Genetically engineered cells

By genetically engineering mammalian cells, reducing or removing expression of specific genes, and increasing expression of CD47 genes, the problem of survival and immunogenicity of transplanted cells and tissues in host subjects is solved, achieving better viability and tolerance.

CN120202293APending Publication Date: 2025-06-24VERTEX PHARMACEUTICALS INC
View PDF 45 Cites 0 Cited by

Patent Information

Application Number
CN202380077448.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-06-13
Filing Date
2023-10-31
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

Transplanted cells and tissues face stress and hostile environments in the host subjects, resulting in reduced viability and increased immunogenicity, making it difficult to effectively treat diseases such as diabetes.

Method used

By genetically engineering mammalian cells, the expression of renal enzyme, ABO, CXCL10, β-2 microglobulin (B2M) and tissue factor (F3) genes is reduced or removed, and the expression of CD47 gene or mutant CD47 is increased to improve cell viability and reduce immunogenicity.

Benefits of technology

Improved viability and reduced immunogenicity of mammalian cells are achieved, and the viability and tolerance of transplanted cells and tissues in the host subjects are improved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005388958430000401
    Figure BDA0005388958430000401
  • Figure BDA0005388958430000411
    Figure BDA0005388958430000411
  • Figure BDA0005388958430000991
    Figure BDA0005388958430000991
Patent Text Reader

Abstract

Disclosed herein are compositions and methods related to genetically engineered mammalian cells comprising modulated expression of a selected gene. The genetically engineered mammalian cells described herein advantageously have improved viability.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of pending PCT / US2022 / 079017, filed November 1, 2022; U.S. provisional patent application US 63 / 491,032, filed March 17, 2023; US 63 / 493,880, filed April 3, 2023; and US 63 / 507,793, filed June 13, 2023, the contents of which are incorporated herein by reference in their entirety.

[0003] References to electronic sequence listings

[0004] The contents of the electronic sequence listing (41822WO_SequenceListing.xml; size: 326 KB; and creation date: October 27, 2023) are incorporated herein by reference in their entirety.

[0005] background

[0006] Transplantation of tissues such as the pancreas or pancreatic islets has been used to treat diseases such as diabetes, such as type I diabetes. However, after transplantation into a host subject, the transplanted cells and tissues typically encounter a stressful and hostile environment. Therefore, there is a need for engineered cells and tissues (e.g., stem cells or cells differentiated from stem cells) with improved survivability and / or reduced immunogenicity in a host subject.

[0007] Overview

[0008] The present disclosure relates to genetically engineered mammalian cells comprising modulated expression of selected genes.The genetically engineered mammalian cells described herein advantageously have improved viability and / or reduced immunogenicity.

[0009] In a first aspect, the present disclosure relates to a genetically engineered mammalian cell engineered to have reduced or no expression of a renalase gene, and wherein the engineered mammalian cell is further genetically engineered to have reduced or no expression of an ABO gene; reduced or no expression of a CXCL10 gene, reduced or no expression of beta-2 microglobulin (B2M), reduced or no expression of a tissue factor (F3) gene, and / or increased expression of CD47 or expression of a mutant CD47, when compared to the expression levels of the corresponding genes in the same cell type in which the cell has not been genetically engineered.

[0010] In some embodiments, the mammalian cells have been genetically engineered to have reduced or no expression of a renalase gene, and the cells have been further genetically engineered to have reduced or no expression of an ABO gene compared to the expression level of the same cell type that has not been genetically engineered.

[0011] In some embodiments, the mammalian cells have been genetically engineered to have reduced or no expression of a renalase gene, and the cells have been further genetically engineered to have reduced or no expression of an ABO gene, and / or the cells have been genetically engineered to have reduced or no expression of a CXCL10 gene compared to the expression level of the same cell type that has not been genetically engineered.

[0012] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of a renalase gene, and the cell has been further genetically engineered to have reduced or no expression of an ABO gene; the cell has been genetically engineered to have reduced or no expression of a CXCL10 gene; and / or the cell has been genetically engineered to have reduced or no expression of a B2M gene compared to the expression level of the same cell type that has not been genetically engineered.

[0013] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of a renalase gene; and the cell has been further genetically engineered to have reduced or no expression of an ABO gene; the cell has been genetically engineered to have reduced or no expression of a CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of a B2M gene; and / or the cell has been genetically engineered to have reduced or no expression of an F3 gene compared to the expression level of the same cell type that has not been genetically engineered.

[0014] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of the renal enzyme gene, and the cell has been further genetically engineered to have reduced or no expression of the ABO gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; and / or the cell has been genetically engineered to have increased expression of CD47 compared to the expression level of the same cell type that has not been genetically engineered. In some embodiments, the engineered cell comprises the insertion of an exogenous CD47 gene.

[0015] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of the renalase gene, and the cell has been further genetically engineered to have reduced or no expression of the ABO gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; and / or the cell has been genetically engineered to express a mutant CD47. In some embodiments, the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the mutant CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that the Q at position 1 is replaced by at least 3 amino acids. In some embodiments, the Q at position 1 is replaced by any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP and WQM. In some embodiments, the cell comprises a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein with at least three amino acids added between the start of the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the mature CD47 amino acid sequence (e.g., an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146). In some embodiments, the cell comprises a gene encoding a CD47 protein, wherein the gene encodes a mutant CD47 protein in which the "Q" at position 19 corresponding to an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 is replaced with at least three amino acids. In some embodiments, the at least three amino acids are selected from any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM. In some embodiments, the at least three amino acids are WQPP. In some embodiments, the Q at position 1 is replaced with WQPP. In some embodiments, the at least three amino acids comprise the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

[0016] In some embodiments, the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0017] Some aspects of the present disclosure provide a mammalian cell that has been genetically engineered to have reduced or no expression of a CXCL10 gene, and wherein the cell has also been genetically engineered to have reduced or no expression of an ABO gene and / or a tissue factor (F3) gene.

[0018] In some embodiments, the mammalian cells have been genetically engineered to have reduced or no expression of the CXCL10 gene, and wherein the cells have been further genetically engineered to have reduced or no expression of the ABO gene compared to the expression level of the same cell type that has not been genetically engineered.

[0019] In some embodiments, the mammalian cells have been genetically engineered to have reduced or no expression of the CXCL10 gene, and the cells have been further genetically engineered to have reduced or no expression of the ABO gene, and / or the cells have been genetically engineered to have reduced or no expression of the tissue factor (F3) gene as compared to the expression levels of the same cell type that has not been genetically engineered.

[0020] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been further genetically engineered to have reduced or no expression of the ABO gene; the cell has been genetically engineered to have reduced or no expression of the tissue factor (F3) gene; and / or the cell has been genetically engineered to have reduced or no expression of the beta-2 microglobulin (B2M) gene as compared to the expression level of the same cell type that has not been genetically engineered.

[0021] In some embodiments, the mammalian cells have been genetically engineered to have reduced or no expression of the CXCL10 gene; the cells have been further genetically engineered to have reduced or no expression of the ABO gene; the cells have been genetically engineered to have reduced or no expression of the tissue factor (F3) gene; the cells have been genetically engineered to have reduced or no expression of the beta-2 microglobulin (B2M) gene; and / or the cells have been genetically engineered to have reduced or no expression of the renalase gene as compared to the expression level of the same cell type that has not been genetically engineered.

[0022] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been further genetically engineered to have reduced or no expression of the ABO gene; the cell has been genetically engineered to have reduced or no expression of the tissue factor (F3) gene; the cell has been genetically engineered to have reduced or no expression of the beta-2 microglobulin (B2M) gene; the cell has been genetically engineered to have reduced or no expression of the renal enzyme gene; and / or the cell has been genetically engineered to have increased expression of CD47 compared to the expression level of the same cell type that has not been genetically engineered. In some embodiments, the engineered cell comprises the insertion of an exogenous CD47 gene.

[0023] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been further genetically engineered to have reduced or no expression of the ABO gene; the cell has been genetically engineered to have reduced or no expression of the tissue factor (F3) gene; the cell has been genetically engineered to have reduced or no expression of the beta-2 microglobulin (B2M) gene; the cell has been genetically engineered to have reduced or no expression of the renal enzyme gene; and / or the cell has been genetically engineered to express a mutant CD47 protein. In some embodiments, the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M. In some embodiments, the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0024] In some embodiments, the cell expresses a membrane-bound CD47 protein, wherein the membrane-bound CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, except that the Q at position 1 is replaced by at least 3 amino acids. In some embodiments, the Q at position 1 is replaced by any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP and WQM. In some embodiments, the cell comprises a gene encoding a membrane-bound CD47 protein, wherein the gene encodes a CD47 protein with at least three amino acids added between the start of the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the mature CD47 amino acid sequence (e.g., an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146). In some embodiments, the cell comprises a gene encoding a membrane-bound CD47 protein, wherein the gene encodes a CD47 protein with a "Q" at a position corresponding to position 19 of an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14 or 243 replaced by at least three amino acids. In some embodiments, the at least three amino acids are selected from any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, or WQM. In some embodiments, the at least three amino acids are WQPP. In some embodiments, the Q at position 1 is replaced with WQPP. In some embodiments, the at least three amino acids comprise the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

[0025] In some embodiments of the present disclosure, the mammalian cells have been genetically engineered to have reduced or no expression of the B2M, CXCL10, renalase, ABO, and F3 genes, and increased expression of CD47, compared to the expression levels of the same mammalian cell type that has not been genetically engineered.

[0026] In some embodiments of the present disclosure, mammalian cells have been genetically engineered to have reduced or no expression of the B2M, CXCL10, renalase, ABO, and F3 genes compared to expression levels in the same mammalian cell type that has not been genetically engineered, and express mutant CD47. In some embodiments, the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the three added amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0027] Certain aspects of the present disclosure include mammalian cells of ABO blood group O, wherein the cells have been genetically engineered to have reduced or no expression of the renal enzyme gene. In some embodiments, the cells have been genetically engineered to have reduced or no expression of the CXCL10 gene, and / or express a mutant CD47 protein.

[0028] In some embodiments, the mammalian cell is ABO blood type O, wherein the cell has been genetically engineered to have reduced or no expression of the renalase gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; and the cell has been genetically engineered to have increased expression of the CD47 gene compared to the expression level of the same cell type that has not been genetically engineered.

[0029] Certain aspects of the present disclosure include mammalian cells, wherein the cells express membrane-bound CD47 protein, wherein the CD47 protein comprises at least three amino acids added to the N-terminus of the mature CD47 protein, wherein the added three amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

[0030] In some embodiments, the cell expresses a membrane-bound CD47 protein, wherein the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M. In some embodiments, the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP, and WQM.

[0031] In some embodiments, the mammalian cells express membrane-bound CD47 protein, wherein the cells have also been genetically engineered to have reduced or no expression of a B2M gene.

[0032] In some embodiments, the mammalian cells express membrane-bound CD47 protein, wherein the cells have also been genetically engineered to have reduced or no expression of the B2M gene, and / or genetically engineered to have reduced or no expression of the F3 gene.

[0033] In some embodiments, the mammalian cells express membrane-bound CD47 protein, wherein the cells have also been genetically engineered to have reduced or no expression of the B2M gene; the cells have been genetically engineered to have reduced or no expression of the F3 gene; and / or the cells have been genetically engineered to have reduced or no expression of the CXCL10 gene.

[0034] In some embodiments, the mammalian cells express membrane-bound CD47 protein, wherein the cells have also been genetically engineered to have reduced or no expression of the B2M gene; the cells have been genetically engineered to have reduced or no expression of the F3 gene; the cells have been genetically engineered to have reduced or no expression of the CXCL10 gene; and / or the cells have been genetically engineered to have reduced or no expression of the renalase gene.

[0035] In some embodiments, the mammalian cell expresses membrane-bound CD47 protein, wherein the cell has also been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the renalase gene; and / or the cell is ABO blood type O.

[0036] In some embodiments, the mammalian cell expresses membrane-bound CD47 protein, wherein the cell has also been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the renalase gene; the cell is ABO blood type O; and / or the cell has been genetically engineered to have reduced or no expression of the ABO gene.

[0037] In some embodiments, the mammalian cell expresses membrane-bound CD47 protein, wherein the cell has also been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the renalase gene; the cell is ABO blood type O; the cell has been genetically engineered to have reduced or no expression of ABO genes; and / or the cell is naturally ABO blood type O.

[0038] In some embodiments, the mammalian cell expresses membrane-bound CD47 protein, wherein the cell has also been genetically engineered to have reduced or no expression of the B2M gene; the cell has been genetically engineered to have reduced or no expression of the F3 gene; the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene; the cell has been genetically engineered to have reduced or no expression of the renal enzyme gene; the cell is ABO blood type O; the cell has been genetically engineered to have reduced or no expression of the ABO gene; and / or the cell is a natural ABO blood type O. In some embodiments, a transgene encoding the CD47 protein is inserted into the genome of the cell so that expression of the CD47 transgene is tied to expression of an endogenous target gene in the cell. In some embodiments, the endogenous target gene is a housekeeping gene, such as ACTB, NANOG, or GAPDH. In some embodiments, the transgene is inserted in a manner that leaves the 3'UTR of the housekeeping gene (e.g., the 3'UTR of the GAPDH gene) intact.

[0039] In some embodiments, the endogenous CD47 gene of the cell is mutated such that the cell expresses a CD47 protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M.

[0040] In some embodiments, the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 245, 162 or 163.

[0041] Some aspects of the present disclosure relate to genetically modified mammalian cells, wherein the cells are stem cells. In some embodiments, the modified mammalian cells are pluripotent stem cells (PSC), embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and / or embryonic germ stem cells (EGSC). In some embodiments, the modified mammalian cells are differentiated from pluripotent stem cells. In some embodiments, the genetically engineered mammalian cells are somatic cells. In some embodiments, the modified mammalian cells are definitive endoderm cells. In some embodiments, the mammalian cells are primitive intestinal tube cells. In some embodiments, the cells are PDX1-positive pancreatic progenitor cells. In some embodiments, the cells are NKX6.1-positive pancreatic progenitor cells. In some embodiments, the cells are Ngn3-positive endocrine progenitor cells. In some embodiments, the cells are insulin-positive endocrine cells. In some embodiments, the mammalian cells are pancreatic SC-β cells. In some embodiments, the cells are NKX6.1-positive. In some embodiments, the cells are ISL1-negative. In some embodiments, the mammalian cells are NKX6.1-positive and ISL1-positive. In some embodiments, the mammalian cell is NKX6.1 negative and ISL1 negative. In some embodiments, the mammalian cell is ISL1 positive. In some embodiments, the mammalian cell is NKX6.1 negative. In some embodiments, the cell expresses insulin.

[0042] Certain aspects of the present disclosure relate to mammalian cells that have been genetically modified as described herein, wherein the genetic manipulation is performed using CRISPR / Cas, piggybac transposons, TALENs, zinc finger technology, homing endonucleases, or meganucleases. In some embodiments, at least one genetic modification is performed in an intron region of a gene. In some embodiments, at least one genetic modification is performed in an exon of a gene. In some embodiments, at least one genetic modification is performed in a promoter of a gene.

[0043] Certain aspects of the present disclosure relate to mammalian cells, wherein the mammalian cells have been genetically engineered to have reduced expression of, or the absence of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6, as compared to expression levels in the same cell type that has not been genetically engineered, and wherein the cells have also been genetically engineered to have reduced expression of, or the absence of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6. NO:1 is at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to a protein encoded by a nucleic acid or comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:2; reduced or absent expression of a protein encoded by a nucleic acid or comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7; NO:8 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:8; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12 expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 11, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 12;and / or increased expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 15, or a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 145 and / or SEQ ID NO: 146;

[0044] In some embodiments, the mammalian cell has been genetically engineered to have reduced expression of, or absence of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8, and the cell has also been genetically engineered to have reduced expression of, or absence of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, as compared to expression levels in the same cell type that has not been genetically engineered. NO:11 is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the nucleic acid of SEQ ID NO:11, or comprises an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:2 or SEQ ID NO:12.

[0045] In some embodiments, the mammalian cell has been genetically engineered to have reduced expression of, or no expression of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8, and the cell has also been genetically engineered to have reduced expression of, or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1 and / or SEQ ID NO:11, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: NO:2 and / or SEQ ID NO:12 and / or SEQ ID NO:12, and is further genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, as compared to the expression levels of the same cell type that has not been genetically engineered.

[0046] In some embodiments, the mammalian cell has been genetically engineered to have reduced expression of, or no expression of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8, reduced expression of, or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: NO:2 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:2; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14 NO:9 or a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10; and is further genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10, as compared to expression levels in the same cell type that has not been genetically engineered. NO:6 Expression of a protein having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0047] In some embodiments, the mammalian cell has been genetically engineered to have reduced expression of, or no expression of, a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:8, reduced expression of, or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: NO:2 at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO:2; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:12; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13; reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14 NO:9 or a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:10; reduced or absent expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:5. NO:6 expression of a protein having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical;wherein the cell is genetically engineered to have increased expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 13 and / or SEQ ID NO: 15, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 145 and / or SEQ ID NO: 146, as compared to expression levels in the same cell type that has not been genetically engineered;

[0048] In some embodiments, the mammalian cell has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 9, SEQ ID NO: 7, SEQ ID NO: 1 and SEQ ID NO: 11, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 10, SEQ ID NO: 8, SEQ ID NO: 2 and SEQ ID NO: 12, as compared to expression levels in the same cell type that has not been genetically engineered; NO:5 or a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6; and having increased expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145 and / or SEQ ID NO:146. NO:146 Expression of a protein having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0049] In some aspects of the present disclosure, mammalian cells (wherein the cells are ABO blood group O) have been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 3, SEQ ID NO: 5 and / or SEQ ID NO: 7, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 4, SEQ ID NO: 6 and / or SEQ ID NO: 8, as compared to the expression levels of the same cell type that has not been genetically engineered. In some embodiments, the mammalian ABO blood group O cell has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 9, SEQ ID NO: 7 and SEQ ID NO: 11, or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 10, SEQ ID NO: 8 and SEQ ID NO: 12, as compared to the expression levels of the same cell type that has not been genetically engineered; NO:5 or a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:4 and / or SEQ ID NO:6; and having increased expression of a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15 or a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:145 and / or SEQ ID NO:146. NO:146 Expression of a protein having an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0050] Some aspects of the present disclosure describe mammalian cells that have been genetically engineered to have reduced or no expression of a protein encoded by a renalase gene, and wherein the cells have also been genetically engineered to have reduced or no expression of a protein encoded by an ABO gene; reduced or no expression of a protein encoded by a CXCL10 gene; reduced or no expression of a protein encoded by a beta-2 microglobulin (B2M) gene; reduced or no expression of a protein encoded by a tissue factor (F3) gene; and / or increased expression of a protein encoded by a CD47 gene, as compared to the level of protein expression in the same cell type that has not been genetically engineered.

[0051] In some embodiments of the present disclosure, the mammalian cells have been genetically engineered to have increased expression of a protein encoded by a CD47 gene as compared to the level of protein expression in the same cell type that has not been genetically engineered, wherein the CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146, wherein the CD47 protein comprises a substitution at one or more amino acids corresponding to amino acid positions Q1, L3, A53, and L54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises a P or L at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an R, A, K, N, E, or V at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises a W, Y, D, Q, or V at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises an A, I, K, M, E, W, S, or V at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein comprises a P at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, CD47 comprises an amino acid other than Q at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146. In some embodiments, CD47 comprises an amino acid other than L at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146. In some embodiments, CD47 comprises an amino acid other than A at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146. In some embodiments, CD47 comprises an amino acid other than L at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146. In some embodiments, the CD47 protein is membrane-bound.

