Primer, probe, kit and detection method for quantitatively detecting streptococcus pneumoniae

Abstract

The invention belongs to the field of molecular diagnostic biology, and relates to a primer, a probe, a kit and a detection method for quantitatively detecting streptococcus pneumoniae, the primer comprises an upstream primer for detecting streptococcus pneumoniae, a downstream primer for detecting streptococcus pneumoniae, an internal control gene upstream primer and an internal control gene downstream primer, the probe comprises a streptococcus pneumoniae detection probe and an internal control gene probe; the nucleotide sequence of the upstream primer for detecting the streptococcus pneumoniae is as shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer for detecting the streptococcus pneumoniae is as shown in SEQ ID NO: 2; the nucleotide sequence of the upstream primer of the internal control gene is as shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer of the internal control gene is as shown in SEQ ID NO: 4; the nucleotide sequence of the streptococcus pneumoniae detection probe is as shown in SEQ ID NO: 5, and the nucleotide sequence of the internal control gene probe is as shown in SEQ ID NO: 6. According to the application, the sensitivity and accuracy of streptococcus pneumoniae detection can be improved; operation is simple and detection efficiency is high.

Description

Technical Field

[0001] This application relates to the technical field of molecular diagnostic biology, and particularly relates to a primer, a probe, a kit for quantitatively detecting Streptococcus pneumoniae, and a detection method thereof. Background Art

[0002] Streptococcus pneumoniae (SP) is a Gram-positive bacterium belonging to the genus Streptococcus of the family Streptococcaceae. It was separately isolated and discovered from patients' sputum in France and the United States in 1881. Humans are the only hosts for Streptococcus pneumoniae infection, which is mainly transmitted through frequent close contact and droplets and colonizes the oropharynx of humans. The main infected populations are the elderly over 65 years old and children under 5 years old. As an opportunistic pathogen, Streptococcus pneumoniae can cause diseases or colonize the oronasopharynx of normal people, resulting in no obvious incubation period during the process from infection to onset. When the body's immunity declines, especially after being infected with other respiratory viruses, it is prone to cause corresponding symptoms. According to whether it penetrates the mucosal system into the blood during the infection process, the diseases caused by it can be divided into non-invasive SP infections (such as: otitis media, sinusitis, community-acquired pneumonia, etc.) and invasive SP infections (such as: invasive pneumonia, sepsis, meningitis, etc.). Among them, severe pneumonia caused by invasive SP infection is the leading cause of death in children under 5 years old in China.

[0003] As the main pathogenic factor of Streptococcus pneumoniae, the structure of its capsular polysaccharide is closely related to its serotype classification. According to different antigenicity, Streptococcus pneumoniae can be divided into about 100 serotypes. Streptococcus pneumoniae of different serotypes have different pathogenicities, and their distribution laws of each serotype are not consistent worldwide. The serotypes that are more prevalent in China are 6B, 19A, 19F, and 23F. Therefore, appropriate treatment should be given as soon as possible for Streptococcus pneumoniae infection according to different conditions. With the progress of technology, various new detection methods have been applied to the detection of pathogenic bacteria. Currently, the commonly used methods for detecting Streptococcus pneumoniae are:

[0004] (1) In vitro pathogen isolation and culture: The collected samples are inoculated on a sheep blood agar medium plate and cultured at 37°C and 5% CO2 for 12 - 36 h. Then, grayish-white umbilicate colonies with a greenish-brown hemolytic ring can be selected for further Gram staining, colony morphology identification, Optochin sensitivity test, and bile solubility test to identify the suspected colonies. As the gold standard for clinical etiological diagnosis, in vitro isolation and culture technology is still a commonly used method for diagnosing Streptococcus pneumoniae clinically. However, it is only used for qualitative detection, and its detection time is long, and its culture is easily affected by clinical medication and sampling methods, resulting in a low positive rate.

[0005] (2) Antigen-antibody detection methods based on immunological principles: Through the immunochromatographic test (ICT) that combines colloidal gold technology and protein chromatography technology, the C polysaccharide antigen on the cell wall surface of Streptococcus pneumoniae can be detected in human urine in just 15 minutes. In addition, enzyme-linked immunosorbent assay (ELISA) can not only detect antigens in samples but also detect antibodies. However, the sensitivity of antigen-antibody detection methods is relatively low.

[0006] (3) PCR-based sequencing technology: Based on the development of molecular biology-related diagnostic technologies, high-throughput sequencing and whole-genome sequencing have been used in clinical pathogen diagnosis. Detecting pathogens in samples by sequencing technology has the advantages of high efficiency and good sensitivity, but it is difficult to interpret positive results and distinguish normal colonizing bacteria, pathogenic bacteria, and background bacteria in samples. At the same time, its detection cost is relatively high, and there are still certain limitations in actual clinical applications.

