodiments of the present invention and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments based on the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.​

Claims

1. A gene for resistance to sheath blight in maize GRMZM2G068455 , characterized in that, Maize sheath blight resistance gene GRMZM2G068455 The nucleotide sequence of the cDNA is shown in SEQ ID NO:1, the nucleotide sequence of the coding region is shown in SEQ ID NO:2, and the encoded amino acid sequence is shown in SEQ ID NO:

3.

2. A maize sheath blight resistance gene as claimed in claim 1 GRMZM2G068455 The application is characterized in that Maize sheath blight resistance gene GRMZM2G068455 Overexpression and genetic transformation of corn plants to improve corn resistance to sheath blight.

3. A maize sheath blight resistance gene as claimed in claim 1 GRMZM2G068455 The application is characterized in that The maize sheath blight resistance gene GRMZM2G068455 There are differences in the resistance and susceptible alleles of sheath blight in maize lines, and the resistance of maize to sheath blight is identified; Sheath blight resistance genes in maize GRMZM2G068455 In the promoter region, there is a natural variation site of an allele with a length of 831 bp in the position interval -875 bp to -1705 bp, which is manifested as a deletion of the allele with a length of 831 bp in the corn sheath blight resistant strain and as an insertion of the allele with a length of 831 bp in the corn sheath blight susceptible strain; Complete gene GRMZM2G068455 The 831 bp corresponding sequence is shown in SEQ ID NO:

25.

4. The use according to claim 3, using primers 17 and 18 to detect the natural variation site of the allele with a length of 831 bp between the corn sheath blight resistant strain and the susceptible strain; The nucleotide sequence of primer 17 is shown as SEQ ID NO: 23, and the nucleotide sequence of primer 18 is shown as SEQ ID NO:

24.

5. The use according to claim 4, characterized in that: The PCR reaction system for the detection is: 2×T8 High-Fidelity Master Mix 10 μL, 10 μM primer 17 0.5 μL, 10 μM primer 18 0.5 μL, DNA template 1 μL, ddH2O supplemented to 20 μL; The PCR reaction program was as follows: pre-denaturation at 98°C for 2 min; 30 cycles of 98°C for 30 sec, 60°C for 30 sec, and 72°C for 30 sec; termination extension at 72°C for 5 min; The identification results were as follows: the band with the 831 bp natural variation site was 969 bp, which was identified as a strain with the susceptible allele of corn sheath blight; the band with the 831bp natural variation site missing was 138 bp, which was identified as a strain with the resistant allele of corn sheath blight; the strain with both 969bp and 138bp bands was identified as a heterozygous strain.

Citation Information

Patent Citations

  • Cloning and application of promoter sequence of corn malate dehydrogenase gene

    CN101979551A

  • Malate dehydrogenase MDH as well as coding gene and application thereof

    CN114645026A

  • Transcription factors of cereals

    US20070089180A1