[0052] Some aspects of the present disclosure describe compositions comprising one or more engineered mammalian cells described herein. In some embodiments, the composition comprises more than one non-natural cell; wherein:

[0053] a) at least 30% of the cells in the composition are NKX6.1-positive and ISL1-positive cells;

[0054] b) at least 25% of the cells in the composition are NKX6.1-negative, ISL1-positive cells;

[0055] c) there are more NKX6.1-positive and ISL1-positive cells in the composition than NKX6.1-negative and ISL1-positive cells;

[0056] d)

[0057] i) less than 12% of the cells in the composition are NKX6.1 negative, ISL1 negative cells; and / or

[0058] ii) between 9%-25% of the cells in the composition are NKX6.1 positive, ISL1 negative cells; and

[0059] e) Less than 40% of the cells in the composition are VMAT1 positive cells.

[0060] Some aspects of the present disclosure describe methods of administering the compositions to a subject.In some embodiments, the subject has diabetes. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] This patent or application file contains at least one drawing executed in color. Copies of this patent or application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0063] Figure 1A-Figure 1C illustrate that the removal of A antigen protects SC islets from immune attack. Figure 1A is a bar graph showing the percentage of A-positive SC islet cells (Type A-positive SC-islet cells) differentiated from wild-type hESC or hESC of ABO knock-out form that have never been edited. Figure 1B is a bar graph showing the cytotoxicity percentage of SC islets differentiated from wild-type hESC or ABO knock-out hESC in antibody-dependent cellular toxicity assays. Figure 1C is a bar graph showing the cytotoxicity percentage of SC islets differentiated from wild-type hESC or ABO knock-out hESC in complement-dependent cytotoxicity assays. Figure is a representative of 5 independent experiments carried out with ABO-KO SC islet clonal cell lines.

[0064] Figure 2 Figure 3: T cell responses to SC islets (percentage of IFNγ-positive CD8 T cells) were measured in three different donors (donors 1-3) under three different conditions: 1) no stimulation (first bar in each donor graph); 2) wild-type SC islets (second bar in each donor graph); and 3) B2M-knockout SC islets (third bar in each donor graph).

[0065] Figures 3A-3B are graphs comparing wild-type cells and B2M knockout cells. Figure 3A is a graph showing wild-type or B2M knockout ("HLA-I") cells removed from transplants at designated time points. KO”) Graph showing the percentage of ISL1-positive cells in SC islets.

[0066] FIG3B shows the expression of wild type or B2M knockout ("HLA-I") cells removed at the indicated time points. KO ”) Frequency of hCD69 expression on hCD8-positive cells recovered from SC islet transplants. Asterisks indicate unpaired T-test.

[0067] Fig. 4 A-Fig. 4 B illustrate that the hESC that CD142 knocks out has the tissue factor pathway activation that significantly reduces in vitro.Fig. 4 A is the bar graph showing the percentage ratio of tissue factor (CD142) positive cells in wild-type hESC or two different CD142 knockout pools.Fig. 4 B is the bar graph showing the tissue factor percentage ratio in wild-type (WT) cell or in the cell from two different CD142 knockout cell pools." WT+αTF mAb " corresponds to the wild-type hESC that activates complement pathway with the anti-tissue factor antibody pretreatment of saturation level.Fig. 4 B mensuration includes cell, recombinant FVII and recombinant FX.FX is activated with colorimetric substrate measurement, and this depends on CD142 activation FVII, and FVII activates FX again.In the experiment shown, omitting FVII can not eliminate signal completely (" without FVII (determination baseline) ").

[0068] Figure 5A- Figure 5C A gene editing strategy for generating high-affinity CD47 mutants is illustrated. Figure 5A shows an exemplary guide sequence positioned near the editing site in CD47 to enable HDR-mediated repair. Figure 5B shows an example of a template sequence for templated repair. Figure 5C A simplified schematic diagram showing a portion of the wild-type CD47 protein sequence and a portion of the high-affinity CD47 protein sequence.

[0069] Figure 6 A series of flow cytometry plots of different CD47 mutants based on expression of NKX6.1 (x-axis) and ISL1 (y-axis) are shown. "WT" corresponds to SC islets generated from wild-type hESCs (top left panel). SB(CD47)51 corresponds to SC islets generated from hESCs heterozygous for CD47-high affinity editing and for CD47 knockout (top two right panels), SB(CD47)53 corresponds to SC islets generated from hESCs homozygous for CD47 high affinity editing (bottom two left panels); and SB(CD47)54 corresponds to SC islets generated from hESCs homozygous for CD47 knockout (bottom two right panels).

[0070] Figure 7Bar graph showing the percentage of CFSE-positive, CD11b-positive cells across different test conditions. "Positive CTRL" corresponds to FITC-dextran. "dKO HI TG1 TG2#22," "dKO HI TG1 TG2#23," "dKO HI TG1 TG2#24," and "dKO HI TG1 TG2#54" correspond to four different clones of endothelial cells differentiated from stem cells in which the B2M and CIITA genes were knocked out and the PDL1 and CD47 genes were knocked in.

[0071] Figure 8A-8B Shown are a series of flow cytometry graphs for the expression of the indicated genes in wild-type hESCs or three different hESC clones in which B2M and ABO were knocked out and CD47 was knocked in (clones A3, A5, and A11). Figure 8A Figures showing the expression of A antigen (top row), HLA-A, HLA-B, HLA-C (middle row), and CD47 (bottom row) are shown. In the bottom row, the first inset box in each figure indicates the fraction of expected endogenous levels of CD47, while the second inset box in each figure indicates the fraction of expected overexpression of CD47. Figure 8B Graph showing the expression of stem cell markers SOX2 and OCT4 in the indicated cell types.

[0072] Figure 9A-9B Flow cytometry plots are shown. Figure 9A Shown are several flow cytometry graphs of the expression of NKX6.1 (x-axis) and ISL1 (y-axis) in stage 5 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs that have been engineered to knock out B2M and ABO and knock in CD47. Figure 9A The lower panel shows a graph illustrating the percentages of different cell types in stage 5 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs that have been engineered to knock out B2M and ABO and knock in CD47. Figure 9B Shown are several flow cytometry graphs of the expression of NKX6.1 (x-axis) and ISL1 (y-axis) in stage 6 day 6 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs that have been engineered to knock out B2M and ABO and knock in CD47. Figure 9B The lower panel of shows a graph illustrating the percentage of different cell types in stage 6 day 6 SC islet cells differentiated from wild-type hESCs ("WT") or from hESCs that have been engineered to knock out B2M and ABO and knock in CD47. Figure 9A and Figure 9BFor each bar in the bar graph, the top quadrant of each bar corresponds to the percentage of cells that are double negative for NKX6.1 and ISL1, the second quadrant downward in each bar corresponds to the percentage of cells that are NKX6.1 positive and ISL1 negative, the third quadrant downward in each bar corresponds to the percentage of cells that are ISL1 positive and NKX6.1 negative, and the bottom quadrant in each bar corresponds to the percentage of cells that are ISL1 positive and NKX6.1 positive.

[0073] Figures 10A-10B show flow cytometry graphs. Figure 10A shows a flow cytometric graph of the expression of NKX6.1 (x-axis) and ISL1 (y-axis) in stage 5 or stage 6 day 6 SC islet cells differentiated from hESCs engineered to have B2M, ABO, and CD142 knocked out and CD47 knocked in. Figure 10B shows a flow cytometric graph of the expression of CD142 in stage 6 SC islets differentiated from hESCs engineered to have B2M, ABO, and CD142 knocked out and CD47 knocked in.

[0074] Incorporated by Reference

[0075] All publications, patents, and patent applications mentioned in this specification are incorporated herein by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. If a publication, patent, or patent application incorporated by reference contradicts the disclosure contained in this specification, this specification is intended to supersede and / or take precedence over any such contradictory material.

[0076] Detailed description

[0077] The following description and examples set forth embodiments of the present disclosure in detail. It should be understood that the present disclosure is not limited to the specific embodiments described herein, and therefore can vary. Those skilled in the art will appreciate that there are many variations and modifications in the present disclosure, and these variations and modifications are all included within the scope of the present invention.

[0078] All terms are intended to be understood as would be understood by one skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0079] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0080] Although various features of the present disclosure may be described in the context of a single embodiment, these features may also be provided separately or in any suitable combination. Conversely, although the present disclosure may be described herein in the context of separate embodiments for clarity, the present disclosure may also be implemented in a single embodiment.

[0081] The following definitions supplement those in the art and are specific to the present application and should not be attributed to any related or unrelated circumstances, for example, any commonly owned patents or applications. Although any methods and materials similar or equivalent to those described herein can be used to test the practice of the present disclosure, preferred materials and methods are described herein. Therefore, the terms used herein are only used for the purpose of describing specific embodiments and are not intended to be limiting.

[0082] In this application, the use of the singular includes the plural unless expressly stated otherwise. It must be noted that, as used in this specification, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise.

[0083] In this application, unless otherwise indicated, the use of "or" means "and / or". As used herein, the terms "and / or" and "any combination thereof" and their grammatical equivalents may be used interchangeably. These terms may indicate that any combination is specifically contemplated. For illustrative purposes only, the following phrases "A, B and / or C" or "A, B, C or any combination thereof" may mean "A alone; B alone; C alone; A and B; B and C; A and C; and A, B and C". The term "or" may be used conjunctively or disjunctively unless the context clearly indicates separate use.

[0084] Furthermore, use of the term "including" as well as other forms, such as "include," "includes," and "included," is not limiting.

[0085] Reference in the specification to "some embodiments," "an embodiment," "one embodiment," or "other embodiments" means that a particular feature, structure, or characteristic described in connection with the embodiment is included in at least some embodiments of the present disclosure, but not necessarily in all embodiments.

[0086] As used in this specification and claims, the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include"), or "containing" (and any form of "containing," such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the disclosure, and vice versa. In addition, compositions of the disclosure can be used to implement methods of the disclosure.

[0087] The term "about" or "approximately" means within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, for example, the limitations of the measurement system. For example, "about" can mean within one or more standard deviations, as practiced in the art. Alternatively, "about" can mean a range of up to 20%, up to 10%, up to 5%, or up to 1% of a given value. In another example, the amount "about 10" includes 10 and any amount from 9 to 11. In another example, the amount "about 10" includes 10 and any amount from 9 to 11. In yet another example, the term "about" with respect to a reference value can also include a range of values ​​of that value plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. Alternatively, particularly with respect to biological systems or processes, the term "about" can mean within an order of magnitude of a value, preferably within 5-fold of a value, and more preferably within 2-fold of a value. When particular values ​​are described in this application and claims, unless otherwise indicated, the term "about" should be assumed to mean within an acceptable error range for the particular value.

[0088] As used herein, the term "diabetes" and its grammatical equivalents may refer to a disease characterized by high blood sugar levels over a prolonged period of time. For example, as used herein, the term "diabetes" and its grammatical equivalents may refer to all or any types of diabetes, including, but not limited to, type 1 diabetes, type 2 diabetes, cystic fibrosis-related diabetes, surgical diabetes, gestational diabetes, and mitochondrial diabetes. In some embodiments, diabetes may be a form of hereditary diabetes. In some embodiments, diabetes may be an autoimmune form of diabetes.

[0089] If not otherwise specified, the term "endocrine cell" may refer to a hormone-producing cell present in the pancreas of an organism, such as an "islet," "islet cell," "islet equivalent," "islet-like cell," "pancreatic islet," and grammatical equivalents thereof. In embodiments, endocrine cells may be distinguished from pancreatic progenitor cells or precursors. Islet cells may include different types of cells, including but not limited to pancreatic α cells, pancreatic β cells, pancreatic δ cells, pancreatic F cells, and / or pancreatic ε cells. Islet cells may also refer to a group of cells, a cell cluster, and the like.

[0090] "Guide RNA" and "guide" for short are used interchangeably herein to refer to crRNA (also referred to as CRISPR RNA) nucleic acid, or a combination of crRNA nucleic acid and trRNA (also referred to as tracrRNA) nucleic acid. CrRNA and trRNA can be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (double guide RNA, dgRNA). Unless otherwise indicated, "guide RNA" refers to each type. TrRNA can be a naturally occurring sequence, or a trRNA sequence with a modification or variation compared to a naturally occurring sequence. For clarity, unless otherwise specifically indicated, the term "guide RNA" or "guide" as used herein can refer to an RNA molecule (comprising A, C, G, and U nucleotides) or a DNA molecule (comprising A, C, G, and T nucleotides) encoding such an RNA molecule, or its complementary sequence. Typically, in the case of a DNA nucleic acid construct encoding a guide RNA, the U residues in any RNA sequence described herein can be replaced by T residues, and in the case of a guide RNA construct encoded by any DNA sequence described herein, the T residues can be replaced by U residues. In some embodiments, any guide RNA sequence comprises a scaffold sequence. In some embodiments, the scaffold sequence comprises a sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 143 (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAG TGGCACCGAGTCGGTGCTTTT). In some embodiments, the guide RNA comprises one or more modified nucleotides. Discussion of modified guide RNAs can be found in, for example, WO2022 / 056000, which is incorporated herein in its entirety. In some embodiments, the guide RNA is unmodified.

[0091] "Polynucleotide," "nucleic acid," and "nucleic acid molecule" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs having nitrogenous heterocyclic bases or base analogs linked together along a backbone, including conventional RNA, DNA, mixed RNA-DNA, and polymers that are analogs thereof. The nucleic acid "backbone" can be composed of a variety of linkages, including one or more of sugar-phosphodiester bonds, peptide-nucleic acid bonds ("peptide nucleic acid" or PNA; PCT No. WO 95 / 32305), phosphorothioate bonds, methylphosphonate bonds, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds having substitutions (e.g., 2' methoxy or 2' halide substitutions). The nitrogenous base can be a conventional base (A, G, C, T, U), an analog thereof (e.g., a modified uridine such as 5-methoxyuridine, pseudouridine or N1-methylpseudouridine, etc.); inosine; a derivative of purine or pyrimidine (e.g., N4-methyldeoxyguanosine, a deazapurine or azapurine, a deazapyrimidine or azapyrimidine, a pyrimidine base having a substituent at position 5 or 6 (e.g., 5-methylcytosine), a purine base having a substituent at position 2, 6 or 8, 2-amino-6-methylaminopurine, O6-methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine and O4-alkyl-pyrimidines; U.S. Pat. No. 5,378,825 and PCT No. WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids 5-36, Adams et al., eds., 11th ed., 1992. Nucleic acids may contain one or more "abasic" residues, in which the backbone does not contain a nitrogenous base at the polymer position (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNA), an analog containing one or more LNA nucleotide monomers having a bicyclic furanose unit locked in an RNA-mimicking sugar conformation that enhances hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42): 13233-41). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA. The present disclosure provides a number of exemplary nucleotide sequences herein, and contemplates the reverse complements of these nucleotide sequences, as well as the RNA and / or DNA equivalents of any of these sequences.For example, the RNA equivalent of any DNA sequence disclosed herein will contain uracil in place of thymine in the sequence, and the DNA equivalent of any RNA sequence disclosed herein will contain thymine in place of uracil.

[0092] As used herein, "CRISPR" systems and "RNA-targeted endonuclease is a type II CRISPR Cas enzyme" or "Cas nuclease" include type II CRISPR systems of Streptococcus pyogenes (S. pyogenes), Staphylococcus aureus (S. aureus), and other prokaryotes, and modified (e.g., engineered or mutant) forms thereof. See, e.g., US2016 / 0312198A1; US2016 / 0312199A1. In specific embodiments, the RNA-targeted endonuclease is a type II CRISPR Cas enzyme. Other examples of Cas nucleases include the Csm or Cmr complex of a type III CRISPR system, or its Cas10, Csm1, or Cmr2 subunits; and the Cascade complex of a type I CRISPR system, or its Cas3 subunits. In some embodiments, the Cas nuclease may be from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, e.g., Makarova et al., Nat. Rev. Microbiol., 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol., 13:722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp.), Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis), Streptomyces viridochromogenes, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas species sp.), Crocosphaera watsonii, Cyanothecesp.), Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp.), Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Spirulina sp., Microcoleus chthonoplastes, Oscillatoria sp.), Petrotoga mobilis, Thermosiphoafricanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina. In some embodiments, the Cas protein is Cpf1 or Cas12 (e.g., Cas12i2) protein. In some embodiments, the present disclosure provides cells (e.g., stem cells or stem cell-derived β cells) comprising one or more genetic disruptions using a CRISPR system and one or more guide RNAs comprising any sequence disclosed herein. In some embodiments, the CRISPR system disrupts a target gene by introducing one or more insertions / deletions (e.g., indels) into the target gene.

[0093] In some embodiments, the Cas protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 144 (designated herein as SpCas9):

[0094]

[0095] The terms "progenitor cell" and "precursor" cell are used interchangeably herein and refer to cells that have a more primitive cellular phenotype relative to the cells that can be generated by differentiation (e.g., cells that are at an earlier step in a developmental pathway or progression than fully differentiated cells). Typically, progenitor cells can also have a significant or very high proliferation potential. Progenitor cells can give rise to a variety of different differentiated cell types or a single differentiated cell type, depending on the developmental pathway and the environment in which the cells develop and differentiate.

[0096] The term "precursor thereof" in relation to insulin-positive endocrine cells may refer to any cell capable of differentiating into insulin-positive endocrine cells, including, for example, pluripotent stem cells, definitive endoderm cells, primitive intestinal tube cells, pancreatic progenitor cells or endocrine progenitor cells that will differentiate into insulin-positive endocrine cells if cultured under appropriate conditions.

[0097] The terms "stem cell-derived β cells," "SC-β cells," "functional β cells," "functional pancreatic β cells," "mature SC-β cells," "β-like cells," and their grammatical equivalents may refer to cells (e.g., non-natural pancreatic β cells) that display at least one marker indicative of a pancreatic β cell (e.g., PDX-1 or NKX6.1), express insulin, and exhibit a glucose-stimulated insulin secretion (GSIS) response similar to or superior to that of endogenous mature β cells (e.g., mature β cells from a healthy, functional pancreas of a healthy adult non-diabetic patient). For simplicity, SC-β cells may be simply referred to as "β cells" in this disclosure. In some embodiments, the terms "SC-β cells" and "non-natural β cells" as used herein are interchangeable. In some embodiments, "SC-β cells" express lower levels of MAFA than pancreatic β cells from healthy adult patients. In some embodiments, "SC-β cells" express higher levels of MAFB than pancreatic β cells from healthy adult patients. In some embodiments, "SC-β cells" express higher levels of SIX2, HOPX, IAPP and / or UCN3 than pancreatic β cells from healthy adult patients. In some embodiments, "SC-β cells" include mature pancreatic cells. It should be understood that SC-β cells do not need to be derived from stem cells (e.g., directly), because the methods of the present disclosure can use any cell as a starting point (e.g., embryonic stem cells, induced pluripotent stem cells, progenitor cells (such as definitive endoderm cells), partially reprogrammed somatic cells (e.g., somatic cells that have been partially reprogrammed to an intermediate state between induced pluripotent stem cells and the somatic cells from which they are derived), pluripotent cells, totipotent cells, transdifferentiation forms of any of the foregoing cells, etc., because the present invention is not intended to be limited in this manner) to derive SC-β cells from any insulin-positive endocrine cell or its precursor. In some embodiments, SC-β cells exhibit a response to more than one glucose stimulus (e.g., at least one, at least two, or at least three or more sequential glucose stimuli). In some embodiments, the response is similar to the response of endogenous pancreatic islets (e.g., human pancreatic islets) to more than one glucose stimulus. In some embodiments, the morphology of SC-β cells is similar to that of endogenous β cells. In some embodiments, SC-β cells exhibit an in vitro GSIS response similar to the GSIS response of endogenous β cells. In some embodiments, SC-β cells exhibit an in vivo GSIS response similar to the GSIS response of endogenous β cells. In some embodiments, SC-β cells exhibit an in vitro GSIS response and an in vivo GSIS response similar to the GSIS response of endogenous β cells. In some embodiments, the GSIS response of SC-β cells can be observed within two weeks of SC-β cell transplantation into a host (e.g., a human or an animal).In some embodiments, the GSIS response of SC-β cells can be observed within three weeks of SC-β cell transplantation into a host (e.g., humans or animals). In some embodiments, the GSIS response of SC-β cells can be observed within four weeks of SC-β cell transplantation into a host (e.g., humans or animals). In some embodiments, the GSIS response of SC-β cells can be observed between one and three months of SC-β cell transplantation into a host (e.g., humans or animals). In some embodiments, SC-β cells encapsulate insulin in secretory granules. In some embodiments, when observed using electron microscopy, SC-β cells exhibit encapsulated crystalline insulin granules. In some embodiments, SC-β cells exhibit a stimulation index greater than 1. In some embodiments, SC-β cells exhibit a stimulation index greater than 1.1. In some embodiments, SC-β cells exhibit a stimulation index greater than 2. In some embodiments, the stimulation index of the cell is characterized by the ratio of insulin secreted in response to high glucose concentrations (e.g., 15mM) to in response to low glucose concentrations (e.g., 2.5mM).