[0007] (4) Real-time fluorescence quantitative PCR technology: Specific primers and fluorescent probes with a fluorescent reporter group and a quenching group are designed using the conserved sequence of Streptococcus pneumoniae as a template. When the fluorescent probe in the system is intact, the fluorescent signal generated by the fluorescent group is absorbed by the quenching group; when in the PCR process, when the polymerase amplifies the target sequence, its 5'→3' exonuclease activity enzymatically cleaves the fluorescent probe, separating its fluorescent group from the quenching group, thereby releasing a fluorescent signal. The intensity of the fluorescent signal is positively correlated with the concentration of the target sequence to be detected in the sample within a certain range. The target pathogen can be semi-quantitatively detected according to the cycle threshold (Ct) of the reaction. Although the detection results of real-time fluorescence quantitative PCR technology are more specific, they still cannot achieve 100% specificity, and the resolution of low-copy target gene molecules is poor, and the sensitivity, precision, and resolution are limited.

[0008] Based on the problems existing in the above detection methods, there is an urgent need to propose a detection method with high specificity and high sensitivity, enabling it to quickly and accurately perform precise quantitative detection on Streptococcus pneumoniae directly. Summary of the Invention

[0009] The purpose of this application is to propose a primer, probe, kit, and detection method for quantitatively detecting Streptococcus pneumoniae to solve the technical problem that the specificity and sensitivity of the detection method for Streptococcus pneumoniae in related technologies are both limited and it is impossible to directly perform precise quantitative detection on Streptococcus pneumoniae.

[0010] To solve the above technical problems, an embodiment of the present application provides primers and probes for quantitatively detecting Streptococcus pneumoniae, and adopts the following technical solutions:

[0011] The primers include an upstream primer for detecting Streptococcus pneumoniae, a downstream primer for detecting Streptococcus pneumoniae, an upstream primer for an internal control gene, and a downstream primer for an internal control gene, and the probes include a Streptococcus pneumoniae detection probe and an internal control gene probe;

[0012] Among them, the nucleotide sequence of the upstream primer for detecting Streptococcus pneumoniae is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream primer for detecting Streptococcus pneumoniae is shown as SEQ ID NO: 2;

[0013] The nucleotide sequence of the upstream primer for the internal control gene is shown as SEQ ID NO: 3, and the nucleotide sequence of the downstream primer for the internal control gene is shown as SEQ ID NO: 4;

[0014] The nucleotide sequence of the Streptococcus pneumoniae detection probe is shown as SEQ ID NO: 5, and the nucleotide sequence of the internal control gene probe is shown as SEQ ID NO: 6.

[0015] Furthermore, the 5' ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a fluorescent group; the 3' ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a quenching group.

[0016] Furthermore, the fluorescent group is selected from FAM or VIC; the quenching group is selected from MGB, BHQ1 or BHQ2.

[0017] Furthermore, the 5' end of the Streptococcus pneumoniae detection probe is labeled with a FAM fluorescent group, and the 3' end of the Streptococcus pneumoniae detection probe is labeled with an MGB quenching group; the 5' end of the internal control gene probe is labeled with a VIC fluorescent group, and the 3' end of the internal control gene probe is labeled with an MGB quenching group.

[0018] To solve the above technical problems, an embodiment of the present application also provides a kit for quantitatively detecting Streptococcus pneumoniae, and adopts the following technical solutions:

[0019] The kit includes a PCR reaction system, an SP positive control product, and an SP negative control product;

[0020] Among them, the PCR reaction system includes a primer-probe mixture, a ddPCR premix, and DEPC water, and the primer-probe mixture includes the primers and probes for quantitatively detecting Streptococcus pneumoniae as described above.

[0021] Further, the final concentration of the upstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the upstream primer of the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer of the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L;

[0022] The final concentration of the Streptococcus pneumoniae detection probe in the PCR reaction system is 0.2 - 0.3 μmol / L, and the final concentration of the internal control gene probe in the PCR reaction system is 0.2 - 0.3 μmol / L.

[0023] Further, the components of the SP positive control product include pseudovirus containing Streptococcus pneumoniae gene fragments and pseudovirus containing internal standard fragments; the components of the SP negative control product include pseudovirus containing internal standard fragments and TE buffer solution.

[0024] Further, the test sample of the kit is a human sputum sample.

[0025] To solve the above technical problems, the embodiment of the present application also provides a non-diagnostic detection method using the kit for quantitatively detecting Streptococcus pneumoniae as described above, and adopts the following technical solutions:

[0026] Collect the test sample, extract nucleic acid from the test sample to obtain the test sample nucleic acid;

[0027] Take out the primer-probe mixture, ddPCR premix and DEPC water from the kit, melt them at room temperature and mix well, prepare the PCR reaction system, and dispense the PCR reaction system into a preset number of PCR reaction tubes;

[0028] Add the test sample nucleic acid, SP positive control product and SP negative control product into the PCR reaction tubes respectively, transfer them to the droplet preparation area after instantaneous centrifugation;

[0029] Perform droplet preparation on the liquid in the PCR reaction tubes, and perform PCR amplification on the prepared droplets according to the preset PCR cycling conditions to obtain the PCR reaction product;

[0030] Perform quantitative analysis on the PCR reaction product to obtain the copy number of Streptococcus pneumoniae.