[0098] In some embodiments, SC-β cells exhibit cytokine-induced apoptosis in response to cytokines. In some embodiments, insulin secretion of SC-β cells is enhanced in response to known antidiabetic drugs (e.g., secretagogues). In some embodiments, SC-β cells are single hormones. In some embodiments, SC-β cells do not abnormally co-express other hormones such as glucagon, somatostatin, or pancreatic polypeptide. In some embodiments, SC-β cells exhibit a low replication rate. In some embodiments, SC-β cells increase intracellular Ca in response to glucose. 2+ .

[0099] The terms "stem cell-derived α cells," "SC-α cells," "functional α cells," "functional pancreatic α cells," "mature SC-α cells," "α-like cells," and their grammatical equivalents may refer to cells (e.g., non-natural pancreatic α cells) that display at least one marker indicative of a pancreatic α cell (e.g., glucagon, expressing ISL1 but not expressing NKX6.1), express glucagon, and are capable of secreting functional glucagon in response to stimulation that induces endogenous pancreatic α cells to secrete functional glucagon. In some embodiments, "SC-α cells" do not express somatostatin. In some embodiments, "SC-α cells" do not express insulin. In some embodiments, the terms "SC-α cells" and "non-natural α cells" as used herein are interchangeable. In some embodiments, "SC-α cells" include mature pancreatic cells. In short, these cells may be simply referred to as "α cells" in the present disclosure.

[0100] The terms "stem cell-derived delta cells," "SC-delta cells," "functional delta cells," "functional pancreatic delta cells," "mature SC-delta cells," "delta-like cells," and their grammatical equivalents may refer to cells (e.g., non-natural pancreatic delta cells) that display at least one marker indicative of a pancreatic delta cell (e.g., somatostatin), express and are capable of secreting somatostatin in response to stimulation that induces endogenous pancreatic delta cells to secrete functional glucagon. For simplicity, SC-delta cells may be simply referred to as "delta cells" in this disclosure. In some embodiments, "SC-delta cells" do not express glucagon. In some embodiments, "SC-delta cells" do not express insulin. In some embodiments, the terms "SC-delta cells" and "non-natural delta cells" used herein are interchangeable. In some embodiments, "SC-delta cells" include mature pancreatic cells.

[0101] The terms "stem cell-derived enterochromaffin (EC) cells," "SC-EC cells," and grammatical equivalents thereof, may refer to cells (e.g., non-natural pancreatic EC cells) that display at least one marker indicative of pancreatic EC cells (e.g., VMAT1 (vesicular monoamine transporter 1), expression of NKX6.1 but not expression of ISL1). In some embodiments, the terms "SC-EC cells" and "non-natural EC cells" as used herein are interchangeable.

[0102] The terms "stem cell-derived islet cells," "SC islet cells," and their grammatical equivalents refer to islet cells or islet-like cells that have been differentiated from stem cells in vitro. Examples of SC islet cells include SC-β cells, SC-α cells, and SC-δ cells.

[0103] It should be understood that SC islet cells need not be derived from stem cells (e.g., directly), as the methods of the present disclosure are capable of deriving SC islet cells from other precursor cells generated during in vitro differentiation starting with SC islet cells (e.g., one can use embryonic stem cells, induced pluripotent stem cells, progenitor cells, partially reprogrammed somatic cells (e.g., somatic cells that have been partially reprogrammed to an intermediate state between induced pluripotent stem cells and the somatic cells from which they are derived), pluripotent cells, totipotent cells, transdifferentiated forms of any of the foregoing, etc., as the present invention is not intended to be limited in this manner).

[0104] As used herein, the term "insulin producing cell" and its grammatical equivalents refer to cells that secrete insulin differentiated from pancreatic progenitor cells or their precursors. Insulin producing cells can include the term pancreatic β cells as described herein, as well as pancreatic β-like cells (e.g., insulin-positive, endocrine cells) that synthesize (e.g., transcribe insulin genes, translate proinsulin mRNA, and modify proinsulin mRNA to insulin protein) in a constitutive or inducible manner, express (e.g., exhibit phenotypic traits carried by insulin genes), or secrete (release insulin into the extracellular space) insulin. Insulin producing cell colonies, for example, insulin-producing cell colonies produced by differentiating insulin-positive endocrine cells or their precursors into SC-β cells according to the methods of the present disclosure can be pancreatic β cells or β-like cells (e.g., cells having at least one or at least two characteristics of endogenous β cells and exhibiting glucose-stimulated insulin secretion (GSIS) responses similar to endogenous adult β cells). Insulin-producing cell populations, such as those produced by the methods disclosed herein, can include mature pancreatic β cells or SC-β cells, and can also include non-insulin-producing cells (e.g., cells with a β-like phenotype, but they do not produce or secrete insulin).

[0105] The terms "insulin-positive β-like cells," "insulin-positive endocrine cells," and grammatical equivalents thereof, may refer to cells that display at least one marker indicative of pancreatic β cells and also express insulin (e.g., pancreatic endocrine cells), but, unless otherwise indicated, lack the glucose-stimulated insulin secretion (GSIS) response characteristic of endogenous β cells. Exemplary markers for "insulin-positive endocrine cells" include, but are not limited to, NKX6.1 (NK6 homeobox 1), ISL1 (Islet1), and insulin.

[0106] The term "β cell marker" refers to, but is not limited to, proteins, peptides, nucleic acids, polymorphisms of proteins and nucleic acids, splice variants, fragments of proteins or nucleic acids, elements and other analytes expressed or present in pancreatic β cells. Exemplary β cell markers include, but are not limited to, pancreatic and duodenal homeobox 1 (PDX1) polypeptide, insulin, c-peptide, islet amylin, E-cadherin, Hnf3β, PCI / 3, B2, Nkx2.2, GLUT2, PC2, ZnT-8, ISL1, Pax6, Pax4, NeuroD, 1Inf1b, Hnf-6, Hnf-3β, VMAT2, NKX6.1 and MafA, as well as those described in Zhang et al., Diabetes.50(10):2231-6(2001). In some embodiments, the β cell marker is a nuclear β cell marker. In some embodiments, the β cell marker is PDX1 or PH3.

[0107] The term "pancreatic endocrine marker" may refer to, but is not limited to, proteins, peptides, nucleic acids, polymorphisms of proteins and nucleic acids, splice variants, fragments of proteins or nucleic acids, elements, and other analytes expressed or present in pancreatic endocrine cells. Exemplary pancreatic endocrine cell markers include, but are not limited to, Ngn-3, NeuroD, and Islet-1.

[0108] The terms "pancreatic progenitor cells," "pancreatic endocrine progenitor cells," "pancreatic precursors," "pancreatic endocrine precursors," and their grammatical equivalents are used interchangeably herein and may refer to stem cells capable of becoming pancreatic hormone-expressing cells capable of forming pancreatic endocrine cells, pancreatic exocrine cells, or pancreatic duct cells. These cells are committed to differentiating into at least one type of pancreatic cell, e.g., beta cells that produce insulin; alpha cells that produce glucagon; delta cells (or D cells) that produce somatostatin; and / or F cells that produce pancreatic polypeptide. Such cells may express at least one of the following markers: NGN3, NKX2.2, NeuroD, ISL-1, Pax4, Pax6, or ARX.

[0109] As used herein, the term "PDX1 positive pancreatic progenitor cells" may refer to cells that are pancreatic endoderm (PE) cells that have the ability to differentiate into SC-β cells (such as pancreatic β cells). PDX1 positive pancreatic progenitor cells express the marker PDX1. Other markers include, but are not limited to, Cdcp1 or Ptf1a or HNF6 or NRx2.2. The expression of PDX1 can be assessed by any method known to the skilled person, such as immunochemistry or quantitative RT-PCR using anti-PDX1 antibodies. In some embodiments, PDX1 positive pancreatic progenitor cells lack the expression of NKX6.1. In some embodiments, because PDX1 positive pancreatic progenitor cells lack the expression of NKX6.1, they may also be referred to as PDX1 positive, NKX6.1 negative pancreatic progenitor cells. In some embodiments, PDX1 positive pancreatic progenitor cells may also be referred to as "pancreatic foregut endoderm cells."

[0110] The terms "PDX1-positive, NKX6.1-positive pancreatic progenitor cells" and "NKX6.1-positive pancreatic progenitor cells" are used interchangeably herein and may refer to cells that are pancreatic endoderm (PE) cells that have the ability to differentiate into insulin-producing cells, such as pancreatic beta cells. PDX1-positive, NKX6.1-positive pancreatic progenitor cells express the markers PDX1 and NKX6.1. Other markers may include, but are not limited to, Cdcp1 or Ptf1a or HNF6 or NRx2.2. The expression of NKX6.1 may be assessed by any method known to the skilled person, such as immunochemistry or quantitative RT-PCR using an anti-NKX6.1 antibody. As used herein, the terms "NKX6.1" and "NKX6.1" are equivalent and interchangeable. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells may also be referred to as "pancreatic foregut precursor cells."

[0111] The terms "NeuroD" and "NeuroD1" are used interchangeably and identify a protein expressed in pancreatic endocrine progenitor cells and the gene encoding the protein.

[0112] The term "differentiated cell" or its grammatical equivalent refers to any primary cell that is not pluripotent (as the term is defined herein) in its native form. In other words, the term "differentiated cell" can refer to a cell of a higher degree of specialized cell type derived from a cell of a less specialized cell type (e.g., stem cells, such as induced pluripotent stem cells) during cell differentiation. Without being limited by theory, pluripotent stem cells can first differentiate into endoderm cells and other endoderm cell types that can form pancreatic cells during normal individual development. The further differentiation of endoderm cells may lead to pancreatic pathways, in which ~98% of the cells become exocrine, ductal or stromal cells, and ~2% of the cells become endocrine cells. Early endocrine cells are pancreatic islet progenitor cells, which can subsequently further differentiate into insulin-producing cells (e.g., functional endocrine cells) that secrete insulin, glucagon, somatostatin or pancreatic polypeptide. Endoderm cells can also differentiate into other cells of endoderm origin, e.g., cells of the lung, liver, intestine, thymus, etc.

[0113] As used herein, the term "somatic cell" can refer to any cell of the body that forms an organism, in contrast to germline cells. In mammals, germline cells (also referred to as "gametes") are sperm and ovum, which fuse during fertilization to produce a cell called a zygote, from which the entire mammalian embryo develops. All other cell types in the mammalian body (except sperm and ovum, the cells (gametocytes) that form them, and undifferentiated stem cells) are somatic cells: internal organs, skin, bones, blood, and connective tissue are all made up of somatic cells. In some embodiments, somatic cells are "non-embryonic somatic cells," which refer to somatic cells that are not present in an embryo or are not obtained from an embryo and are not produced by in vitro propagation of such cells. In some embodiments, somatic cells are "adult somatic cells," which refer to cells present in or obtained from an organism other than an embryo or fetus, or cells obtained from in vitro propagation of such cells. Unless otherwise indicated, methods for converting at least one insulin-positive endocrine cell, or a precursor thereof, into an insulin-producing, glucose-responsive cell can be performed both in vivo and in vitro (wherein in vivo is practiced when the at least one insulin-positive endocrine cell, or a precursor thereof, is present in a subject, and in vitro is practiced using isolated at least one insulin-positive endocrine cell, or a precursor thereof, maintained in culture).

[0114] As used herein, the term "adult cell" may refer to cells found throughout the body after embryonic development.

[0115] As used herein, the term "endodermal cell" may refer to cells from one of the three major germ cell layers in a very early embryo (the other two germ cell layers are the mesoderm and ectoderm). The endoderm is the innermost layer of these three layers. Endoderm cells first differentiate to produce the embryonic intestine, and then differentiate into the lining of the respiratory and digestive tracts (e.g., intestines), the liver, and the pancreas.

[0116] As used herein, the term "cell of endoderm origin" may refer to any cell that develops or differentiates from an endoderm cell. For example, cells of endoderm origin include cells of the liver, lung, pancreas, thymus, intestine, stomach, and thyroid. Without wishing to be bound by theory, liver and pancreatic progenitor cells (also referred to as pancreatic progenitor cells) develop from endoderm cells in the embryonic foregut. Soon after specialization, liver and pancreatic progenitor cells rapidly acquire significantly different cellular functions and regenerative abilities. These changes are caused by inductive signals and genetic regulatory factors that are highly conserved in vertebrates. The strong demand for hepatocytes and pancreatic beta cells in the therapeutic treatment of liver failure and type 1 diabetes has aroused people's interest in organ development and regeneration. Studies in a variety of model organisms and humans have shown that evolutionarily conserved inductive signals and transcription factor networks trigger the differentiation of liver and pancreatic cells and provide guidance for how to promote the differentiation of hepatocytes and beta cells from a variety of stem cells and progenitor cell types.

[0117] As used herein, the term "definitive endoderm" can refer to cells that differentiate from endoderm cells and can differentiate into SC-β cells (e.g., pancreatic β cells). Definitive endoderm cells express the marker Sox17. Other markers characteristic of definitive endoderm cells can include, but are not limited to, MIXL2, GATA4, HNF3b, GSC, FGF17, VWF, CALCR, FOXQ1, CXCR4, Cerberus, OTX2, goosecoid, C-Kit, CD99, CMKOR1, and CRIP1. In particular, the definitive endoderm cells herein express Sox17, and in some embodiments express Sox17 and HNF3B, and do not express significant levels of GATA4, SPARC, APF, or DAB. Definitive endoderm cells are not positive for marker PDX1 (e.g., they are PDX1 negative). Definitive endoderm cells have the ability to differentiate into cells including those of the liver, lung, pancreas, thymus, intestine, stomach, and thyroid. Expression of Sox17 and other markers of definitive endoderm can be assessed by any method known to the skilled artisan, such as immunochemistry using anti-Sox17 antibodies or quantitative RT-PCR.

[0118] The term "pancreatic endoderm" may refer to cells of endoderm origin that are capable of differentiating into various pancreatic lineages, including pancreatic β cells, but no longer have the ability to differentiate into non-pancreatic lineages.

[0119] The term "islet cells" refers to a cell population that includes different types of pancreatic endocrine cells (β-cells, α-cells, δ-cells, ε-cells) and enterochromaffin (EC) cells, for example, as described by Xavier et al., (J Clin Med. 2018 Mar; 7(3): 54), incorporated herein by reference.

[0120] As used herein, the term "primitive intestinal tube cells" or "intestinal tube cells" may refer to cells that differentiate from endoderm cells and can differentiate into SC-β cells (e.g., pancreatic β cells). Primitive intestinal tube cells express at least one of the following markers: HNP1-β, HNF3-β, or HNF4-α. In some embodiments, primitive intestinal tube cells are FOXA2 positive and SOX2 positive, that is, they express both FOXA2 (also known as HNF3-β) and SOX2. In some embodiments, primitive intestinal tube cells are FOXA2 positive and PDX1 negative, that is, they express FOXA2 but not PDX1. Primitive intestinal tube cells have the ability to differentiate into cells including lung, liver, pancreas, stomach, and intestinal cells. The expression of HNF1-β and other markers of primitive intestinal tubes can be assessed by any method known to technicians, such as immunochemistry using, for example, anti-HNF1-β antibodies.

[0121] The term "phenotype" may refer to one or a number of gross biological characteristics that define a cell or organism under a specific set of environmental conditions and factors, regardless of the actual genotype.

[0122] The terms "patient," "subject," and "individual" are used interchangeably and may refer to both humans and non-human animals. "Non-human animals" and "non-human mammals," as used interchangeably herein, include mammals such as rats, mice, rabbits, sheep, cats, dogs, cows, pigs, and non-human primates. The term "subject" also encompasses any vertebrate, including but not limited to mammals, reptiles, amphibians, and fish. However, advantageously, the subject is a mammal, such as a human, or other mammal, such as a domesticated mammal, e.g., dog, cat, horse, etc., or a producing mammal, e.g., cow, sheep, pig, etc. A "patient in need thereof" or "subject in need thereof" herein refers to a patient diagnosed with or suspected of having a disease or disorder, such as, but not limited to, diabetes.

[0123] As used herein, "administering" can refer to providing one or more compositions described herein to a patient or subject. For example, and not limitation, composition administration (e.g., injection) can be performed by intravenous (iv) injection, subcutaneous (sc) injection, intradermal (id) injection, intraperitoneal (ip) injection, or intramuscular (im) injection. One or more such approaches can be used. Parenteral administration can be, for example, by bolus injection or by gradual perfusion over time. Alternatively or simultaneously, oral administration can be used. In addition, pellets or boluses of surgically deposited cells or positioning medical devices can also be used. In embodiments, the compositions of the present disclosure can include engineered cells or host cells expressing nucleic acid sequences described herein, or a vector comprising at least one nucleic acid sequence described herein, in an amount effective to treat or prevent proliferative disorders. Pharmaceutical compositions can include cell colonies as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents, or excipients. Such compositions may include a buffer, such as neutral buffered saline, phosphate buffered saline, etc.; a sugar, such as glucose, mannose, sucrose or dextran, mannitol; a protein; a polypeptide or an amino acid, such as glycine; an antioxidant; a chelating agent, such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative.

[0124] As used herein, the terms "genetically engineered", "genetically altered" or "genetically modified" and their grammatical equivalents refer to non-natural genetic modifications. Examples of genetic engineering include the use of gene editing systems such as CRISPR / Cas, piggybac, TALEN and / or zinc finger systems to destroy the expression of one or more gene targets in a cell (e.g., to reduce or eliminate expression), or for increasing expression in a cell (e.g., by inserting a gene of interest). As used herein, "genetically engineered", "genetically altered" or "genetically modified" cells mean genetically engineered cells, or cells derived from and / or passaged from genetically engineered cells. For example, SC islet cells derived from genetically engineered stem cells will be considered to be genetically engineered SC islets.

[0125] In some embodiments, "ABO" as used herein is a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1. In some embodiments, "ABO" is a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2.

[0126] In some embodiments, "renalase" as used herein is a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 3 or 5. In some embodiments, "renalase" is a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 4 and / or 6.

[0127] In some embodiments, as used herein, "CXCL10" is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 7. In some embodiments, "CXCL10" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 8.

[0128] In some embodiments, "beta-2 microglobulin" or "B2M" as used herein is a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, "B2M" is a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 10.

[0129] In some embodiments, "tissue factor" as used herein is a protein encoded by a nucleic acid at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 11. In some embodiments, "tissue factor" is a protein comprising an amino acid sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12.

[0130] In some embodiments, "CD47" as used herein is a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13 or 15. In some embodiments, "CD47" is a protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 145, and / or SEQ ID NO: 146.

[0131] stem cells

[0132] The term "stem cell" is used herein to refer to mammalian cells (Morrison et al. (1997) Cell 88:287-298) with the ability to self-renew and generate differentiated cell types. In the context of cell ontogeny, the adjective "differentiated" or "differentiating" is a relative term. "Differentiated cells" are cells that develop further downward along the developmental pathway relative to the cells compared therewith. Therefore, pluripotent stem cells can be differentiated into lineage-restricted progenitor cells (e.g., mesodermal stem cells), which can then be differentiated into further restricted cells (e.g., neuronal progenitor cells), which can be differentiated into terminal stage cells (i.e., terminally differentiated cells, e.g., neurons, cardiomyocytes, etc.), which have characteristic effects in certain tissue types and can retain or not retain the ability to further propagate. Stem cells can be characterized by the presence of specific markers (e.g., proteins, RNA, etc.) and the absence of specific markers. Stem cells can also be differentiated by in vitro functional assays and in vivo functional assays, particularly the assays relevant to the ability of stem cells to produce multiple differentiated offspring. In embodiments, the host cell is an adult stem cell, a somatic stem cell, a non-embryonic stem cell, an embryonic stem cell, a hematopoietic stem cell, an induced pluripotent stem cell, and a trophoblast stem cell. In some embodiments, the stem cell line is a natural O blood type cell line (i.e., the cell line is not genetically engineered to be an O blood type cell line). In some embodiments, the stem cell line is a natural Rh - (Rhesus factor negative) cell line. In some embodiments, the cells comprise a genetic disruption in the RHD gene. In some embodiments, the cells do not comprise a genetic disruption in the RHD gene. In some embodiments, the cells comprise a genetic disruption in the RHCE gene. In some embodiments, the cells do not comprise a genetic disruption in the RHCE gene.

[0133] Stem cells of interest include pluripotent stem cells (PSCs). The term "pluripotent stem cell" or "PSC" is used herein to refer to a stem cell that is capable of producing all cell types of an organism. Thus, PSCs can produce cells of all germ layers of an organism (e.g., endoderm, mesoderm, and ectoderm of vertebrates). Pluripotent cells are capable of forming teratomas and contributing to ectoderm, mesoderm, or endoderm tissue in living organisms. Pluripotent stem cells of plants are capable of producing all cell types of a plant (e.g., cells of roots, stems, leaves, etc.).

[0134] The PSC of animal can be obtained by a variety of different ways. For example, embryonic stem cell (ESC) is derived from the inner cell mass of embryo (Thomson et al., Science.1998 November 6; 282 (5391): 1145-7), and induced pluripotent stem cell (iPSC) is derived from somatic cells (Takahashi et al., Cell.2007 November 30; 131 (5): 861-72; Takahashi et al., Nat Protoc.2007; 2 (12): 3081-9; Yu et al., Science.2007 December 21; 318 (5858): 1917-20. Epub 2007 November 20). Because the term PSC refers to pluripotent stem cells without considering their origin, the term PSC includes the terms ESC and iPSC, and the term embryonic germ stem cell (EGSC), which is another example of PSC. PSCs may be in the form of established cell lines, they may be obtained directly from primary embryonic tissue, or they may be derived from somatic cells.

[0135] "Embryonic stem cells" (ESCs) refer to PSCs isolated from an embryo, typically the inner cell mass of a blastocyst. ESC cell lines are listed in the NIH Human Embryonic Stem Cell Registry, e.g., hESBGN-01, hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc.); HES-1, HES-2, HES-3, HES-4, HES-5, HES-6 (ES Cell International); Miz-hESI (MizMedi Hospital-Seoul National University); HSF-1, HSF-6 (University of California at San Francisco); and H1, H7, H9, H13, H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)). In some embodiments, the ESC is a Cyt49 (CVCL_B850) cell line. The stem cells of interest also include embryonic stem cells from other primates, such as rhesus monkey stem cells and marmoset stem cells. Stem cells can be obtained from any mammalian species, for example, humans, equines, bovines, porcines, canines, felines, rodents (e.g., mice, rats, hamsters), primates, etc. (Thomson et al., (1998) Science 282:1145; Thomson et al., (1995) Proc. Natl. Acad. Sci USA 92:7844; Thomson et al., (1996) Biol. Reprod. 55:254; Shamblott et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998). In a preferred embodiment, stem cells are human stem cells. In culture, ESCs typically grow as flat colonies with a large nuclear-cytoplasmic ratio, clear boundaries, and prominent nucleoli. In addition, ESCs express SSEA-3, SSEA-4, TRA-1-60, TRA-1-81, and alkaline phosphatase, but do not express SSEA-1. Examples of methods for generating and characterizing ESCs can be found, for example, in U.S. Patent Nos. 7,029,913, 5,843,780, and 6,200,806, each of which is incorporated herein in its entirety. Methods for proliferating undifferentiated hESCs are described in WO 99 / 20741, WO 01 / 51616, and WO 03 / 020920, each of which is incorporated herein in its entirety.In some embodiments, the ESC cell line is a naturally O blood type cell line (ie, the cell line is not genetically engineered to be a blood type O cell line). In some embodiments, the ESC cell line is Rh naturally. - (Rhesus factor negative) cell line. In some embodiments, the cells comprise a genetic disruption in the RHD gene. In some embodiments, the cells do not comprise a genetic disruption in the RHD gene. In some embodiments, the cells comprise a genetic disruption in the RHCE gene. In some embodiments, the cells do not comprise a genetic disruption in the RHCE gene.

[0136] "Embryonic germ stem cells" (EGSCs) or "embryonic germ cells" or "EG cells" means PSCs derived from germ cells and / or germ cell progenitors, such as primordial germ cells, i.e., those cells that can become sperm and eggs. Embryonic germ cells (EG cells) are believed to have similar properties to those of the embryonic stem cells described above. Examples of methods for generating and characterizing EG cells can be found, for example, in U.S. Pat. No. 7,153,684; Matsui, Y. et al., (1992) Cell 70:841; Shamblott, M. et al., (2001) Proc. Natl. Acad. Sci. USA 98:113; Shamblott, M. et al., (1998) Proc. Natl. Acad. Sci. USA, 95:13726; and Koshimizu, U. et al., (1996) Development, 122:1235, each of which is incorporated herein in its entirety.

[0137] "Induced pluripotent stem cells" or "iPSCs" refer to PSCs that are derived from cells that are not PSCs (i.e., derived from cells differentiated relative to PSCs). iPSCs can be derived from a variety of different cell types, including terminally differentiated cells. iPSCs have an ES cell-like morphology and grow as flat colonies with a large nuclear-cytoplasmic ratio, clear boundaries, and prominent nucleoli. In addition, iPSCs express one or more key pluripotency markers known to those of ordinary skill in the art, including but not limited to alkaline phosphatase, SSEA3, SSEA4, Sox2, Oct3 / 4, Nanog, TRA160, TRA181, TDGF 1, Dnmt3b, FoxD3, GDF3, Cyp26a1, TERT, and zfp42. Examples of methods for generating and characterizing iPSCs can be found in, for example, U.S. Patent Publication Nos. US20090047263, US20090068742, US20090191159, US20090227032, US20090246875, and US20090304646, each of which is incorporated herein in its entirety. Typically, to generate iPSCs, somatic cells are provided with reprogramming factors known in the art (e.g., Oct4, SOX2, KLF4, MYC, Nanog, Lin28, etc.) to reprogram somatic cells into pluripotent stem cells.

[0138] "Somatic cell" means any cell in an organism that, without experimental manipulation, does not normally give rise to all types of cells in the organism. In other words, somatic cells are cells that have differentiated sufficiently that they are unable to naturally generate cells of all three germinal layers of the body (i.e., ectoderm, mesoderm, and endoderm). For example, somatic cells can include neuronal cells and neural progenitor cells, which are able to naturally give rise to all or some cell types of the central nervous system, but are unable to give rise to cells of the mesodermal or endodermal lineages.

[0139] In certain instances, according to methods disclosed herein, before being exposed to at least one beta cell maturation factor, stem cells can be undifferentiated (e.g., cells are not committed to a specific lineage), while in other instances, it may be desirable to differentiate stem cells into one or more intermediate cell types before being exposed to at least one cell maturation factor described herein. For example, stem cells can display the morphology, biology, or physical properties of undifferentiated cells, which can be used to distinguish them from differentiated cells of embryonic or adult origin. In some instances, undifferentiated cells can appear in a two-dimensional microscopic view of a cell colony with a high nuclear / cytoplasmic ratio and prominent nucleoli. Stem cells can be stem cells themselves (e.g., substantially devoid of any differentiated cells), or can be used in the presence of differentiated cells. In certain instances, stem cells can be cultured in the presence of suitable nutrients and optionally other cells so that the stem cells can grow and optionally differentiate. For example, embryonic fibroblasts or fibroblast-like cells can be present in the culture to help the growth of stem cells. Fibroblasts can exist during a stage of stem cell growth, but do not have to exist in all stages. For example, fibroblasts can be added to a stem cell culture in a first culture stage and not added to the stem cell culture in one or more subsequent culture stages.

[0140] The stem cells used in all aspects of the present disclosure can be any cell derived from any kind of tissue (e.g., embryonic tissue, such as fetal or pre-fetal tissue or adult tissue) that has the property of being able to produce offspring of different cell types (e.g., all three germ layers (endoderm, mesoderm, and ectoderm) or derivatives of at least one of them) under appropriate conditions. These cell types can be provided in the form of established cell lines or can be obtained directly from primary embryonic tissue and used directly for differentiation. Included are cells listed in the NIH Human Embryonic Stem Cell Registry, for example, hESBGN-01, hESBGN-02, hESBGN-03, hESBGN-04 (BresaGen, Inc.); HES-1, HES-2, HES-3, HES-4, HES-5, HES-6 (ES Cell International); Miz-hESI (MizMedi Hospital-Seoul National University); HSF-1, FISF-6 (University of California at San Francisco); and H1, H7, H9, H13, H14 (Wisconsin Alumni Research Foundation (WiCell Research Institute)). In some embodiments, the source of human stem cells or pluripotent stem cells for chemically induced differentiation into mature insulin-positive cells does not involve the destruction of human embryos.

[0141] In another embodiment, stem cells can be isolated from tissues including solid tissues. In some embodiments, the tissue is skin, fat tissue (e.g., adipose tissue), muscle tissue, heart or cardiac tissue. In other embodiments, the tissue is, for example, but not limited to, umbilical cord blood, placenta, bone marrow or cartilage.

[0142] Stem cells of interest also include various types of embryonic cells, for example, human embryonic stem cells (hES) described by Thomson et al., (1998) Science 282:1145; embryonic stem cells from other primates, such as rhesus monkey stem cells (Thomson et al., (1995) Proc. Natl. Acad. Sci. USA 92:7844); marmoset stem cells (Thomson et al., (1996) Biol. Reprod. 55:254); and human embryonic germ (hEG) cells (Shambloft et al., Proc. Natl. Acad. Sci. USA 95:13726, 1998). Also of interest are lineage-committed stem cells, such as mesodermal stem cells and other early cardiomyocytes (see Reyes et al. (2001) Blood 98:2615-2625; Eisenberg & Bader (1996) Circ Res. 78(2):205-16; etc.). Stem cells can be obtained from any mammalian species, for example, humans, equines, bovines, porcines, canines, felines, rodents (e.g., mice, rats, hamsters), primates, etc. In some embodiments, human embryos are not destroyed for the source of pluripotent cells used in the methods and compositions disclosed herein.

[0143] A cell mixture from a suitable source of endothelial, muscle and / or neural stem cells can be harvested from a mammalian donor by methods known in the art. A suitable source is a hematopoietic microenvironment. For example, circulating peripheral blood can be removed from a subject, preferably mobilized (i.e., raised). In embodiments, stem cells can be reprogrammed stem cells, such as stem cells derived from somatic cells or differentiated cells. In such embodiments, dedifferentiated stem cells can be, for example, but not limited to, neoplastic cells, tumor cells and cancer cells, or alternatively, induced reprogrammed cells, such as induced pluripotent stem cells or iPS cells.

[0144] In some embodiments, the SC-β cells can be derived from one or more of the following: trichocytes, keratinocytes, gonadotrophs, corticotrophs, thyrotrophs, somatotropes, prolactin cells, chromaffin cells, parafollicular cells, glomeruli cells, melanocytes, nevus cells, Merkel cells, odontoblasts, cementoblasts, corneal keratinocytes, retinal Muller cells, retinal pigment epithelial cells, neurons, glia (e.g., oligodendrocytes, astrocytes), ependymal cells, pinealocytes, pneumocytes (e.g., type I pneumocytes and type II pneumocytes), Clara cells, goblet cells, G cells, β cells, ECL cells, gastric chief cells, parietal cells, foveolar cells, cell), K cell, β cell, I cell, goblet cell, Paneth cell, enterocyte, microfold cell, hepatocyte, hepatic stellate cell (e.g., Kupffer cell from mesoderm), gallbladder cell, alveolar cardiomyocyte, pancreatic stellate cell, pancreatic α cell, pancreatic β cell, pancreatic δ cell, pancreatic F cell (e.g., PP cell), pancreatic ε cell, thyroid (e.g., follicular cell), parathyroid (e.g., parathyroid chief cell), eosinophil, urothelial cell, osteoblast, osteocyte, chondroblast, chondrocyte, fibroblast, fibrocyte, myoblast, muscle cell, muscle satellite cell, tenocyte, cardiomyocyte, adipocyte, adipocyte, cajal interstitial cells, angioblasts, endothelial cells, mesangial cells (e.g., intraglomerular mesangial cells and extraglomerular mesangial cells), juxtaglomerular cells, macula densa cells, stromal cells, interstitial cells, telocytes, simple epithelial cells, podocytes, proximal tubule brush border cells, Sertoli cells, Leydig cells, granulosa cells, thrombus cells, germ cells, sperm, eggs, lymphocytes, myeloid cells, endothelial progenitor cells, endothelial stem cells, angioblasts, mesoangioblasts, pericytes, parietal cells, splenocytes (e.g., T lymphocytes, B lymphocytes, dendritic cells, microphages, leukocytes), trophoblast stem cells, or any combination thereof.

[0145] SC islets

[0146] In some embodiments, any of the genetically engineered cells disclosed herein are SC islet cells. In some embodiments, the SC islet cells are NKX6.1 + / ISL1 + In some embodiments, the SC islet cells are NKX6.1 - / ISL1 + In some embodiments, the SC islet cells are NKX6.1+ / ISL1 - In some embodiments, the SC islet cells express insulin. In some embodiments, the SC islet cells express glucagon. In some embodiments, the SC islet cells express somatostatin. In some embodiments, the SC islet cells are naturally type O blood type cells (i.e., the SC islet cells or their precursor cells are not genetically engineered to be type O blood type cell lines). In some embodiments, the SC islet cells are naturally type Rh - (Rhesus factor negative) cells. In some embodiments, the cells comprise a genetic disruption in the RHD gene. In some embodiments, the cells do not comprise a genetic disruption in the RHD gene. In some embodiments, the cells comprise a genetic disruption in the RHCE gene. In some embodiments, the cells do not comprise a genetic disruption in the RHCE gene.

[0147] In some embodiments, the present disclosure provides a composition comprising a genetically engineered SC islet cell population. In some embodiments, the composition comprises no less than 50%, 40%, 30%, or 20% NKX6.1 + / ISL1 + cells (e.g., as determined by flow cytometry). In some embodiments, no less than 30% of the cells in the composition are NKX6.1-positive, ISL1-positive cells, no less than 25% of the cells in the composition are NKX6.1-negative, ISL1-positive cells, less than 12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells, or between 9%-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells (e.g., as determined by flow cytometry). In some embodiments, no less than 40%, 35%, 30%, 26%, 25%, or 20% of the cells in the composition are NKX6.1-positive, ISL1-positive cells. - / ISL1 + cells (e.g., as determined by flow cytometry). In some embodiments, no less than 26% of the cells in the composition are NKX6.1 - / ISL1 + cells (e.g., as determined by flow cytometry). In some embodiments, 5%-25%, 5%-40%, 5%-35%, or 8%-20% of the cells in the composition are NKX6.1 - / ISL1 + cells (e.g., as determined by flow cytometry). In some embodiments, no more than 50%, 45%, 40%, 35%, 30%, or 25% of the cells in the composition are NKX6.1 + / ISL1 -cells (e.g., as determined by flow cytometry). In some embodiments, no more than 50% of the cells in the composition are NKX6.1 + / ISL1 - cells (e.g., as determined by flow cytometry).

[0148] In some embodiments, less than 12% of the cells in the population (e.g., about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less) are NKX6.1-negative, ISL1-negative cells. In some embodiments, less than 10%, less than 8%, less than 6%, less than 4%, or 1%-11%, 2%-10%, 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5% of the cells in the population are NKX6.1-negative, ISL1-negative cells. In some embodiments, 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5% of the cells in the population are NKX6.1 negative, ISL1 negative cells.

[0149] In some embodiments, at least 15% (e.g., about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60% or more) of the cells in the population are NKX6.1 negative, ISL1 positive cells. In some embodiments, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, or 15%-60%, 15%-45%, 15%-30%, 30%-60%, 30%-45%, 45%-60% of the cells in the population are NKX6.1 negative, ISL1 positive cells. In some embodiments, 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the cells in the population are NKX6.1 negative, ISL1 positive cells.

[0150] In some embodiments, at least 15% (e.g., 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60%) of the cells in the population are NKX6.1-negative, ISL1-positive cells, and less than 12% (e.g., 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5%) of the cells in the population are NKX6.1-negative, ISL1-negative cells.

[0151] In some embodiments, at least 60%, at least 65%, at least 70%, at least 73%, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85%-95%, or about 90%-95% of the cells in the population are ISL1 positive cells. In some embodiments, 50%-90%, 50%-85%, 50%-80%, 50%-75%, 50%-70%, 50%-60%, 60%-90%, 60%-85%, 60%-80%, 60%-75%, 60%-70%, 65%-90%, 65%-85%, 65%-80%, 65%-75%, 65%-70%, 70%-90%, 70%-85%, 70%-80%, 70%-75%, 75%-90%, 75%-85%, 75%-80%, 80%-90%, 80%-85%, or 85%-90% of the cells in the population are ISL1 positive. In some embodiments, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85%-95%, or about 90%-95% of the cells in the population are ISL1 positive cells. In some embodiments, about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% of the cells in the population are ISL1 positive cells.

[0152] In some embodiments, the in vitro differentiated cell populations described herein contain more NKX6.1-negative, ISL1-positive cells than NKX6.1-positive, ISL1-positive cells. In some embodiments, at least 40% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 40%-50%, about 45%-55%, or about 50%-55% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the population are NKX6.1-negative, ISL1-positive cells.

[0153] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60% or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50% or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more of the ISL1-positive cells are NKX6.1-negative.

[0154] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60% or more) of the cells in the composition are ISL1 positive and NKX6.1 positive. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50% or 50%-60% of the cells in the composition are ISL1 positive and NKX6.1 positive. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more of the cells in the composition are ISL1 positive and NKX6.1 positive.

[0155] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60% or more) of the cells in the composition are ISL1 positive and NKX6.1 negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50% or 50%-60% of the cells in the composition are ISL1 positive and NKX6.1 negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more of the cells in the composition are ISL1 positive and NKX6.1 negative.

[0156] In some embodiments, the in vitro differentiated cell populations described herein comprise up to 20% (e.g., up to 20%, up to 30%, up to 40%, or up to 50%) of NXK6.1-positive, ISL1-positive cells. In some embodiments, the in vitro differentiated cell populations described herein comprise about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% of NXK6.1-positive, ISL1-positive cells. In some embodiments, the in vitro differentiated cell populations described herein comprise about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% of NXK6.1-positive, ISL1-positive cells.

[0157] In some embodiments, NKX6.1-positive, ISL1-positive cells also express PDX1. In some embodiments, NKX6.1-positive, ISL1-positive cells also express insulin. NKX6.1-positive, ISL1-positive cells also express C-peptide. In some embodiments, NKX6.1-positive, ISL1-positive cells also express chromogranin A.