[0031] Further, the preset PCR cycling conditions are as follows:

[0032] First stage: 95°C for 10 min;

[0033] Second stage: 94°C for 30 s, 58°C for 1 min, perform 45 cycles;

[0034] Third stage: 98°C for 10 min, reaction stops;

[0035] Fourth stage: 4°C, keep warm.

[0036] Compared with the prior art, the present application mainly has the following beneficial effects:

[0037] The present application provides a primer, a probe, a kit and a detection method for quantitatively detecting Streptococcus pneumoniae. Based on the droplet digital PCR platform, it can accurately quantify Streptococcus pneumoniae, does not rely on the threshold (CT) of the amplification curve for quantification, and is not affected by the amplification efficiency; through droplet treatment, the interference of background and matrix can be greatly reduced, and the sensitivity and accuracy of Streptococcus pneumoniae detection can be improved; at the same time, the operation of the present application is simple, qualitative and quantitative can be carried out simultaneously, and the detection efficiency is high. Description of the Drawings

[0038] In order to more clearly illustrate the solutions in the present application, the following will briefly introduce the drawings required for the description of the embodiments of the present application. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, other drawings can be obtained according to these drawings without creative efforts.

[0039] Figure 1 It is the fluorescence detection result of the positive control product detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0040] Figure 2 It is the fluorescence detection result of the negative control product detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0041] Figures 3 to 6 They are the fluorescence detection results of the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application for the pseudovirus nucleic acid containing the Streptococcus pneumoniae gene fragment at 1×10 5 copies / mL, 1×10 4 copies / mL, 1×10 3 copies / mL and 1×10 2 copies / mL in sequence;

[0042] Figure 7 It is the fluorescence detection result of the enterprise reference product P1 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0043] Figure 8 It is the fluorescence detection result of the enterprise reference product P2 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0044] Figure 9 are the fluorescence detection results of the negative reference products N1 - N5 by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0045] Figure 10 are the fluorescence detection results of the negative reference products N6 - N10 by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0046] Figure 11 are the fluorescence detection results of clinical samples No. 1 - 5 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0047] Figure 12 are the fluorescence detection results of clinical samples No. 6 - 10 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0048] Figure 13 are the fluorescence detection results of clinical samples No. 11 - 14 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application;

[0049] Figure 14 are the fluorescence detection results of clinical samples No. 15 - 20 detected by the kit for quantitatively detecting Streptococcus pneumoniae provided by the present application. Detailed Embodiments

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs; the terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "comprising" and "having" and any variations thereof in the specification and claims of this application and the above drawings are intended to cover non - exclusive inclusion. The terms "first", "second", etc. in the specification and claims of this application or the above drawings are used to distinguish different objects and not to describe a specific order.

[0051] Referring to "embodiments" herein means that the specific features, structures, or characteristics described in connection with the embodiments can be included in at least one embodiment of this application. The phrase appears in various places in the specification and does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment mutually exclusive with other embodiments. Those skilled in the art will explicitly and implicitly understand that the embodiments described herein can be combined with other embodiments.

[0052] To enable those skilled in the technical field to better understand the solution of this application, the technical solutions in the embodiments of this application will be clearly and completely described below with reference to the accompanying drawings.

[0053] Based on the problems existing in the detection methods of Streptococcus pneumoniae in the prior art, this application uses the droplet digital PCR (hereinafter referred to as "ddPCR") technology of Bio-rad to quantitatively detect the nucleic acid of Streptococcus pneumoniae in the extracted sample. This detection method can quantitatively detect Streptococcus pneumoniae within the fastest 3 hours. In addition to reporting the positive and negative results of Streptococcus pneumoniae in the sample, this method can also provide the quantitative detection results of Streptococcus pneumoniae, that is, it can perform qualitative and quantitative detections simultaneously.

[0054] This application provides a primer and a probe for quantitatively detecting Streptococcus pneumoniae. The primer includes an upstream primer for detecting Streptococcus pneumoniae, a downstream primer for detecting Streptococcus pneumoniae, an upstream primer for the internal control gene, and a downstream primer for the internal control gene. The probe includes a detection probe for Streptococcus pneumoniae and a probe for the internal control gene.

[0055] Among them, the nucleotide sequence of the upstream primer for detecting Streptococcus pneumoniae is shown as SEQ ID NO: 1, and the nucleotide sequence of the downstream primer for detecting Streptococcus pneumoniae is shown as SEQ ID NO: 2; the nucleotide sequence of the upstream primer for the internal control gene is shown as SEQ ID NO: 3, and the nucleotide sequence of the downstream primer for the internal control gene is shown as SEQ ID NO: 4; the nucleotide sequence of the detection probe for Streptococcus pneumoniae is shown as SEQ ID NO: 5, and the nucleotide sequence of the probe for the internal control gene is shown as SEQ ID NO: 6.

[0056] The nucleotide sequences corresponding to the primer and probe for quantitatively detecting Streptococcus pneumoniae in this application are designed according to the detected gene locus (target fragment). It is not only necessary to ensure the detection of Streptococcus pneumoniae, but also to ensure that the detection sensitivity and detection efficiency of the primer and probe at this gene locus are optimal.