[0158] In some embodiments, the present disclosure provides a composition comprising more than one genetically engineered cell (e.g., a composition comprising one cell cluster or more than one cell cluster); wherein 30%-60%, 30%-55%, 30%-50%, 30%-45%, 30%-40%, 30%-35%, 35%-60%, 35%-55%, 35%-50%, 35%-45%, 35%-40%, 40%-60%, 40%-55%, 40%-50%, 40%-45%, 45%-60%, 45%-55%, 45%-50%, 50%-60% or 50%-55% of the cells are NKX6.1-positive, ISL1-positive cells; wherein 20%-50%, 20%-45%, 20%-40%, 20%-35%, 20%-30%, 20%-25%, 25%-50% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; , 25%-45%, 25%-40%, 25%-35%, 25%-30%, 30%-50%, 30%-45%, 30%-40%, 30%-35%, 35%-50%, 35%-35%, 35%-40%, 40%-50%, 40%-45% or 45%-50% of the cells are NKX6.1 negative, ISL1 positive cells; and wherein 1%-12%, 1%-1 0%, 1%-8%, 1%-6%, 1%-4%, 3%-5%, 1%-2%, 2%-12%, 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-12%, 4%-10%, 4%-8%, 4%-6%, 6%-12%, 6%-10%, 6%-8%, 8%-12%, 8%-10% or 10%-12% of the cells are NKX6.1 negative, ISL1 negative cells. In some embodiments, the present disclosure provides compositions comprising more than one genetically engineered cell (e.g., a composition comprising one or more than one cell cluster); wherein 35%-50% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; wherein 30%-45% of the cells in the composition are NKX6.1-negative, ISL1-positive cells; and wherein 2%-12% of the cells in the composition are NKX6.1-negative, ISL1-negative cells. In some embodiments, between 3%-25%, 3%-20%, 3%-15%, 3%-10%, 3%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20%, or 20%-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells.

[0159] In some embodiments, the present disclosure provides a composition comprising more than one genetically engineered cell (e.g., a composition comprising one or more than one cell cluster); wherein at least 30% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; wherein at least 25% of the cells in the composition are NKX6.1-negative, ISL1-positive cells; and wherein between 9%-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells. In some embodiments, the present disclosure provides a composition comprising more than one genetically engineered cell (e.g., a composition comprising one or more than one cell cluster); wherein 30%-60%, 30%-55%, 30%-50%, 30%-45%, 30%-40%, 30%-35%, 35%-60%, 35%-55%, 35%-50%, 35%-45%, 35%-3 5%-40%, 40%-60%, 40%-55%, 40%-50%, 40%-45%, 45%-60%, 45%-55%, 45%-50%, 50%-60% or 50%-55% of the cells are NKX6.1-positive, ISL1-positive cells; wherein 20%-50%, 20%-45%, 20%-40%, 20%-35%, 20%-30%, 20%-25%, 25%-50%, 25%-45%, 25%-40%, 25%-35%, 25%-30%, 30%-50%, 30%-45%, 30%-40%, 30%-35%, 35%-50%, 35%-35%, 35%-40%, 40%-50%, 40%-45%, or 45%-50% of cells are NKX6.1 negative and ISL1 positive cells; and wherein 9%-30%, 9%-25%, 9%-20%, 9%-15%, 9%-12%, 12%-30%, 12%-25%, 12%-20%, 12%-15%, 15%-30%, 15%-25%, 15%-20%, 20%-30%, 20%-25% or 25%-30% of the cells in the composition are NKX6.1 positive, ISL negative cells. In some embodiments, 1%-12%, 1%-10%, 1%-8%, 1%-6%, 1%-4%, 3%-5%, 1%-2%, 2%-12%, 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-12%, 4%-10%, 4%-8%, 4%-6%, 6%-12%, 6%-10%, 6%-8%, 8%-12%, 8%-10%, or 10%-12% of the cells in the composition are NKX6.1 negative, ISL1 negative cells.In some embodiments, the present disclosure provides a composition comprising more than one genetically engineered cell (e.g., a composition comprising one cell cluster or more than one cell cluster); wherein 35%-50% of the cells in the composition are NKX6.1-positive, ISL1-positive cells; wherein 30%-45% of the cells in the composition are NKX6.1-negative, ISL1-positive cells; and wherein 9%-25% of the cells in the composition are NKX6.1-positive, ISL1-negative cells.

[0160] In some embodiments, less than 12% (e.g., about 11%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less) of the cells in the composition are NKX6.1 negative, ISL1 negative cells. In some embodiments, less than 10%, less than 8%, less than 6%, less than 4%, 1%-11%, 2%-10%, 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5% of the cells in the composition are NKX6.1 negative, ISL1 negative cells. In some embodiments, 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5% of the cells in the population are NKX6.1 negative, ISL1 negative cells.

[0161] In some embodiments, at least 15% (e.g., about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60% or more) of the cells in the composition are NKX6.1 negative, ISL1 positive cells. In some embodiments, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, 15%-60%, 15%-45%, 15%-30%, 30%-60%, 30%-45%, 45%-60% of the cells in the composition are NKX6.1 negative, ISL1 positive cells. In some embodiments, 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60% of the cells in the composition are NKX6.1 negative, ISL1 positive cells.

[0162] In some embodiments, at least 15% (e.g., 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50%, or 50%-60%) of the cells in the composition are NKX6.1-negative, ISL1-positive cells, and less than 12% (e.g., 2%-12%, 4%-12%, 6%-12%, 8%-12%, 2%-8%, 4%-8%, 3%-6%, or 3%-5%) of the cells in the composition are NKX6.1-negative, ISL1-negative cells.

[0163] In some embodiments, at least 60%, at least 65%, at least 70%, at least 73%, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85%-95%, or about 90%-95% of the cells in the composition are ISL1-positive cells. In some embodiments, 50%-90%, 50%-85%, 50%-80%, 50%-75%, 50%-70%, 50%-60%, 60%-90%, 60%-85%, 60%-80%, 60%-75%, 60%-70%, 65%-90%, 65%-85%, 65%-80%, 65%-75%, 65%-70%, 70%-90%, 70%-85%, 70%-80%, 70%-75%, 75%-90%, 75%-85%, 75%-80%, 80%-90%, 80%-85%, or 85%-90% of the cells in the composition are ISL1 positive cells. In some embodiments, at least 74%, at least 75%, at least 80%, at least 85%, at least 90%, about 85%-95%, or about 90%-95% of the cells in the composition are ISL1 positive cells. In some embodiments, about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or about 99% of the cells in the composition are ISL1 positive cells.

[0164] In some embodiments, the composition comprises more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 40% of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 40%-50%, about 45%-55%, or about 50%-55% of the cells in the composition are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the composition are NKX6.1-negative, ISL1-positive cells.

[0165] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60% or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50% or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more of the ISL1-positive cells are NKX6.1-negative.

[0166] In some embodiments, the composition comprises at least 20% (e.g., at least 20%, 30%, 40%, 50%, or 60%) of NXK6.1-positive, ISL1-positive cells. In some embodiments, the composition comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, 40%-50%, 40%-60%, or 50-60% of NXK6.1-positive, ISL1-positive cells. In some embodiments, the composition comprises about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% of NXK6.1-positive, ISL1-positive cells.

[0167] In some embodiments, the composition comprises less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5% or less) of NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20%, or 20%-25% of NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, the composition comprises about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells.

[0168] In some embodiments, the composition comprises less than 10% SOX9 positive cells. In some embodiments, the composition comprises less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or 1% SOX9 positive cells. In some embodiments, the composition comprises 0.1%-10%, 0.1%-7%, 0.1%-3%, 0.1%-1%, 0.5%-10%, 0.5%-7%, 0.5%-3%, 0.5%-1%, 1%-10%, 1%-5%, 1%-3%, 3%-10%, 3%-5% or 5%-10% SOX9 positive cells.

[0169] In some embodiments, the composition comprises less than 5% Ki67 positive cells. In some embodiments, the composition comprises less than 5%, 4%, 3%, 2% or 1% Ki67 positive cells. In some embodiments, the composition comprises 0.01%-0.1%, 0.1%-5%, 0.1%-3%, 0.1%-1%, 0.5%-5%, 0.5%-3%, 0.5%-1%, 1%-5%, 1%-3% or 1%-2% Ki67 positive cells.

[0170] In some embodiments, at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% of the cells in the composition are CHGA-positive cells. In some embodiments, 80%-100%, 85%-100%, 90%-100%, 90%-99%, 90%-98%, 95%-99%, or 95%-99% of the cells in the composition are CHGA-positive cells.

[0171] In some embodiments, the percentage of cells expressing the markers provided herein is measured by flow cytometry. Those skilled in the art know representative methods of testing cells or cell collections for expression of specific gene markers (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67) by flow cytometry. In some embodiments, based on median fluorescence intensity (rMFI), it is considered that cells are positive for expression of specific genes (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67). As used herein, the term "rMFI" or relative median fluorescence intensity is the ratio between the fluorescence intensity measured using an antibody against a specific target (e.g., NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, SOX9, C-peptide, Ki67) and the intensity obtained from a control antibody (isotype control). In some embodiments, anti-(human) NKX6.1, ISL1, INS, GCG, somatostatin, chromogranin A, or SOX9 antibodies are used. Examples of suitable antibodies for flow cytometry are any of the antibodies disclosed in Table 1. An example of a suitable flow cytometer is the Accuri 6 flow cytometer. In some embodiments, if tested, target-expressing cells (e.g., cells expressing NKX6.1 and / or ISL1) exhibit a target relative median fluorescence intensity (rMFI) of at least 6, 6.5, 7, 8, 9, or 10 as measured by flow cytometry. In another embodiment, the rMFI is between 6.5 and 15, between 6.5 and 14, between 6.5 and 13, between 6.5 and 13, between 6.5 and 12, or between 6.5 and 10.

[0172] In some embodiments, the percentage of cells expressing a marker provided herein is measured by qRT-PCR. In some embodiments, the percentage of cells expressing a marker provided herein is measured by single cell RNA sequencing analysis. The skilled artisan is aware of methods for testing whether a cell or cell collection is positive for expression of a specific gene marker (e.g., NKX6.1, ISL1, INS, GCG, ARX, or somatotropin-releasing hormone) by single cell RNA sequencing analysis.

[0173] In some embodiments, the genetically engineered cell populations described herein comprise less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5% or less) of NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20% or 20%-25% of NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells.

[0174] Table 1

[0175]

[0176]

[0177] In some embodiments, the genetically engineered cell populations described herein comprise more NKX6.1-negative, ISL1-positive cells than NKX6.1-positive, ISL1-positive cells. In some embodiments, the population comprises more NKX6.1-positive, ISL1-positive cells than NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 30% or 40% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, at least 45%, at least 50%, about 25%-50%, 20%-50%, 20%-40%, 20%-55%, 25%-40%, 30%-45%, 30%-40%, about 40%-50%, about 45%-55%, or about 50%-55% of the cells in the population are NKX6.1-negative, ISL1-positive cells. In some embodiments, about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, or about 55% of the cells in the population are NKX6.1 negative, ISL1 positive cells.

[0178] In some embodiments, at least 20% (e.g., at least 20%, at least 30%, at least 40%, at least 50%, at least 50%, at least 60% or more) of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%-60%, 20%-50%, 20%-40%, 20%-30%, 30%-60%, 30%-50%, 30%-40%, 40%-60%, 40%-50% or 50%-60% of the ISL1-positive cells are NKX6.1-negative. In some embodiments, about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60% or more of the ISL1-positive cells are NKX6.1-negative.

[0179] In some embodiments, the genetically engineered cell populations described herein comprise at least 20% (e.g., at least 20%, 30%, 40%, 50%, or 60%) of NXK6.1-positive, ISL1-positive cells. In some embodiments, the genetically engineered cell populations described herein comprise about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, 40%-50%, 40%-60%, or 50-60% of NXK6.1-positive, ISL1-positive cells. In some embodiments, the genetically engineered cell populations described herein comprise about 20%-50%, 20%-40%, 20%-30%, 30%-50%, 30%-40%, or 40%-50% of NXK6.1-positive, ISL1-positive cells.

[0180] In some embodiments, the genetically engineered cell populations described herein comprise less than 25% (e.g., less than 25%, less than 20%, less than 15%, less than 10%, less than 5% or less) of NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%-25%, 2%-20%, 2%-15%, 2%-10%, 2%-5%, 5%-25%, 5%-20%, 5%-15%, 5%-10%, 10%-25%, 10%-20%, 10%-15%, 15%-25%, 15%-20% or 20%-25% of NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%-10%, 2%-8%, 2%-6%, 2%-4%, 4%-10%, 4%-8%, 4%-6%, 6%-10%, 6%-8%, or 8%-10% NKX6.1-positive, ISL1-negative cells. In some embodiments, the genetically engineered cell populations described herein comprise about 2%, 4%, 6%, 8%, or 10% NKX6.1-positive, ISL1-negative cells.

[0181] In some embodiments, the genetically engineered cell colonies described herein include somatotropin-releasing factor positive cells. In some embodiments, the genetically engineered cell colonies described herein include less than 5% (e.g., less than 5%, less than 3%, less than 2%, less than 1% or less than 0.5%) somatotropin-releasing factor positive cells. In some embodiments, the genetically engineered cell colonies described herein include at least 0.05% (e.g., at least 0.05%, 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.8%, 1%, 1.2%, 1.5%, 1.8%, 2%, 3%, 4% or 5%) somatotropin-releasing factor positive cells. In some embodiments, the genetically engineered cell populations described herein comprise 1%-5%, 2%-5%, 3%-5%, 0.1%-5%, 0.1%-3%, 0.1%-2%, 0.1%-1%, 0.5%-5%, 0.5%-3%, 0.5%-2%, 0.5%-1%, 0.5%-0.8%, 0.05%-1%, 0.05%-0.7%, or 0.05%-2% somatotropin-releasing hormone-positive cells.

[0182] In some embodiments, the present disclosure provides compositions comprising genetically engineered NKX6.1-positive, ISL1-positive cells that express MAFA at a lower level than NKX6.1-positive, ISL1-positive cells from the pancreas of healthy control adult subjects or from cadaveric pancreas. In some embodiments, pharmaceutical compositions comprise genetically engineered NKX6.1-positive, ISL1-positive cells that express MAFB at a higher level than NKX6.1-positive, ISL1-positive cells from the pancreas of healthy control adult subjects or from cadaveric pancreas. In some embodiments, pharmaceutical compositions comprise genetically engineered NKX6.1-positive, ISL1-positive cells that express SIX2, HOPX, IAPP, and / or UCN3 at a higher level than NKX6.1-positive, ISL1-positive cells from the pancreas of healthy control adult subjects or from cadaveric pancreas. In some embodiments, pharmaceutical compositions comprise genetically engineered NKX6.1-positive, ISL1-positive cells that do not express MAFA. In some embodiments, pharmaceutical compositions comprise genetically engineered NKX6.1-positive, ISL1-positive cells that express MAFB. In some embodiments, the pharmaceutical composition comprises cells that have been genetically modified (e.g., using gene editing technology such as CRISPR). In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express beta-2 microglobulin, CIITA, HLA-A, HLA-B, HLA-C, HLA-DP, HLA-DQ, and HLADR at lower levels compared to NKX6.1-positive, ISL1-positive cells from the pancreas of healthy control adult subjects or from cadaveric pancreas. In some embodiments, the pharmaceutical composition comprises genetically engineered NKX6.1-positive, ISL1-positive cells that express CD47, PDL1, HLA-G, CD46, CD55, CD59, and CTLA at increased levels compared to NKX6.1-positive, ISL1-positive cells from the pancreas of healthy control adult subjects or from cadaveric pancreas. In some embodiments, any of the cell markers disclosed herein (e.g., NKX6.1, PDX1, MAFA, MAFB, SIX2, HOPX, IAPP, and / or UCN3) are detected by flow cytometry.

[0183] In some embodiments, any cell disclosed herein has not been genetically modified to have reduced PDL1 expression. In some embodiments, any cell disclosed herein has not been genetically modified to have reduced MHC II class protein expression. In some embodiments, any cell disclosed herein has not been genetically modified to have reduced CIITA protein expression. In some embodiments, compared with cells of the same type that have not been genetically modified, any genetically modified cell disclosed herein does not have lower MHC II class protein expression. In some embodiments, compared with cells of the same type that have not been genetically modified, any genetically modified cell disclosed herein does not have lower CIITA protein expression. In some embodiments, any cell disclosed herein does not comprise any genetic alteration in HLA-DR, HLA-DP or HLA-DQ genes. In some embodiments, any cell disclosed herein does not comprise genetic alteration in CIITA gene.

[0184] In some embodiments, any genetically modified cell disclosed herein does not comprise reduced expression of an Rh protein antigen selected from the group consisting of: Rh C antigen, Rh E antigen, Kell K antigen (KEL), Duffy (FY) Fyα antigen, Duffy Fy3 antigen, Kidd (JK) Jkb antigen, MNS antigen U, and MNS antigen S, compared to a cell of the same type that has not been genetically modified. In some embodiments, any cell disclosed herein does not have a genetic alteration in the RHD and / or RHCE genes.

[0185] In some cases, cell colonies or cell clusters disclosed herein are unsorted, for example, cell colonies or cell clusters not yet separated by cell sorting process. In some embodiments, cell clusters disclosed herein can refer to cell clusters formed by the self-aggregation of cells cultivated in a given environment (for example, in 3D suspension culture). Cell sorting as described herein can refer to the process of separating a group of cells from multiple cells by depending on the difference of cell size, shape (morphology), surface protein expression, endogenous signal protein expression or any combination thereof. In some cases, cell sorting includes making cells undergo flow cytometry. Flow cytometry can be a biophysical technique based on laser or impedance. In flow cytometry, cells can be suspended in a fluid stream and made to pass through an electronic detection device. In a type of flow cytometry, i.e., based on one or more parameters (for example, emission wavelength after laser excitation) of cell optical properties, fluorescence activated cell sorting (FACS) (FACS) can be used to physically separate and thus purify cells of interest by flow cytometry. As described herein, unsorted cell clusters can be cell clusters formed by more than one cell not yet undergoing active cell sorting process such as flow cytometry. In some cases, the flow cytometry discussed herein can be based on one or more signal peptides (signal peptide) expressed in the cell.For example, a cell cluster can include cells expressing a signal peptide (for example, a fluorescent protein, such as green fluorescent protein (GFP) or tdTomato). In some cases, a signal peptide is expressed as an indicator of insulin expression in the cell. For example, a cell cluster can include cells carrying an exogenous nucleic acid sequence encoding GFP under the control of an insulin promoter. The insulin promoter can be an endogenous or exogenous promoter. In some cases, the expression of GFP in these cells can indicate the expression of insulin in the cell. Therefore, a GFP signal can be a marker of pancreatic beta cells. In some cases, cell sorting as described herein can include subjecting cells to a magnetic activation sorting process, wherein magnetic antibodies or other ligands are used to mark different types of cells, and the difference in magnetic properties can be used for cell sorting.

[0186] The percentage of cells expressing one or more specific markers described herein, such as PDX1, NKX6.1, insulin, NGN3, or CHGA, can be a percentage detected using a technique such as flow cytometry. In some cases, during a flow cytometry assay, the cells are separated by a digestive enzyme such as trypsin or TrypLE TMExpress, the cell colonies or cell clusters discussed herein are dispersed into single cell suspensions. The dispersed cells can be washed, centrifuged in a suitable buffer such as PBS, and then resuspended in a fixative buffer such as 4% PFA. The first antibody against the cell marker of interest can then be incubated, followed by incubation with a second antibody. After the antibody incubation, the cells can be washed and separated by flow cytometry. The cells described herein can also be characterized using techniques other than flow cytometry, for example, to determine the percentage of cells. Non-limiting examples of cell characterization methods include gene sequencing, microscopy (fluorescence microscopy, atomic force microscopy), karyotyping, isozyme analysis, DNA properties, and viral susceptibility.

[0187] In some embodiments, in any composition disclosed herein, at least a portion of the genetically engineered cells in a population of genetically engineered cells are present in more than one cell cluster. In some cases, the diameter of the cell clusters is from about 50 μm to about 500 μm, from about 50 μm to about 400 μm, from about 50 μm to about 300 μm, from about 60 μm to about 400 μm, from about 60 μm to about 300 μm, from about 60 μm to about 250 μm, from about 75 μm to about 400 μm, from about 75 μm to about 300 μm, from about 75 μm to about 250 μm, from about 125 μm to about 225 μm, from about 130 μm to about 160 μm, from about 170 μm to about 225 μm, from about 140 μm to about 200 μm, from about 140 μm to about 170 μm, from about 160 μm to about 220 μm, from about 170 μm to about 215 μm, or from about 170 μm to about 200 μm. In some cases, in the pharmaceutical compositions disclosed herein, the cell population is present as a single cell suspension. In some embodiments, in the pharmaceutical compositions disclosed herein, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 98%, or at least 99% of the cells are present as cell clusters. In some embodiments, in the pharmaceutical compositions disclosed herein, substantially all of the cells are present as cell clusters, for example, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, at least 99.9%, at least 99.9%, at least 99.999%, at least 99.999%, or at least 99.9999% of the cells.