[0057] The primer and probe design of this application follows the following principles:

[0058] The length of the primer is generally controlled within 18 - 22 bp, and the length of the PCR reaction product is controlled within 50 - 300 bp. The melting temperature Tm of the primer is controlled within 52 - 60 °C, the GC content (the GC content refers to the total proportion of guanine (Guanine) and cytosine (Cytosine) in the DNA or RNA sequence) is controlled between 40 - 60%, and there should be no continuous 3 Gs or Cs at the 3' end. There should be no more than 4 repeated double sequences and 4 repeated single bases in the primer. Except for asymmetric PCR amplification, the difference in Tm values between primers is controlled within 5 °C; the Tm value of the probe should be more than 5 °C higher than the Tm value of the primer. To control the length of the probe sequence, groups such as MGB can be used as quenching groups to increase the overall Tm value of the probe. The fluorescent group of the probe is usually selected as FAM / VIC, etc., and the quenching group is usually selected as MGB / BHQ1 / BHQ2.

[0059] This application is based on digital PCR technology and quantitatively detects Streptococcus pneumoniae nucleic acid in a sample by designing specific primer-probe pairs. The Lyt A gene is selected as the target gene, and the autolysin encoded and synthesized by it is an important virulence factor of Streptococcus pneumoniae, which damages the host body by regulating the release of toxic substances.

[0060] The Lyt A gene sequence of Streptococcus pneumoniae was queried through the NCBI website, primers and probes were designed based on its specific conserved region, and the specificity of the primer-probes was verified through the BLAST (Basic Local Alignment Search Tool, a search tool based on the local sequence alignment algorithm) function. The probe designed in this application is a single probe, with the fluorescent group selected as FAM and the quenching group selected as MGB. The optimal primer-probe system and reaction program were found through repeated experiments.

[0061] The nucleotide sequence information of the primers and probes for quantitatively detecting Streptococcus pneumoniae in this application is shown in Table 1.

[0062] Table 1 Nucleotide sequence table of primers and probes for detecting Streptococcus pneumoniae

[0063] Primer and probe sequence numbers Nucleotide sequence (5'-3') SP upstream primer SEQ ID NO: 1 ACCAGTAGCCAGTGTCATTC SP downstream primer SEQ ID NO: 2 ATTGCACGAATAACCAACCAAAC Internal control gene upstream primer SEQ ID NO: 3 GGCAAATTCCATGGCACCG Internal control gene downstream primer SEQ ID NO: 4 GGACTCCACGACGTACTCAGC SP detection probe SEQ ID NO: 5 TTCAATCGTCAAGCCGTTC Internal control gene probe SEQ ID NO: 6 ACCATCTTCCAGGAGCGA

[0064] The 5'-end and 3'-end of the probe are respectively labeled with a fluorescent group and a quenching group. Specifically, the 5'-ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a fluorescent group; the 3'-ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a quenching group.

[0065] Among them, the fluorescent group is selected from FAM or VIC; the quenching group is selected from MGB, BHQ1 or BHQ2.

[0066] Furthermore, the 5'-end of the Streptococcus pneumoniae detection probe is labeled with the FAM fluorescent group, and the 3'-end of the Streptococcus pneumoniae detection probe is labeled with the MGB quenching group; the 5'-end of the internal control gene probe is labeled with the VIC fluorescent group, and the 3'-end of the internal control gene probe is labeled with the MGB quenching group.

[0067] Through the above primers and probes labeled with fluorescent groups, Streptococcus pneumoniae is quantitatively detected. According to the presence or absence of positive droplets in the FAM channel and the number of positive and negative droplets, it can be judged whether Streptococcus pneumoniae exists in the sample and the concentration of the target fragment of Streptococcus pneumoniae in the sample can be absolutely quantified.

[0068] This application has optimized the specificity of the primers and probes for quantitatively detecting Streptococcus pneumoniae, reduced the misdiagnosis probability caused by non-specific binding, and designed an internal control gene detection system for monitoring and correction.

[0069] Based on the above primers and probes for quantitatively detecting Streptococcus pneumoniae, the present application also provides a kit for quantitatively detecting Streptococcus pneumoniae, which includes a PCR reaction system, an SP positive control product, and an SP negative control product. Among them, the PCR reaction system includes a primer-probe mixture, a ddPCR premix, and DEPC water. The primer-probe mixture includes the primers and probes for quantitatively detecting Streptococcus pneumoniae as described above.

[0070] The ddPCR premix can adopt the ddPCR Supermix for Probes (No dUTP) for DNA sample droplet digital PCR provided by Bio-rad. For example, the premix with catalog numbers 1863023, 1863024, or 1863025 can be used. DEPC water is ultrapure water (grade I water) treated with DEPC (diethyl pyrocarbonate) and sterilized by high temperature and high pressure. It is a colorless liquid and does not contain impurities such as RNA, DNA, and proteins.

[0071] In some optional implementation manners, the final concentration of the upstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the upstream primer of the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer of the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L.

[0072] The final concentration of the Streptococcus pneumoniae detection probe in the PCR reaction system is 0.2 - 0.3 μmol / L, and the final concentration of the internal control gene probe in the PCR reaction system is 0.2 - 0.3 μmol / L.