[0188] In some embodiments, the diameter of cell cluster is between about 80 microns and 270 microns. In some embodiments, the diameter of cell cluster is between about 100 microns and about 250 microns (for example, a diameter of about 125 microns, about 140 microns, about 150 microns, about 160 microns, about 170 microns, about 180 microns, about 190 microns, about 200 microns, about 200 microns, about 210 microns, about 215 microns, about 220 microns or about 225 microns). For example, in some embodiments, the diameter of cell cluster is between about 125 microns and about 225 microns, between about 130 microns and about 160 microns, between about 170 microns and about 225 microns, between about 140 microns and about 200 microns, between about 140 microns and about 170 microns, between about 160 microns and about 220 microns, between about 170 microns and about 215 microns or between about 170 microns and about 200 microns.

[0189] In some embodiments, the present disclosure provides a composition comprising one or more cell clusters. In some embodiments, the composition comprises 500-20,000, 500-15,000, 500-10,000, 500-5,000, 500-2,000, 500-1,000, 1,000-20,000, 1,000-15,000, 1,000-10,000, 1,000-5,000, 1,000-2,000, 2,000-20,000, 2,000-15,000, 2,000-10,000, 2,000-5,000, 5,000-20,000, 5,000-15,000, 5,000-10,000, 10,000-20,000, 10,000-15,000, 15,000-20,000, or 3,000-9,000 cell clusters.

[0190] Methods for producing pancreatic islet cells

[0191] In certain aspects, the present disclosure relates to compositions and methods for generating endocrine cells from genetically engineered pancreatic progenitor cells or genetically engineered precursors. Certain exemplary detailed protocols for generating endocrine cells to provide at least one SC-β cell are described in U.S. Patent Application Publication Nos. US20150240212, US20150218522, US20210238553, and US2022-0090020, each of which is incorporated herein by reference in its entirety.

[0192] In some embodiments, the methods of generating an endocrine cell population result in an increase in the percentage of pancreatic α and / or δ cells and a decrease in the percentage of pancreatic EC cells when generating pancreatic β cells. In some embodiments, the methods described herein can be used to obtain an enriched α cell population. In some embodiments, the methods described herein can be used to obtain an enriched population of β cells. In some embodiments, the methods described herein can be used to obtain an enriched population of α cells and β cells. In some embodiments, the methods described herein can be used to obtain an increased yield of pancreatic endocrine cells.

[0193] Successful differentiation into pancreatic beta cells requires that the differentiated cells synthesize and secrete physiologically appropriate amounts of insulin. Differentiation of hPSCs into hormone-producing pancreatic endocrine cells is achieved by transitioning hPSCs through the major stages of embryonic development: differentiation into mesoderm and definitive endoderm, establishment of primitive intestinal endoderm, patterning of the posterior foregut, and specification and maturation of pancreatic endoderm and endocrine precursors. Through these stages, hPSCs can acquire a pancreatic endocrine phenotype and the ability to secrete insulin in response to glucose in vitro.

[0194] Typically, at least one pancreatic α, β and / or δ cell or a precursor thereof, e.g., pancreatic progenitor cells produced according to the methods disclosed herein can comprise a mixture or combination of different cells, e.g., cells such as PDX1-positive pancreatic progenitor cells, pancreatic progenitor cells co-expressing PDX1 and NKX6.1, Ngn3-positive endocrine progenitor cells, insulin-positive endocrine cells (e.g., NKX6.1-positive, ISL1-positive cells or β-like cells) and / or a mixture of other multipotent cells or stem cells.

[0195] At least one pancreatic α, β, and / or δ cell, or a precursor thereof, can be produced according to any suitable culture protocol to differentiate a stem cell or pluripotent cell to a desired differentiation stage. In some embodiments, at least one pancreatic α, β, and / or δ cell, or a precursor thereof, is produced by culturing at least one pluripotent cell for a period of time and under conditions suitable for differentiating at least one pluripotent cell into at least one pancreatic α, β, and / or δ cell, or a precursor thereof.

[0196] In some embodiments, at least one pancreatic α, β and / or δ cell or its precursor is a substantially pure population of pancreatic α, β and / or δ cells or its precursors. In some embodiments, the population of pancreatic α, β and / or δ cells or its precursors comprises a mixture of pluripotent cells or differentiated cells. In some embodiments, the population of pancreatic α, β and / or δ cells or its precursors is substantially free of or lacks embryonic stem cells or pluripotent cells or iPS cells. In some embodiments, the methods described herein produce a cell population comprising pancreatic α, β and / or δ cells at a ratio similar to that of natural islets.

[0197] In some embodiments, the methods described herein include (i) culturing a first cell population comprising pancreatic progenitor cells (e.g., PDX1-positive, NKX6.1-negative cells; or a mixture of PDX1-positive, NKX6.1-negative cells and PDX1-positive, NKX6.1-positive cells) in a first culture medium comprising a Forkhead Box O1 (FoxO1) inhibitor and a notch signaling pathway inhibitor for a period of time to obtain a second cell population (e.g., a cell population comprising more PDX1-positive, NKX6.1-positive cells than the first cell population); and (ii) culturing the second cell population in a second culture medium comprising a PKC activator and a Wnt signaling pathway inhibitor. In some embodiments, the method generates a cell population comprising PDX1-positive, NKX6.1-positive, and insulin-positive cells.

[0198] In some embodiments, the methods described herein include culturing a first cell population in a first culture medium, wherein the first cell population comprises pancreatic progenitor cells that are PDX1-positive and NKX6.1-negative, and pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive; and the first culture medium comprises a Forkhead Box O1 (FoxO1) inhibitor (e.g., AS1842856 or a derivative thereof). In some embodiments, the first culture medium further comprises a notch signaling pathway inhibitor. In some embodiments, the notch signaling pathway inhibitor is a γ-secretase inhibitor (e.g., XXI, DAPT, or a derivative thereof). In some embodiments, the γ-secretase inhibitor is XXI. In some embodiments, the first culture medium does not comprise a Wnt signaling pathway inhibitor.

[0199] In some embodiments, the first cell population comprises pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive. In some embodiments, the first cell population comprises more pancreatic progenitor cells that are PDX1-positive and NKX6.1-negative than pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive. In some embodiments, the first cell population comprises more pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive than pancreatic progenitor cells that are PDX1-positive and NKX6.1-negative.

[0200] In some embodiments, the first culture medium further comprises a PKC activator (e.g., PdBU, TPB, phorbol 12-myristate 13-acetate, bryostatin 1, or a derivative thereof). In some embodiments, the PKC activator is PdBU. In some embodiments, the first culture medium further comprises one or more (e.g., 1, 2, 3, 4, 5) agents selected from the group consisting of: fibroblast growth factor (e.g., KGF), sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, Rho-associated coiled-coil protein kinase (ROCK) inhibitor (e.g., thiazovivin), and TGF-β ligand (e.g., activin A). In some embodiments, the first culture medium further comprises a water-soluble synthetic polymer (e.g., PVA such as PVA 80%). In some embodiments, the first culture medium comprises a FoxO1 inhibitor (e.g., AS1842856 or a derivative thereof), a notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor such as XXI), a PKC activator (e.g., PdBU), a fibroblast growth factor (e.g., KGF), a sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), and a TGF-β ligand (e.g., activin A) and a water-soluble synthetic polymer (e.g., PVA such as PVA 80%).

[0201] In some embodiments, the first cell population is cultured in the first culture medium for about 12-72 hours (e.g., about 12-72 hours, 12-66 hours, 12-60 hours, 12-54 hours, 12-48 hours, 12-42 hours, 12-36 hours, 12-30 hours, 12-24 hours, 12-18 hours, 18-72 hours, 18-66 hours, 18-60 hours, 18-54 hours, 18-48 hours, 18-42 hours, 18-36 hours, 18-30 hours, 18-24 hours, 24-72 hours, 24-66 hours, 24-60 hours, 24-54 hours, 24-48 hours, 24-42 hours, 24-3 6 hours, 42-54 hours, 42-48 hours, 48-72 hours, 48-66 hours, 48-60 hours, 48-54 hours, 54-72 hours, 54-66 hours, 54-60 hours, 60-72 hours, 60-66 hours or 66-72 hours). In some embodiments, the first population of cells is cultured in the first culture medium for about 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, In some embodiments, the first cell population is cultured in the first culture medium for a period of time of about 24 hours. In some embodiments, the first cell population is cultured in the first culture medium for a period of time of about 48 hours.

[0202] In some embodiments, the first cell colony is cultured in the first culture medium for a contact period (e.g., 24 hours or 48 hours) described herein to produce a second cell colony. In some embodiments, the second cell colony comprises pancreatic progenitor cells that are positive for PDX1 and positive for NKX6.1 and pancreatic progenitor cells that are positive for PDX1 and negative for NKX6.1. In some embodiments, the pancreatic progenitor cells that are positive for PDX1 and positive for NKX6.1 are more than the first cell colony. In some embodiments, the pancreatic progenitor cells that are positive for PDX1 and positive for NKX6.1 are more than the pancreatic progenitor cells that are positive for PDX1 and negative for NKX6.1. In some embodiments, the second cell colony comprises a trace amount (e.g., less than 5%, less than 4%, less than 3%, less than 2%, less than 1% of the second cell colony) of PDX1 positive and negative for NKX6.1.

[0203] In some embodiments, the methods described herein further comprise culturing the second cell population with a second culture medium comprising a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor such as NVP-TNKS656). In some embodiments, the second culture medium comprises a PKC activator (e.g., PdBu). In some embodiments, the second culture medium further comprises one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) agents selected from the group consisting of epidermal growth factor (e.g., betacellulin), thyroid hormone (e.g., GC-1), TGFβ-R1 kinase inhibitor (e.g., ALK5i), notch signaling pathway inhibitors (e.g., γ-secretase inhibitors such as XXI), sonic hedgehog (SHH) signaling pathway inhibitors (e.g., SANT-1), retinoic acid, Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitors (e.g., thiazovivin), protein kinase inhibitors (e.g., staurosporine), bone morphogenesis (BMP) signaling pathway inhibitors (e.g., LDN193189), and histone methyltransferase EZH2 inhibitors (e.g., DZNep). In some embodiments, the second culture medium further comprises one or more (e.g., 1, 2, 3, 4) agents selected from acetyl-CoA related metabolites (e.g., acetate), HDAC inhibitors (e.g., β-hydroxybutyrate), redox homeostasis regulators (e.g., taurine), and single-carbon metabolic pathway intermediates (e.g., formate). In some embodiments, the second culture medium further comprises vitamins (e.g., biotin). In some embodiments, the second culture medium further comprises glutamine. In some embodiments, the second culture medium further comprises a water-soluble synthetic polymer (e.g., PVA, such as PVA 87%-89%). In some embodiments, the second culture medium does not comprise a FOXO1 inhibitor.In some embodiments, the second culture medium comprises a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor such as NVP-TNKS656), a PKC activator (e.g., PdBu), an epidermal growth factor (e.g., betacellulin), a thyroid hormone (e.g., GC-1), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor such as XXI), a sonic hedgehog (SHH) signaling pathway inhibitor (e.g., SANT-1), retinoic acid, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thia zovivin), protein kinase inhibitors (e.g., staurosporine), bone morphogenesis (BMP) signaling pathway inhibitors (e.g., LDN193189), histone methyltransferase EZH2 inhibitors (e.g., DZNep), acetyl-CoA related metabolites (e.g., acetate), HDAC inhibitors (e.g., β-hydroxybutyrate), redox homeostasis regulators (e.g., taurine), one-carbon metabolic pathway intermediates (e.g., formate), vitamins (e.g., biotin), glutamine, and water-soluble synthetic polymers (e.g., PVA such as PVA87%-89%), and does not contain FOXO1 inhibitors.

[0204] In some embodiments, the second population of cells is cultured in the second culture medium for about 12-72 hours (e.g., about 12-72 hours, 12-66 hours, 12-60 hours, 12-54 hours, 12-48 hours, 12-42 hours, 12-36 hours, 12-30 hours, 12-24 hours, 12-18 hours, 18-72 hours, 18-66 hours, 18-60 hours, 18-54 hours, 18-48 hours, 18-42 hours, 18-36 hours, 18-30 hours, 18-24 hours, 24-72 hours, 24-66 hours, 24-60 hours, 24-54 hours, 24-48 hours, 24-42 hours, 24-3 6 hours, 42-54 hours, 42-48 hours, 48-72 hours, 48-66 hours, 48-60 hours, 48-54 hours, 54-72 hours, 54-66 hours, 54-60 hours, 60-72 hours, 60-66 hours or 66-72 hours). In some embodiments, the second population of cells is cultured in the second culture medium for about 12 hours, 13 hours, 14 hours, 15 hours, 16 hours, 17 hours, 18 hours, 19 hours, 20 hours, 21 hours, 22 hours, 23 hours, 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, In some embodiments, the second cell population is cultured in the second culture medium for a period of about 48 hours.

[0205] In some embodiments, the second cell population is cultured in the second culture medium for a contact period of time (e.g., 48 hours) described herein to produce a third cell population. In some embodiments, the third cell population comprises pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive. In some embodiments, the third cell population comprises ISL1-positive cells. In some embodiments, the third cell population comprises ISL1-negative cells. In some embodiments, the third cell population comprises ISL1-positive cells. In some embodiments, the third cell population comprises more ISL1-positive cells than the first and second cell populations. In some embodiments, the third cell population comprises more ISL1-negative cells than ISL1-positive cells. In some embodiments, the third cell population comprises insulin-negative cells. In some embodiments, the third cell population comprises insulin-positive cells. In some embodiments, the third cell population comprises more insulin-negative cells than insulin-positive cells. In some embodiments, the third cell population comprises more insulin-positive cells than the first and second cell populations.

[0206] In some embodiments, the method further comprises culturing a third cell population in a third culture medium comprising one or more agents selected from the group consisting of a notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor such as XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the third culture medium further comprises one or more agents selected from the group consisting of acetyl-CoA-related metabolites (e.g., acetate), HDAC inhibitors (e.g., β-hydroxybutyrate), redox homeostasis regulators (e.g., taurine), and one-carbon metabolic pathway intermediates (e.g., formate). In some embodiments, the third culture medium further comprises vitamins (e.g., biotin). In some embodiments, the third culture medium further comprises glutamine. In some embodiments, the third culture medium further comprises a water-soluble synthetic polymer (eg, PVA, such as PVA 87%-89%).

[0207] In some embodiments, the third culture medium does not contain a Wnt signaling pathway inhibitor or a PKC activator. In some embodiments, the third culture medium contains a notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor such as XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), acetyl-CoA-related metabolites (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, and a water-soluble synthetic polymer (e.g., PVA, such as PVA87%-89%), and does not contain a Wnt signaling pathway inhibitor and a PKC activator. In some embodiments, the third population of cells is cultured in a third culture medium (e.g., a third culture medium that does not comprise a Wnt signaling pathway inhibitor or a PKC activator) for a period of about 24-96 hours (e.g., about 24-96 hours, 24-84 hours, 24-72 hours, 24-60 hours, 24-48 hours, 24-36 hours, 36-96 hours, 36-84 hours, 36-72 hours, 36-60 hours, 36-48 hours, 48-96 hours, 48-84 hours, 48-72 hours, 48-60 hours, 60-96 hours, 60-84 hours, 60-72 hours, 72-96 hours, 72-84 hours, or 84-96 hours).In some embodiments, the third population of cells is cultured in the third culture medium for about 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours, 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 ​​hours, 49 hours, 50 hours, 51 hours, 52 hours, 53 hours, 54 hours, 55 hours, 56 hours, 57 hours, 58 hours. In some embodiments, the third cell population is cultured in the third culture medium for a period of about 96 hours.

[0208] In some embodiments, the third culture medium further comprises a Wnt signaling pathway inhibitor but does not comprise a PKC activator. In some embodiments, the third culture medium comprises a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor such as NVP-TNKS656), a notch signaling pathway inhibitor (e.g., a γ-secretase inhibitor such as XXI), a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), acetyl-CoA-related metabolites (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, and a water-soluble synthetic polymer (e.g., PVA, such as PVA 87%-89%), and does not comprise a PKC activator. In some embodiments, the third cell population is cultured in a third culture medium (e.g., a third culture medium comprising a Wnt signaling pathway inhibitor but not comprising a PKC activator) for a period of about 24-48 hours (e.g., about 24-48 hours, 24-36 hours, or 36-48 hours), after which the Wnt signaling pathway inhibitor is removed from the third culture medium, and the cells are further cultured for about 24-48 hours (e.g., about 24-48 hours, 24-36 hours, or 36-48 hours). In some embodiments, the third cell population is cultured in a third culture medium (e.g., a third culture medium comprising a Wnt signaling pathway inhibitor but not comprising a PKC activator) for a period of about 48 hours, after which the Wnt signaling pathway inhibitor is removed from the third culture medium, and the cells are further cultured for about 48 hours.

[0209] In some embodiments, the third cell colony is cultured in the third culture medium for a contact period (e.g., 96 hours) described herein to produce a fourth cell colony. In some embodiments, the fourth cell colony comprises PDX1-positive and NKX6.1-positive cells. In some embodiments, the fourth cell colony comprises insulin-positive cells. In some embodiments, the fourth cell colony comprises PDX1-positive, NKX6.1-positive and insulin-positive cells. In some embodiments, the fourth cell colony comprises ISL1-positive cells. In some embodiments, the fourth cell colony comprises ISL-1-negative cells. In some embodiments, at least 30% (e.g., at least 30%, at least 40%, at least 50% or at least 60%) of the fourth cell colony is insulin-positive. In some embodiments, 30%-50%, 30%-40% or 40%-50% of the fourth cell colony is insulin-positive.

[0210] In some embodiments, the method further comprises culturing a fourth cell population in a fourth culture medium comprising one or more agents selected from the group consisting of a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep). In some embodiments, the fourth culture medium further comprises one or more agents selected from the group consisting of acetyl-CoA-related metabolites (e.g., acetate), HDAC inhibitors (e.g., β-hydroxybutyrate), redox homeostasis regulators (e.g., taurine), and one-carbon metabolic pathway intermediates (e.g., formate). In some embodiments, the fourth culture medium further comprises a vitamin (e.g., biotin). In some embodiments, the fourth culture medium further comprises one or more of glutamine (e.g., L-glutamine), glutamate (e.g., L-glutamate), and carnitine (e.g., L-carnitine). In some embodiments, the fourth culture medium further comprises albumin (e.g., human serum albumin or HSA). In some embodiments, the fourth culture medium further comprises ZnSO 4 . In some embodiments, the fourth culture medium does not comprise a Wnt signaling pathway inhibitor or a PKC activator. In some embodiments, the fourth culture medium comprises a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenetic (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep), acetyl-CoA-related metabolites (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, glutamate, carnitine, albumin (e.g., human serum albumin or HSA), and ZnSO4, and does not comprise a Wnt signaling pathway inhibitor or a PKC activator.

[0211] In some embodiments, the fourth population of cells is cultured in the fourth culture medium for a period of about 24-96 hours (e.g., about 24-96 hours, 24-84 hours, 24-72 hours, 24-60 hours, 24-48 hours, 24-36 hours, 36-96 hours, 36-84 hours, 36-72 hours, 36-60 hours, 36-48 hours, 48-96 hours, 48-84 hours, 48-72 hours, 48-60 hours, 60-96 hours, 60-84 hours, 60-72 hours, 72-96 hours, 72-84 hours, or 84-96 hours). In some embodiments, the fourth population of cells is cultured in the fourth culture medium for about 24 hours, 25 hours, 26 hours, 27 hours, 28 hours, 29 hours, 30 hours, 31 hours, 32 hours, 33 hours, 34 hours, 35 hours, 36 hours, 37 hours, 38 hours, 39 hours, 40 hours, 41 hours, 42 hours, 43 hours, 44 hours, 45 hours, 46 hours, 47 hours, 48 ​​hours, 49 hours, 50 hours, 51 hours, 52 hours, 53 hours, 54 hours, 55 hours, 56 hours, 57 hours, 58 hours. In some embodiments, the fourth cell population is cultured in the fourth culture medium for a period of about 72 hours.

[0212] In some embodiments, the fourth cell population is cultured in a fourth culture medium for a contact period (e.g., 96 hours) described herein to produce a fifth cell population. In some embodiments, the methods described herein further include culturing a fifth cell population in a fifth culture medium comprising glutamine, albumin (e.g., human serum albumin or HSA) and ZnSO4. In some embodiments, the fifth culture medium comprises glutamine, albumin (e.g., human serum albumin or HSA) and ZnSO4, and does not comprise any one of the following agents: TGFβ-R1 kinase inhibitors (e.g., ALK5i), thyroid hormone (e.g., GC-1), bone morphogenesis (BMP) signaling pathway inhibitors (e.g., LDN193189), Rho-associated coiled-coil protein kinase (ROCK) inhibitors (e.g., thiazovivin), protein kinase inhibitors (e.g., staurosporine) and histone methyltransferase EZH2 inhibitors (e.g., DZNep). In some embodiments, the fifth culture medium further comprises a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamine, glutamate, and carnitine. In some embodiments, the fifth culture medium comprises a histone methyltransferase EZH2 inhibitor (e.g., DZNep), an acetyl-CoA-related metabolite (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolism pathway intermediate (e.g., formate), a vitamin (e.g., biotin), glutamate, glutamine, carnitine, albumin (e.g., human serum albumin or HSA), and ZnSO4, and does not comprise any one agent selected from the group consisting of a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), and a histone methyltransferase EZH2 inhibitor (e.g., DZNep).In some embodiments, the fifth culture medium comprises albumin (e.g., human serum albumin or HSA) and ZnSO4, and does not comprise any one agent selected from the group consisting of a TGFβ-R1 kinase inhibitor (e.g., ALK5i), a thyroid hormone (e.g., GC-1), a bone morphogenesis (BMP) signaling pathway inhibitor (e.g., LDN193189), a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor (e.g., thiazovivin), a protein kinase inhibitor (e.g., staurosporine), a histone methyltransferase EZH2 inhibitor (e.g., DZNep), acetyl-CoA-related metabolites (e.g., acetate), an HDAC inhibitor (e.g., β-hydroxybutyrate), a redox homeostasis regulator (e.g., taurine), a one-carbon metabolic pathway intermediate (e.g., formate), a vitamin (e.g., biotin), carnitine, glutamate, and glutamine.

[0213] In some embodiments, the fifth population of cells is cultured in the fifth culture medium for a period of about 96-240 hours (e.g., about 96-240 hours, 96-216 hours, 96-192 hours, 96-168 hours, 96-144 hours, 96-120 hours, 120-240 hours, 120-216 hours, 120-192 hours, 120-168 hours, 120-144 hours, 144-240 hours, 144-216 hours, 144-192 hours, 144-168 hours, 168-240 hours, 168-216 hours, 168-192 hours, 192-240 hours, 192-216 hours, or 192-240 hours). In some embodiments, the fifth cell population is cultured in the fifth culture medium for a period of about 24 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours, 144 hours, 168 hours, 192 hours, 216 hours, or 240 hours. In some embodiments, the fifth cell population is cultured in the fifth culture medium for a period of about 192 hours.

[0214] In some embodiments, culturing the fifth cell population in the fifth culture medium for a contact period described herein (e.g., 192 hours) produces a sixth cell population. In some embodiments, at least 15% (e.g., at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, or more) of the sixth cell population is NKX6.1 negative and ISL positive; and wherein less than 12% (e.g., less than 12%, less than 10%, less than 8%, less than 6%, less than 4%, less than 2% or less) of the sixth cell population is NKX6.1 negative and ISL negative.

[0215] In some embodiments, the methods described herein include:

[0216] (i) culturing a first cell population in a first culture medium to obtain a second cell population, wherein the first cell population comprises pancreatic progenitor cells that are PDX1-positive and NKX6.1-negative and pancreatic progenitor cells that are PDX1-positive and NKX6.1-positive; and the first culture medium comprises: a FoxO1 inhibitor, a notch signaling pathway inhibitor, a PKC activator, a fibroblast growth factor, a sonic hedgehog (SHH) signaling pathway inhibitor, retinoic acid, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor, a TGF-β ligand, and a water-soluble synthetic polymer;

[0217] (ii) culturing the second cell population obtained in (i) with a second culture medium to obtain a third cell population, wherein the second culture medium comprises: a Wnt signaling pathway inhibitor, a PKC activator, epidermal growth factor, a thyroid hormone, a TGFβ-R1 kinase inhibitor, a notch signaling pathway inhibitor, a sonic hedgehog (SHH) signaling pathway inhibitor, retinoic acid, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor, a bone morphogenesis (BMP) signaling pathway inhibitor, a histone methyltransferase EZH2 inhibitor, an acetyl-CoA-related metabolite, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, vitamins, glutamine, and a water-soluble synthetic polymer (e.g., PVA), and wherein the second culture medium does not comprise a FOXO1 inhibitor;

[0218] (iii) culturing the third cell population obtained in (ii) with a third culture medium to obtain a fourth cell population, wherein the third culture medium comprises: a notch signaling pathway inhibitor, a TGFβ-R1 kinase inhibitor, a thyroid hormone, a bone morphogenesis (BMP) signaling pathway inhibitor, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor and a histone methyltransferase EZH2 inhibitor, acetyl-CoA related metabolites, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolic pathway intermediate, vitamins, glutamine, and a water-soluble synthetic polymer, and wherein the third culture medium does not comprise a Wnt signaling pathway inhibitor and a PKC activator;

[0219] (iv) culturing the fourth cell population obtained in (iii) with a fourth culture medium to obtain a fifth cell population, wherein the fourth culture medium comprises a notch signaling pathway inhibitor, a TGFβ-R1 kinase inhibitor, a thyroid hormone, a bone morphogenesis (BMP) signaling pathway inhibitor, a Rho-associated coiled-coil-containing protein kinase (ROCK) inhibitor, a protein kinase inhibitor, a histone methyltransferase EZH2 inhibitor, acetyl-CoA-related metabolites, an HDAC inhibitor, a redox homeostasis regulator, a one-carbon metabolism pathway intermediate, vitamins, glutamine, glutamate, carnitine, albumin, and ZnSO 4 , and wherein the fourth culture medium does not comprise a Wnt signaling pathway inhibitor and a PKC activator; and

[0220] (v) culturing the fifth cell population obtained in (iv) with a fifth culture medium to obtain a sixth cell population, wherein the fifth culture medium comprises albumin (eg, human serum albumin or HSA) and ZnSO 4 .

[0221] In some embodiments, the methods described herein also include generating a first cell colony comprising pancreatic progenitor cells that are PDX1 positive and NKX6.1 negative and pancreatic progenitor cells that are PDX1 positive and NKX6.1 positive. In some embodiments, the first cell colony is differentiated from stem cells (e.g., embryonic stem cells or pluripotent stem cells). In some embodiments, stem cells (e.g., embryonic stem cells) are generated from the inner cell mass represented by blastocyst stage embryos. Stem cells can be maintained in culture, self-renewed, and proliferate indefinitely as undifferentiated ES cells, and can differentiate into all cell types of the body, such as ectoderm, mesoderm, and endoderm lineage cells or tissues.

[0222] Cell types during pancreatic differentiation

[0223] Aspects of the present disclosure provide cell types of the pancreatic lineage obtained during stem cell differentiation to generate islet cells. Such cells include any cells that can differentiate into islet cells when cultured under conditions suitable for differentiating precursor cells into islet cells, including, for example, pluripotent stem cells, definitive endoderm cells, primitive intestinal tube cells, pancreatic progenitor cells, or endocrine progenitor cells.

[0224] stem cells

[0225] In some embodiments, any stem cell disclosed herein (eg, any genetically engineered stem cell) can be used to generate genetically engineered SC islet cells or precursors thereof.

[0226] Definitive endoderm cells

[0227] Can generate definitive endoderm from inner cell mass by the gastrulation process of embryogenesis, wherein epiblast cells are instructed to form three germ layers.Definitive endoderm can produce different cells and tissues, and these cells and tissues contribute to the epithelial lining of vital organs such as pancreatic beta cells, hepatocytes, alveolar cells, thyroid, thymus and digestive tract and respiratory tract.It is different from the primitive endoderm of extraembryonic tissue, and the latter can form visceral endoderm and luminal endoderm.Definitive endoderm derived from ES cell can theoretically become any endoderm derivative.

[0228] The precise patterning of the definitive endoderm along its anterior-posterior axis ultimately allows the formation of the primitive gut. The primitive gut, derived from the definitive endoderm, gives rise to the pharynx, esophagus, stomach, duodenum, small intestine, and large intestine, along its anterior-posterior axis, along with associated organs including the pancreas, lungs, thyroid gland, thymus, parathyroid glands, and liver. The anterior portion of the primitive gut, the foregut, becomes the lungs, thyroid gland, esophagus, and stomach. The pancreas, liver, and duodenum originate from the posterior portion of the foregut. The midgut and hindgut of the primitive gut give rise to the small and large intestines. The anterior foregut expresses the developmental markers NK2 homeobox 1 (NKX2-1) and SRY (sex determining region Y)-box 2 (SOX2); the posterior foregut expresses hematopoietic-expressed homeobox (HHEX), pancreatic and duodenal homeobox 1 (PDX1), one cleaved homeobox 1 (ONECUT1, also known as HNF6), and hepatocyte nuclear factor 4 alpha (HNF4A); and the midgut / hindgut express caudal-type homeobox 1 (CDX1), caudal-type homeobox 2 (CDX2), and motor neuron and pancreatic homeobox 1 (MNX1) (3, 19, 20).

[0229] In some embodiments, the endodermal cells of the present invention are differentiated into SC-β cells (stage 6) or SC-β cells (stage 7) or SC-β cells (stage 8) or SC-β cells (stage 9) or SC-β cells (stage 10) or SC-β cells (stage 11) or SC-β cells (stage 12) or SC-β cells (stage 13) or SC-β cells (stage 14) or SC-β cells (stage 15) or SC-β cells (stage 16) or SC-β cells (stage 17) or SC-β cells (stage 18) or SC-β cells (stage 19) or SC-β cells (stage 10) or SC-β cells (stage 10) or SC-β cells (stage 11) or SC-β cells (stage 12) or SC-β cells (stage 13) or SC-β cells (stage 14) or SC-β cells (stage 15) or SC-β cells (stage 16)

[0230] In some embodiments, definitive endoderm cells can be obtained by differentiating at least some of the pluripotent cells in the population into definitive endoderm cells, for example, by contacting the pluripotent cell population with i) at least one growth factor from the TGF-β superfamily and ii) an activator of the WNT signaling pathway to induce at least some of the pluripotent cells to differentiate into definitive endoderm cells, wherein the definitive endoderm cells express at least one marker characteristic of the definitive endoderm.

[0231] Any growth factor from the TGF-β superfamily that can induce pluripotent stem cells to differentiate into definitive endoderm cells can be used in the methods provided herein (for example, alone or in combination with a WNT signaling pathway activator). In some embodiments, the growth factor from the TGF-β superfamily includes activin A. In some embodiments, the growth factor from the TGF-β superfamily includes growth differentiation factor 8 (GDF8). Any WNT signaling pathway activator that can induce pluripotent stem cells to differentiate into definitive endoderm cells can be used in the methods provided herein (for example, alone or in combination with a growth factor from the TGF-β superfamily). In some embodiments, the WNT signaling pathway activator includes CHIR99021. In some embodiments, the WNT signaling pathway activator includes Wnt3a recombinant protein.

[0232] In some embodiments, by contacting a pluripotent cell population with i) activin A and ii) CHIR99021 for a suitable time period, e.g., about 2 days, about 3 days, about 4 days, or about 5 days to induce at least some of the pluripotent cells in the population to differentiate into definitive endoderm cells, achieving differentiation of at least some of the pluripotent cells in the population into definitive endoderm cells, wherein the definitive endoderm cells express at least one marker characteristic of the definitive endoderm. In some embodiments, the method includes contacting a pluripotent cell population with activin A and CHIR99021 for 1 day, and then contacting with activin A (in the absence of CHIR99021) for another 1 or 2 days.

[0233] In some examples, the method comprises differentiating the pluripotent cells into definitive endoderm cells by contacting the pluripotent cell population with a suitable concentration, such as about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL, of a growth factor from the TGF-β superfamily (e.g., activin A). In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 70 ng / ml-130 ng / ml, 80 ng / ml-120 ng / ml, or 90 ng / ml-110 ng / ml of activin A. In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 100 ng / mL of activin A. In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 200 ng / mL of activin A.

[0234] In some instances, the method includes contacting pluripotent cells with a suitable concentration of about 0.01 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.5 μM, about 0.8 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 5 μM, about 8 μM, about 10 μM, about 12 μM, about 15 μM, about 20 μM, about 30 μM, about 50 μM, about 100 μM or about 200 μM WNT signaling pathway activator (for example, CHIR99021) to differentiate pluripotent cells into definitive endoderm cells. In some embodiments, the method includes contacting pluripotent cells with a CHIR99021 of about 1 μM-5 μM or 2 μM-4 μM. In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 2 μM CHIR99021. In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 3 μM CHIR99021. In some embodiments, the method comprises differentiating pluripotent cells into definitive endoderm cells using about 5 μM CHIR99021.

[0235] In some embodiments, the cell is further contacted with a water-soluble synthetic polymer. In some embodiments, the water-soluble synthetic polymer is polyvinyl alcohol. In some cases, polyvinyl alcohol is at least 78% hydrolyzed, for example, 79%-81% hydrolyzed, 87%-89% hydrolyzed, 87%-90% hydrolyzed or 99% hydrolyzed. In some embodiments, polyvinyl alcohol is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% hydrolyzed. In some embodiments, PVA is 80% hydrolyzed.

[0236] In some embodiments, the definitive endoderm cells produced by the methods disclosed herein express at least one marker selected from the group consisting of: Nodal, Tmprss2, Tmem30b, St14, Spink3, Sh3gl2, Ripk4, Rab1S, Npnt, Clic6, Cldn5, Cacna1b, Bnip1, Anxa4, Emb, FoxA1, Sox17, and Rbm35a, wherein the expression of at least one marker is upregulated in the definitive endoderm cells relative to the pluripotent stem cells from which they are derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein do not express a statistically significant amount of at least one marker selected from the group consisting of: Gata4, SPARC, AFP, and Dab2 relative to the pluripotent stem cells from which they are derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein do not express a statistically significant amount of at least one marker selected from the group consisting of: Zicl, Pax6, Flk1, and CD31 relative to the pluripotent stem cells from which they are derived. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein have a statistically significant amount of higher levels of Smad2 phosphorylation relative to the pluripotent stem cells derived therefrom. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein have the ability to form intestinal tubes in vivo. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein can be differentiated into cells with a morphology characteristic of intestinal cells, and wherein the cells with a morphology characteristic of intestinal cells express FoxA2 and / or Claudin6. In some embodiments, the definitive endoderm cells produced by the methods disclosed herein can be further differentiated into cells of endoderm origin.

[0237] In some embodiments, before any differentiation or during the first stage of differentiation, pluripotent stem cell colonies are cultured in the presence of at least one β cell differentiation factor. People can use any pluripotent stem cell, such as human pluripotent stem cells, or human iPS cells or any pluripotent stem cell or other suitable pluripotent stem cells discussed herein. In some embodiments, β cell differentiation factors as described herein may be present in the culture medium of pluripotent stem cell colonies, or may be injected or regularly added during the growth (e.g., replication or proliferation) of pluripotent stem cell colonies. In certain instances, pluripotent stem cell colonies may be exposed to at least one β cell differentiation factor before any differentiation. In other instances, pluripotent stem cell colonies may be exposed to at least one β cell differentiation factor during the first stage of differentiation.

[0238] primitive intestinal tube cells

[0239] Aspects of the present disclosure relate to primitive intestinal cells. The primitive intestinal cells used herein can be derived from any source or generated according to any suitable protocol. In some aspects, definitive endoderm cells differentiate into primitive intestinal cells. In some aspects, primitive intestinal cells further differentiate into, for example, PDX1-positive pancreatic progenitor cells, NKX6.1-positive pancreatic progenitor cells, Ngn3-positive endocrine progenitor cells, insulin-positive endocrine cells, and are subsequently induced or matured into SC-β cells.

[0240] In some embodiments, primitive intestinal tube cells can be obtained by differentiating at least some of the definitive endoderm cells in the population into primitive intestinal tube cells, for example, by contacting the definitive endoderm cells with at least one growth factor from the fibroblast growth factor (FGF) family to induce at least some of the definitive endoderm cells to differentiate into primitive intestinal tube cells, wherein the primitive intestinal tube cells express at least one marker characteristic of primitive intestinal tube cells.

[0241] Any growth factor from the FGF family that can induce definitive endoderm cells to differentiate into primitive intestinal cells can be used in the methods provided herein (e.g., alone or in combination with other factors). In some embodiments, at least one growth factor from the FGF family includes keratinocyte growth factor (KGF). In some embodiments, at least one growth factor from the FGF family includes FGF2. In some embodiments, at least one growth factor from the FGF family includes FGF8B. In some embodiments, at least one growth factor from the FGF family includes FGF10. In some embodiments, at least one growth factor from the FGF family includes FGF21.

[0242] In some embodiments, primitive gut tube cells can be obtained by differentiating at least some of the definitive endoderm cells in a population into primitive gut tube cells, for example, by contacting the definitive endoderm cells with KGF for a period of time, for example, about 1 day, about 2 days, about 3 days or about 4 days, to induce at least some of the definitive endoderm cells to differentiate into primitive gut tube cells.

[0243] In some embodiments, the method includes by making definitive endoderm cell and suitable concentration, such as about 10ng / mL, about 20ng / mL, about 50ng / mL, about 75ng / mL, about 80ng / mL, about 90ng / mL, about 95ng / mL, about 100ng / mL, about 110ng / mL, about 120ng / mL, about 130ng / mL, about 140ng / mL, about 150ng / mL, about 175ng / mL, about 180ng / mL, about 200ng / mL, about 250ng / mL or about 300ng / mL from the somatomedin of FGF family (for example, KGF) contact, definitive endoderm cell is differentiated into primitive intestinal tube cell.In some embodiments, the method includes using the KGF of about 20ng / ml-80ng / ml, 30ng / ml-70ng / ml or 40ng / ml-60ng / mL to differentiate definitive endoderm cell into primitive intestinal tube cell. In some embodiments, the method comprises differentiating the definitive endoderm cells into primitive gut tube cells using about 50 ng / mL of KGF. In some embodiments, the method comprises differentiating the definitive endoderm cells into primitive gut tube cells using about 100 ng / mL of KGF.

[0244] In some embodiments, cell is further contacted with water-soluble synthetic polymer.In some embodiments, water-soluble synthetic polymer is polyvinyl alcohol.In some cases, polyvinyl alcohol is at least 78% hydrolysis, for example, 79%-81% hydrolysis, 87%-89% hydrolysis, 87%-90% hydrolysis or 99% hydrolysis.In some embodiments, polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% hydrolysis.In some embodiments, PVA is 80% hydrolysis.