[0073] Preferably, the final concentration of the upstream primer for detecting Streptococcus pneumoniae in the reaction system is 0.45 μmol / L, the final concentration of the downstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.45 μmol / L, and the final concentration of the Streptococcus pneumoniae detection probe in the PCR reaction system is 0.23 μmol / L; the final concentration of the upstream primer of the internal control gene in the PCR reaction system is 0.45 μmol / L, the final concentration of the downstream primer of the internal control gene in the PCR reaction system is 0.45 μmol / L, and the final concentration of the internal control gene probe in the PCR reaction system is 0.23 μmol / L.

[0074] The components of the SP positive control product include pseudoviruses containing Streptococcus pneumoniae gene fragments and pseudoviruses containing internal standard fragments; the components of the SP negative control product include pseudoviruses containing internal standard fragments and TE buffer. TE buffer is prepared from Tris and EDTA, mainly used to dissolve nucleic acids, can stably store DNA and RNA. TE buffer is a solution that can resist changes in pH when adding a small amount of acid or base, and plays an important role in maintaining the normal pH value and normal physiological environment of organisms.

[0075] The detection samples applicable to the kit of this application are human sputum samples.

[0076] The criteria for this application kit to determine the detection effectiveness are as follows:

[0077] In each detection, among all reaction wells, the reaction wells with the number of droplets > 10000 are effective reaction wells. Among the effective reaction wells, the negative control group and the positive control group should be included. When the detection result of the positive control group is positive, the detection result of the negative control group is negative, and the concentration detection result of the positive control group is 1.5×10 5 copies / mL (±10%), the detection result of this time is valid.

[0078] Based on the above-mentioned kit for quantitatively detecting Streptococcus pneumoniae, this application also provides a non-diagnostic detection method for detecting Streptococcus pneumoniae using the above-mentioned kit. The detection method includes the following steps:

[0079] Step S10, collect the sample to be tested, extract nucleic acids from the sample to be tested to obtain the nucleic acid of the sample to be tested;

[0080] Step S20, take out the primer-probe mixture, ddPCR premix and DEPC water from the above-mentioned kit, melt them at room temperature and mix well, prepare the PCR reaction system, and dispense the PCR reaction system into a preset number of PCR reaction tubes;

[0081] Step S30, add the nucleic acid of the sample to be tested, SP positive control product and SP negative control product into the PCR reaction tubes respectively, transfer them to the droplet preparation area after instantaneous centrifugation;

[0082] Step S40, prepare droplets from the liquid in the PCR reaction tubes, and perform PCR amplification on the prepared droplets according to the preset PCR cycling conditions to obtain the PCR reaction product;

[0083] Step S50, perform quantitative analysis on the PCR reaction product to obtain the copy number of Streptococcus pneumoniae.

[0084] In step 10, the sample to be tested is human sputum. Specifically, the person being sampled first rinses their mouth with physiological saline to clean their teeth and oral cavity (denture wearers should remove their dentures), and then coughs up sputum forcefully into a sputum cup, ensuring that the specimen volume is ≥ 1 mL. The sample should be stored in a refrigerator at -75 to -85 °C for no more than 12 months.

[0085] Use a qualified human sputum extraction kit to extract nucleic acids from the sample to be tested. Specifically, use a nucleic acid extraction or purification reagent (registration number: Yue Sui Xie Bei 20170583) produced by Daan Gene Co., Ltd. to extract and purify nucleic acids from the sputum of the collected sample, obtaining the nucleic acid of the sample to be tested.

[0086] For the preparation of the PCR reaction system in step S20, specifically, take the primer-probe mixture, ddPCR premix, and DEPC water from the kit, melt them at room temperature, shake and mix well, and centrifuge at 8000 - 10000 rpm for several seconds to prepare the PCR reaction system, where the centrifugation time is 10 - 20 s.

[0087] Dispense the PCR reaction system into a preset number of PCR reaction tubes, where the preset number N = the number of samples to be tested + SP negative control + SP positive control.

[0088] The single-person PCR reaction system is prepared as shown in Table 2 below. After fully mixing each component, perform a short centrifugation to ensure that all the liquid on the tube wall is centrifuged to the bottom of the tube, and then dispense 17 μL of the PCR reaction system (i.e., the amplification system) into the PCR reaction tubes.

[0089] Table 2 Single-person PCR reaction system

[0090] Component Volume Primer-probe mixture 0.47 μL ddPCR premix 11 μL DEPC water 5.53 μL

[0091] Step S30 is the sample addition operation. Specifically, add 5 μL of the extracted nucleic acid of the sample to be tested, SP negative control, and SP positive control to the above-mentioned PCR reaction tubes respectively, tighten the tube caps. After instantaneous centrifugation for 15 seconds, transfer them to the microdroplet preparation area.

[0092] Prepare microdroplets according to the instructions of the Bio-rad microdrop digital PCR platform. Transfer the prepared microdroplets to a Bio-rad special 96-well plate for microdrop digital PCR, and then use a heat sealer to seal the 96-well plate with an aluminum mold.

[0093] Specifically, the PCR reaction system with the test sample added is mixed using a vortex oscillator. Take out a droplet preparation chip, transfer a column (8) of reaction systems to the sample wells of the chip, add 70 μL of droplet preparation oil to the droplet preparation oil wells, and send it into the droplet preparation instrument for droplet preparation. After the instrument reports that the droplet preparation is complete, carefully transfer the prepared droplets to a dedicated 96-well plate using a pipette, discard the droplet preparation chip, and then take another droplet preparation chip to process the next column of reaction systems until all the test reaction systems are processed and the droplet preparation is completed. Use a heat sealer to seal the 96-well plate with an aluminum mold.

[0094] Transfer the sealed 96-well plate to a PCR instrument, and perform a PCR amplification reaction on the prepared droplets according to the preset PCR cycling conditions in Table 3. Among them, the preset PCR cycling conditions are as follows: in the first stage, pre-denaturation at 95 °C for 10 min; the second stage is divided into two steps. The first step is denaturation at 94 °C for 30 s, and the second step is annealing and extension at 58 °C for 1 min. Among them, the second stage is performed for 45 cycles; in the third stage, enzyme inactivation is carried out at 98 °C for 10 min, and the reaction stops; in the fourth stage, keep the temperature at 4 °C.

[0095] Table 3 PCR cycling conditions

[0096]

[0097] After the PCR amplification reaction is completed, transfer the 96-well plate to a droplet reader, set the droplet reading parameters according to the instruction manual, and pay attention to the fluorescence channel selection: select the FAM channel to detect Streptococcus pneumoniae nucleic acid, select the VIC channel to detect the internal standard, and start the droplet reading after the setting is completed.

[0098] After the droplet reading is completed, the results are automatically saved. Click "Analyze" to enter the result analysis interface. First, click "Event" to view the total number of droplets in each reaction well. If the number of droplets in a certain reaction well < 10000, it is regarded as an invalid reaction well. Then check whether the positive and negative quality control products of this test are included in the valid reaction wells. If they are included, this test is valid.

[0099] If the test is valid, click "1D Amplitude" to view the fluorescence scatter plot of Ch1. After drawing the threshold line, click "Concentration" to view the concentration of Ch1, with the unit of copies / μL. Combining the sample dilution factor, the concentration of the original sample can be calculated.

[0100] The detection principle of this application is as follows:

[0101] The kit of the present application utilizes the droplet digital PCR technology of Bio-rad to design specific primers and probes in the conserved region of the Streptococcus pneumoniae genome. Streptococcus pneumoniae is labeled with the FAM fluorophore, and the internal control gene is labeled with the VIC fluorophore. After preparing the PCR reaction system and loading the samples, it is dispersed into tens of thousands of droplets. Each droplet can simultaneously perform PCR amplification reactions. After PCR is completed, a droplet reader is used to detect the fluorescence signals of each droplet to determine the positivity or negativity of the droplets. After counting the positivity and negativity of all droplets, it is possible to determine whether Streptococcus pneumoniae nucleic acid exists in the sample. Further, based on the statistical results of the positive and negative droplets and combined with statistical formulas, the copy number of Streptococcus pneumoniae nucleic acid in the sample can be calculated.

[0102] See Figure 1 and Figure 2 the fluorescence detection results of the positive control product and the negative control product detected by the kit of the present application shown in. Among them, Ch1 corresponds to the FAM fluorescence channel, and Ch2 corresponds to the VIC fluorescence channel. As can be seen from the figure, in Figure 1 the Streptococcus pneumoniae gene fragment and the internal control gene fragment (i.e., the internal standard fragment) are detected in the FAM fluorescence channel and the VIC fluorescence channel respectively; Figure 2 in, no signal is detected in the FAM channel, and the internal control gene fragment can be detected in the VIC channel.

[0103] The following further illustrates the content of the present application in more detail in conjunction with specific embodiments and further elaborates on the present application. However, these embodiments are by no means limiting the present application.

[0104] Example 1

[0105] The present application example provides the composition, packaging, and quantity (96 person-times / box) of a kit for quantitatively detecting Streptococcus pneumoniae, as shown in Table 4.

[0106] Table 4

[0107]

[0108] Example 2

[0109] This example conducts experiments on the sample detection range and sensitivity detection of the kit of the present application.

[0110] Take an appropriate number of SP primer-probe mixtures, 2x supermix, and DEPC water, prepare them according to the above-mentioned PCR reaction system preparation method, and transfer them into PCR reaction tubes; select a pseudovirus sample containing Streptococcus pneumoniae gene fragments at 1x10 7 copies / mL, dilute it 1:10 times with sterile physiological saline, and then dilute it 1:10 2 、1:10 3 、1:104 and 1:10 5 The 1-fold, 1:10-fold, 1:100-fold, and 1:1000-fold diluted samples were respectively labeled as S1, S2, S3, and S4 as the samples to be tested. After nucleic acid extraction, 5 μL of the extraction solution was added to an eight-well strip tube of the prepared PCR reaction system to make the total volume 22 μL. The eight-well tube lid was tightened, and it was vigorously shaken and mixed for 15 seconds with an oscillator, and then transferred to the droplet preparation area after instantaneous centrifugation for 15 seconds.

[0111] After the droplets were prepared according to the above droplet preparation method, the 96-well plate was sealed with an aluminum mold on a heat sealer. The sealed 96-well plate was transferred to a qualitative PCR, and the prepared droplets were subjected to a PCR amplification reaction according to the preset PCR cycle conditions in Table 3.

[0112] After the reaction ended, the detection results were obtained. The detection results are shown in Table 5. Figures 3 to 6 as shown Figures 3 to 6 in turn are 1×10 5 copies / mL, 1×10 4 copies / mL, 1×10 3 copies / mL and 1×10 2 copies / mL of the fluorescence detection results of the pseudovirus nucleic acid containing the Streptococcus pneumoniae gene fragment.

[0113] Table 5 Sample Detection Range and Sensitivity Detection Experiment Results

[0114]

[0115] As can be seen from Table 5 above, when the sample concentration ≥ 1×10 4 copies / mL, the difference between the quantitative test result of the kit of the present application and the true concentration < 20%. The minimum detection limit of the kit of the present application is 1000 copies / mL, the sensitivity is 1000 copies / mL, and the kit has high sensitivity.

[0116] Example 3

[0117] This example detects the accuracy of the kit of the present application.

[0118] The kit of the present application was used to detect Streptococcus pneumoniae enterprise reference product P1 with concentrations of 1x10 5 copies / mL, and the concentration was 1x10 3The detection limit of < copies / mL > is for enterprise reference product P2, and the negative reference products N1 to N10 of Streptococcus A, Haemophilus influenzae, Klebsiella pneumoniae, Neisseria meningitidis, Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus (group b), Streptococcus (group c), Moraxella catarrhalis, and Corynebacterium diphtheriae in the national reference product of the Streptococcus pneumoniae nucleic acid detection reagent. Take 5 μL of the extraction solution and add it to an eight-strip tube of the prepared PCR reaction system to make the total volume 22 μL. Tighten the eight-tube caps, mix well by vigorous oscillation with an oscillator for 15 seconds, and transfer it to the droplet preparation area after instantaneous centrifugation for 15 seconds.

[0119] After the droplets are prepared according to the above droplet preparation method, seal the 96-well plate with an aluminum mold on a heat sealer, transfer the sealed 96-well plate to a qualitative PCR, and perform a PCR amplification reaction on the prepared droplets according to the preset PCR cycle conditions in Table 3.

[0120] After the reaction ends, obtain the detection results, as shown in Table 6, Figures 7 to 10 as shown, Figure 7 is the fluorescence detection result of enterprise reference product P1, Figure 8 is the fluorescence detection result of enterprise reference product P2, Figure 9 is the fluorescence detection result of negative reference products N1 to N5, Figure 10 is the fluorescence detection result of negative reference products N6 to N10.

[0121] Table 6 Accuracy detection results

[0122]

[0123]

[0124] According to the detection results described in the above table, the compliance rate of the negative reference products is 100%, and the compliance rate of the positive reference products is 100%. The detection accuracy of the kit of the present application is high, and the quantitative result is accurate, indicating that the accuracy detection of the kit of the present application meets the requirements.

[0125] Example 4

[0126] This example is a clinical application experiment, using the kit of the present application and other Streptococcus pneumoniae qualitative detection reagents to detect the positive and negative of the tested clinical samples.

[0127] Select 10 SP clinical positive samples and 10 negative samples respectively. After nucleic acid extraction, mark the samples well and ensure that the label information is correct, and store them at -80 °C. During the experiment, take 5 μL of each sample and add it to a PCR reaction tube containing the PCR reaction system prepared according to step S20 to make the total volume 22 μL. Mix well by vigorous oscillation with an oscillator for 15 seconds, and transfer it to the droplet preparation area after instantaneous centrifugation for 15 seconds.

[0128] After the microdroplets are prepared according to the above microdroplet preparation method, seal the 96-well plate with an aluminum mold on a heat sealer, transfer the sealed 96-well plate to a qualitative PCR instrument, and perform a PCR amplification reaction on the prepared microdroplets according to the preset PCR cycle conditions in Table 3.

[0129] After the reaction is completed, the detection results are obtained as shown in Table 7 and Figures 11 to 14 as shown, where Figure 11 are the fluorescence detection results of clinical samples No. 1-5, Figure 12 are the fluorescence detection results of clinical samples No. 6-10, Figure 13 are the fluorescence detection results of clinical samples No. 11-14, Figure 14 are the fluorescence detection results of clinical samples No. 15-20.

[0130] Table 7 Detection results of clinical samples of the kit of the present application and other SP qualitative detection reagents

[0131]

[0132]

[0133] As can be seen from the above results, among the 20 samples, there are 10 SP-positive samples and 10 negative samples. The consistency of the detection results of positive and negative clinical samples with those of other reagents reaches 100%. By using the kit of the present application for detection, it is possible to identify whether the tested population carries Streptococcus pneumoniae and perform quantitative detection on it, which is worthy of popularization and application.

[0134] Obviously, the embodiments described above are only a part of the embodiments of the present application, rather than all of them. The preferred embodiments of the present application are given in the drawings, but they do not limit the patent scope of the present application. The present application can be implemented in many different forms. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of the present application more thorough and comprehensive. Although the present application has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions recorded in the foregoing specific embodiments, or perform equivalent replacements on some of the technical features. Any equivalent structures made by using the specification and drawings of the present application, directly or indirectly applied to other related technical fields, are equally within the scope of the patent protection of the present application.

Claims

1. A primer and a probe for quantitatively detecting Streptococcus pneumoniae, characterized in that, The primers include an upstream primer for detecting Streptococcus pneumoniae, a downstream primer for detecting Streptococcus pneumoniae, an upstream primer for the internal control gene, and a downstream primer for the internal control gene, and the probes include a Streptococcus pneumoniae detection probe and an internal control gene probe; Among them, the nucleotide sequence of the upstream primer for detecting Streptococcus pneumoniae is shown in SEQ ID NO: 1, and the nucleotide sequence of the downstream primer for detecting Streptococcus pneumoniae is shown in SEQ ID NO: 2; The nucleotide sequence of the upstream primer for the internal control gene is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer for the internal control gene is shown in SEQ ID NO: 4; The nucleotide sequence of the Streptococcus pneumoniae detection probe is shown in SEQ ID NO: 5, and the nucleotide sequence of the internal control gene probe is shown in SEQ ID NO:

6.

2. The primer and probe for quantitatively detecting Streptococcus pneumoniae according to claim 1, characterized in that, The 5' ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a fluorescent group; the 3' ends of the Streptococcus pneumoniae detection probe and the internal control gene probe are respectively labeled with a quenching group.

3. The primer and probe for quantitatively detecting Streptococcus pneumoniae according to claim 2, wherein, The fluorescent group is selected from FAM or VIC; the quenching group is selected from MGB, BHQ1 or BHQ2.

4. The primer and probe for quantitatively detecting Streptococcus pneumoniae according to claim 3, characterized in that The 5' end of the Streptococcus pneumoniae detection probe is labeled with a FAM fluorescent group, and the 3' end of the Streptococcus pneumoniae detection probe is labeled with an MGB quenching group; the 5' end of the internal control gene probe is labeled with a VIC fluorescent group, and the 3' end of the internal control gene probe is labeled with an MGB quenching group.

5. A kit for quantitatively detecting Streptococcus pneumoniae, characterized in that, It includes a PCR reaction system, an SP positive control product, and an SP negative control product; Among them, the PCR reaction system includes a primer-probe mixture, a ddPCR premix, and DEPC water, and the primer-probe mixture includes the primers and probes for quantitatively detecting Streptococcus pneumoniae as described in any one of claims 1 to 4.

6. The kit for quantitatively detecting Streptococcus pneumoniae according to claim 5, wherein The final concentration of the upstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer for detecting Streptococcus pneumoniae in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the upstream primer for the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L; the final concentration of the downstream primer for the internal control gene in the PCR reaction system is 0.4 - 0.5 μmol / L; The final concentration of the Streptococcus pneumoniae detection probe in the PCR reaction system is 0.2 - 0.3 μmol / L, and the final concentration of the internal control gene probe in the PCR reaction system is 0.2 - 0.3 μmol / L.

7. The kit for quantitatively detecting Streptococcus pneumoniae according to claim 5, wherein, The components of the SP positive control product include a pseudovirus containing a Streptococcus pneumoniae gene fragment and a pseudovirus containing an internal standard fragment; the components of the SP negative control product include a pseudovirus containing an internal standard fragment and TE buffer.

8. The kit for quantitatively detecting Streptococcus pneumoniae according to claim 5, characterized in that, The detection sample of the kit is a human sputum sample.

9. A detection method for non-diagnostic purposes using a kit for quantitatively detecting Streptococcus pneumoniae as described in any one of claims 5 to 8, characterized in that, It includes the following steps: Collect the sample to be tested, extract nucleic acid from the sample to be tested to obtain the nucleic acid of the sample to be tested; Take out the primer-probe mixture, ddPCR premix and DEPC water from the kit, melt them at room temperature and mix well. Prepare the PCR reaction system and aliquot the PCR reaction system into a preset number of PCR reaction tubes; Add the nucleic acid of the sample to be tested, SP positive control and SP negative control to the PCR reaction tubes respectively. After instantaneous centrifugation, transfer them to the droplet preparation area; Prepare droplets from the liquid in the PCR reaction tubes and perform PCR amplification on the prepared droplets according to the preset PCR cycling conditions to obtain the PCR reaction product; Perform quantitative analysis on the PCR reaction product to obtain the copy number of Streptococcus pneumoniae.

10. The detection method according to claim 9, wherein The preset PCR cycling conditions are as follows: The first stage: 95°C for 10 min; the second stage: 94°C for 30 s, 58°C for 1 min, perform 45 cycles; the third stage: 98°C for 10 min, stop the reaction; the fourth stage: 4°C, keep warm.

Images