[0245] PDX1-positive pancreatic progenitor cells

[0246] Aspects of the present disclosure relate to PDX1 positive pancreatic progenitor cells. The PDX1 positive pancreatic progenitor cells used herein can be derived from any source or generated according to any suitable protocol. In some aspects, primitive intestinal cells differentiate into PDX1 positive pancreatic progenitor cells. In some aspects, PDX1 positive pancreatic progenitor cells are NKX6.1 negative and can be further differentiated into, for example, NKX6.1 positive pancreatic progenitor cells, Ngn3 positive endocrine progenitor cells, insulin positive endocrine cells, and then induced or matured into SC-β cells.

[0247] In some aspects, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with i) at least one BMP signaling pathway inhibitor, ii) a growth factor from the TGF-β superfamily, iii) at least one growth factor from the FGF family, iv) at least one SHH pathway inhibitor, v) at least one retinoic acid (RA) signaling pathway activator, vi) at least one protein kinase C activator, and vii) a ROCK inhibitor to induce at least some of the primitive intestinal tube cells to differentiate into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0248] In some aspects, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with i) at least one BMP signaling pathway inhibitor, ii) a growth factor from the TGF-β superfamily, iii) at least one growth factor from the FGF family, iv) at least one SHH pathway inhibitor, v) at least one retinoic acid (RA) signaling pathway activator, and vi) at least one protein kinase C activator to induce at least some of the primitive intestinal tube cells to differentiate into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0249] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with i) at least one BMP signaling pathway inhibitor, ii) at least one growth factor from the FGF family, iii) at least one SHH pathway inhibitor, iv) at least one retinoic acid (RA) signaling pathway activator, and v) at least one protein kinase C activator to induce at least some of the primitive intestinal tube cells to differentiate into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0250] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive gut tube cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive gut tube cells with i) at least one SHH pathway inhibitor, ii) at least one retinoic acid (RA) signaling pathway activator, and iii) at least one protein kinase C activator, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0251] In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in a population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with i) at least one growth factor from the FGF family and ii) at least one retinoic acid (RA) signaling pathway activator to induce at least some of the primitive intestinal tube cells to differentiate into PDX1-positive pancreatic progenitor cells, wherein the PDX1-positive pancreatic progenitor cells express PDX1.

[0252] Any BMP signaling pathway inhibitor that can induce the differentiation of primitive intestinal tube cells into PDX1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone or in any combination with a growth factor from the TGF-β superfamily, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the BMP signaling pathway inhibitor includes LDN193189 or DMH-1. In some examples, the method comprises contacting the primitive intestinal cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some examples, the method comprises contacting the primitive intestinal cells with a concentration of a BMP signaling pathway inhibitor (e.g., DMH-1), such as about 0.01 μM, about 0.02 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.5 μM, about 0.8 μM, about 1 μM, about 1.2 μM, about 1.5 μM, about 1.75 μM, about 2 μM, about 2.2 μM, about 2.5 μM, about 2.75 μM, about 3 μM, about 3.25 μM, about 3.5 μM, about 3.75 μM, about 4 μM, about 4.5 μM, about 5 μM, about 8 μM, about 10 μM, about 15 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, or about 100 μM. In some instances, the method includes contacting the primitive intestinal tube cells with a concentration of a BMP signaling pathway inhibitor (e.g., DMH-1), such as about 220nM-280nM, about 230nM-270nM, about 240nM-260nM, or about 245nM-255nM. In some instances, the method includes contacting the primitive intestinal tube cells with a concentration of about 250nM of a BMP signaling pathway inhibitor (e.g., DMH-1).

[0253] Any growth factor from the TGF-β superfamily that can induce the differentiation of primitive intestinal cells into PDX1-positive pancreatic progenitor cells (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, a growth factor from the FGF family, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor) can be used. In some embodiments, the growth factor from the TGF-β family includes activin A. In some embodiments, the growth factor from the TGF-β family includes GDF8. In some examples, the method comprises contacting the primitive intestinal cells with a concentration of a growth factor from the TGF-β superfamily (e.g., activin A), such as about 5 ng / mL, about 7.5 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL, about 11 ng / mL, about 12 ng / mL, about 13 ng / mL, about 14 ng / mL, about 15 ng / mL, about 16 ng / mL, about 17 ng / mL, about 18 ng / mL, about 19 ng / mL, about 20 ng / mL, about 21 ng / mL, about 22 ng / mL, about 23 ng / mL, about 24 ng / mL, about 25 ng / mL, about 26 ng / mL, about 27 ng / mL, about 28 ng / mL, about 29 ng / mL, about 30 ng / mL, about 35 ng / mL, about 40 ng / mL, about 50 ng / mL, or about 100 ng / mL. In some examples, the method comprises contacting the primitive gut cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 17 ng / ml-23 ng / ml, about 18 ng / ml-22 ng / ml, or about 19 ng / ml-21 ng / ml. In some examples, the method comprises contacting the primitive gut cells with a growth factor from the TGF-β superfamily (e.g., activin A) at a concentration of about 20 ng / ml.

[0254] Any growth factor from the FGF family that can induce primitive intestinal cells to differentiate into PDX1-positive pancreatic progenitor cells (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, a growth factor from the TGF-β superfamily, at least one SHH pathway inhibitor, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor) can be used. In some embodiments, at least one growth factor from the FGF family includes keratinocyte growth factor (KGF). In some embodiments, at least one growth factor from the FGF family is selected from the group consisting of: FGF2, FGF8B, FGF10, and FGF21. In some examples, the method comprises contacting the primitive intestinal cells with a concentration of a growth factor from the FGF family (e.g., KGF), such as about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL. In some instances, the method includes contacting the primitive intestinal tube cells with a growth factor (e.g., KGF) from the FGF family at a concentration of about 20 ng / ml-80 ng / ml, about 30 ng / ml-70 ng / ml, about 40 ng / ml-60 ng / ml, or about 45 ng / ml-55 ng / ml. In some instances, the method includes contacting the primitive intestinal tube cells with a growth factor (e.g., KGF) from the FGF family at a concentration of about 50 ng / ml.

[0255] Any SHH pathway inhibitor that can induce the differentiation of primitive intestinal tube cells into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, a growth factor from the TGF-β superfamily, at least one retinoic acid signaling pathway activator, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the SHH pathway inhibitor includes Sant1. In some examples, the method comprises treating the primitive intestinal cells with a concentration such as about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about The invention relates to contacting an SHH pathway inhibitor (e.g., Sant1) at about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM. In some instances, the method comprises contacting the primitive intestinal tube cells with a concentration of an SHH pathway inhibitor (e.g., Sant1), such as about 220 nM-280 nM, about 230 nM-270 nM, about 240 nM-260 nM, or about 245 nM-255 nM. In some instances, the method comprises contacting the primitive intestinal tube cells with a concentration of about 250 nM of an SHH pathway inhibitor (e.g., Sant1).

[0256] Any RA signaling pathway activator capable of inducing differentiation of primitive intestinal tube cells into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one protein kinase C activator, and a ROCK inhibitor). In some embodiments, the RA signaling pathway activator includes retinoic acid. In some examples, the method comprises treating the primitive intestinal cells with a concentration such as about 0.02 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, or about 2. In some embodiments, the present invention relates to contacting an RA signaling pathway activator, e.g., retinoic acid, with at least one RA signaling pathway activator, e.g., retinoic acid, ... In some instances, the method includes contacting the primitive intestinal tube cells with a concentration of an RA signaling pathway activator (e.g., retinoic acid) such as about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM. In some instances, the method includes contacting the primitive intestinal tube cells with a concentration of about 2 μM of an RA signaling pathway activator (e.g., retinoic acid).

[0257] Any PKC activator capable of inducing differentiation of primitive intestinal tube cells into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, at least one RA signaling pathway activator, and a ROCK inhibitor). In some embodiments, the PKC activator includes PdBU. In some embodiments, the PKC activator includes TPPB. In some examples, the method comprises treating the primitive intestinal cells with a concentration such as about 10 nM, 50 nM, 100 nM, 150 nM, 200 nM, 250 nM, 300 nM, 350 nM, 400 nM, 450 nM, 500 nM, 550 nM, 600 nM, 650 nM, 700 nM, 750 nM, 800 nM, 850 nM, 900 nM, 950 nM, 1 μM, 10 μM, about 20 μM, about 50 μM, about 75 μM, about 80 μM, about 100 μM, about 120 μM, about 140 μM, about 150 μM, about 175 μM, about 180 μM, about 200 μM, about 210 μM, about 220 μM, about 240 μM, or about 260 μM.

[0014] In some embodiments, the present invention relates to a method for contacting a PKC activator (e.g., PdBU or TPPB) with about 1 mM, about 2 mM, about 3 mM, about 4 mM, or about 5 mM of the PKC activator. The method further comprises contacting the PKC activator with about 1 mM, about 250 μM, about 260 μM, about 280 μM, about 300 μM, about 320 μM, about 340 μM, about 360 μM, about 380 μM, about 400 μM, about 420 μM, about 440 μM, about 460 μM, about 480 μM, about 500 μM, about 520 μM, about 540 μM, about 560 μM, about 580 μM, about 600 μM, about 620 μM, about 640 μM, about 660 μM, about 680 μM, about 700 μM, about 750 μM, about 800 μM, about 850 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 4 mM, or about 5 mM of the PKC activator. In some embodiments, the method includes contacting the primitive intestinal cells with a PKC activator (e.g., PdBU or TPPB) at a concentration of 10nM-1mM, 10nM-500 μM, 10nM-1 μM, 10nM-800nM, 100nM-900nM, 300nM-800nM, 300nM-600nM, 400nM-600nM, 450nM-550nM or about 500nM. In some instances, the method includes contacting the primitive intestinal cells with a PKC activator (e.g., PdBU or TPPB) at a concentration of about 450mM-550mM, about 475nM-525nM, about 490nM-510nM or about 495nM-505nM. In some examples, the method comprises contacting the primitive intestinal cells with a PKC activator (eg, PdBU or TPPB) at a concentration of about 500 nM. In some embodiments, the primitive intestinal cells are not treated with a PKC activator (eg, PDBU).

[0258] Any ROCK inhibitor capable of inducing the differentiation of primitive intestinal tube cells into PDX1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one BMP signaling pathway inhibitor, at least one growth factor from the FGF family, at least one SHH pathway inhibitor, a PKC activator, and at least one RA signaling pathway activator). In some embodiments, the ROCK inhibitor includes Thiazovivin, Y-27632, Fasudil / HA1077, or H-1152. In some embodiments, the ROCK inhibitor includes Y-27632. In some embodiments, the ROCK inhibitor includes Thiazovivin. In some examples, the method comprises treating the primitive intestinal cells with a concentration such as about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about 60 μM, about 61 μM, about About 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM or about 100 μM ROCK inhibitor (e.g., Y-27632 or Thiazovivin). In some instances, the method includes contacting primitive intestinal cells with a concentration of ROCK inhibitor (e.g., Y-27632 or thiazovivin) such as about 2.2 μM-2.8 μM, about 2.3 μM-2.7 μM or about 2.4 μM-2.6 μM. In some examples, the method comprises contacting the primitive gut cells with a ROCK inhibitor (eg, Y-27632 or thiazovivin) at a concentration of about 2.5 μM.

[0259] In some embodiments, cell is further contacted with water-soluble synthetic polymer.In some embodiments, water-soluble synthetic polymer is polyvinyl alcohol.In some cases, polyvinyl alcohol is at least 78% hydrolysis, for example, 79%-81% hydrolysis, 87%-89% hydrolysis, 87%-90% hydrolysis or 99% hydrolysis.In some embodiments, polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% hydrolysis.In some embodiments, PVA is 80% hydrolysis.

[0260] In some embodiments, the PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin, and activin A for a suitable period of time, for example, about 1 day, about 2 days, about 3 days, or about 4 days. In some embodiments, the PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive intestinal tube cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive intestinal tube cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin, and activin A for about 2 days. In some embodiments, PDX1-positive pancreatic progenitor cells can be obtained by differentiating at least some of the primitive gut tube cells in the population into PDX1-positive pancreatic progenitor cells, for example, by contacting the primitive gut tube cells with retinoic acid, KGF, Sant1, DMH-1, PdBU, thiazovivin and activin A for 1 day, and then contacting the cells with retinoic acid, KGF, Sant1, PdBU, thiazovivin and activin A for 1 day (in the absence of DMH-1).

[0261] NKX6.1-positive pancreatic progenitor cells

[0262] Aspects of the present disclosure relate to NKX6.1-positive pancreatic progenitor cells. The NKX6.1-positive pancreatic progenitor cells used herein can be derived from any source or generated according to any suitable protocol. In some aspects, PDX1-positive, NKX6.1-negative pancreatic progenitor cells differentiate into PDX1-positive, NKX6.1-positive pancreatic progenitor cells. In some aspects, NKX6.1-positive pancreatic progenitor cells further differentiate into, for example, Ngn3-positive endocrine progenitor cells or insulin-positive endocrine cells, which are then induced or matured into SC-β cells.

[0263] In some aspects, a method of generating NKX6.1-positive pancreatic progenitor cells from PDX1-positive pancreatic progenitor cells comprises contacting a cell population comprising PDX1-positive pancreatic progenitor cells (e.g., under conditions that promote cell clustering and / or promote cell survival) with at least two β cell differentiation factors comprising: a) at least one growth factor from the fibroblast growth factor (FGF) family, b) a sonic hedgehog pathway inhibitor, and optionally c) a low concentration of a retinoic acid (RA) signaling pathway activator, to induce at least one PDX1-positive pancreatic progenitor cell in the population to differentiate into a NKX6.1-positive pancreatic progenitor cell, wherein the NKX6.1-positive pancreatic progenitor cell expresses NKX6.1.

[0264] In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) an activator of the RA signaling pathway to induce at least some of the PDX1-positive pancreatic progenitor cells to differentiate into PDX1-positive, NKX6.1-positive pancreatic progenitor cells, wherein the PDX1-positive, NKX6.1-positive pancreatic progenitor cells express PDX1 and NKX6.1.

[0265] In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) a RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily to induce at least some of the PDX1-positive pancreatic progenitor cells to differentiate into PDX1-positive, NKX6.1-positive pancreatic progenitor cells. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with the following for 3 days, 4 days, or 5 days: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) an RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily; and then contacting the cells with the following: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, and optionally iii) an RA signaling pathway activator, iv) a ROCK inhibitor, and v) at least one growth factor from the TGF-β superfamily, and vi) a PKC activator and optionally a γ-secretase inhibitor. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with at least one growth factor from the FGF family under conditions that promote cell clustering. In some embodiments, the growth factor from the FGF family is KGF.

[0266] In some embodiments, the present disclosure provides a method, wherein a first cell population comprising PDX1-positive, NKX6.1-negative cells is cultured for a period of about 1 day, 2 days, 3 days, 4 days, or 5 days (e.g., 2-4 days, 3-4 days, or 4-5 days) in a culture medium comprising any one or a combination of the following: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, iii) an RA signaling pathway activator, iv) a ROCK inhibitor, and v) a growth factor from the TGF-β superfamily; thereby generating a second cell population. In some embodiments, the second cell population is then incubated for about 1, 2, or 3 days (e.g., 1-2 days, 1-3 days, or 2-3 days) in a composition comprising any one or a combination of: i) at least one growth factor from the FGF family, ii) at least one SHH pathway inhibitor, iii) a RA signaling pathway activator, iv) a ROCK inhibitor, v) a growth factor from the TGF-β superfamily, vi) a PKC activator, vii) a FoxO1 inhibitor, and optionally viii) a notch signaling pathway inhibitor.

[0267] In some embodiments, in the culture medium used to culture the first cell population, a growth factor from the FGF family is present at a concentration of about 45-55 ng / ml, about 46-54 ng / ml, about 47-53 ng / ml, about 48-52 ng / ml, or about 49-51 ng / ml, an SHH pathway inhibitor is present at a concentration of about 200 nM-300 nM, about 220 nM-280 nM, or about 240 nM-260 nM, and an RA signaling pathway activator is present. The active agent is present at a concentration of about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM, the ROCK inhibitor is present at a concentration of about 2 μM-3 μM, about 2.2 μM-2.8 μM, or about 2.4 μM-2.6 μM, and / or the growth factor from the TGF-β superfamily is present at a concentration of about 2 ng / ml-8 ng / ml, about 3 ng / ml-7 ng / ml, or about 4 ng / ml-6 ng / ml.

[0268] In some embodiments, in the culture medium used to culture the second cell population, the growth factor from the FGF family is present at a concentration of about 45-55 ng / ml, about 46-54 ng / ml, about 47-53 ng / ml, about 48-52 ng / ml, or about 49-51 ng / ml, the SHH pathway inhibitor is present at a concentration of about 200 nM-300 nM, about 220 nM-280 nM, or about 240 nM-260 nM, the RA signaling pathway activator is present at a concentration of about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM, and the ROCK inhibitor is present at a concentration of about 2 μM-3 μM, about 2.2 μM-2.8 μM, or about 2.4 μM. M-2.6 μM, the growth factor from the TGF-β superfamily is present at a concentration of about 2 ng / ml-8 ng / ml, about 3 ng / ml-7 ng / ml, or about 4 ng / ml-6 ng / ml, the PKC activator is present at a concentration of about 0.2 μM-0.8 μM, about 0.3 μM-0.7 μM, or about 0.4 μM-0.6 μM, and the FoxO1 inhibitor is present at a concentration of about 0.7 μM-1.3 μM, about 0.8 μM-1.2 μM, or about 0.9 μM-1.1 μM, and optionally the notch signaling pathway inhibitor is present at a concentration of about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM.

[0269] In some embodiments, PDX1 positive pancreatic progenitor cells are generated from a pluripotent cell population. In some embodiments, PDX1 positive pancreatic progenitor cells are generated from an iPS cell population. In some embodiments, PDX1 positive pancreatic progenitor cells are generated from an ESC cell population. In some embodiments, PDX1 positive pancreatic progenitor cells are generated from a definitive endoderm cell population. In some embodiments, PDX1 positive pancreatic progenitor cells are generated from a primitive intestinal tube cell population.

[0270] Any growth factor from the FGF family that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone or in any combination with at least one SHH pathway inhibitor, ROCK inhibitor, growth factor from the TGF-β superfamily, and at least one retinoic acid signaling pathway activator). In some embodiments, at least one growth factor from the FGF family includes keratinocyte growth factor (KGF). In some embodiments, at least one growth factor from the FGF family is selected from the group consisting of: FGF8B, FGF 10, and FGF21. In some examples, the method comprises contacting the PDX1-positive pancreatic progenitor cells with a concentration of a growth factor from the FGF family (e.g., KGF), such as about 10 ng / mL, about 20 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 110 ng / mL, about 120 ng / mL, about 130 ng / mL, about 140 ng / mL, about 150 ng / mL, about 175 ng / mL, about 180 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL. In some instances, the method includes contacting the PDX1 positive pancreatic progenitor cells with a concentration such as about 20ng / ml-80ng / ml, about 30ng / ml-70ng / ml, about 40ng / ml-60ng / ml, or about 45ng / ml-55ng / ml of a somatomedin from the FGF family (e.g., KGF). In some instances, the method includes contacting the PDX1 positive pancreatic progenitor cells with a concentration of about 50ng / ml of a somatomedin from the FGF family (e.g., KGF).

[0271] Any SHH pathway inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone or in any combination with at least one growth factor from the FGF family, a retinoic acid signaling pathway activator, a ROCK inhibitor, and at least one growth factor from the TGF-β superfamily). In some embodiments, the SHH pathway inhibitor includes Sant1. In some examples, the method comprises treating PDX1-positive pancreatic progenitor cells with a concentration such as about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM. , about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM or about 5 μM of an SHH pathway inhibitor (e.g., Sant1). In some instances, the method includes contacting the PDX1-positive pancreatic progenitor cells with a concentration of an SHH pathway inhibitor (e.g., Sant1), such as about 220 nM-280 nM, about 230 nM-270 nM, about 240 nM-260 nM, or about 245 nM-255 nM. In some instances, the method includes contacting the PDX1-positive pancreatic progenitor cells with a concentration of about 250 nM of an SHH pathway inhibitor (e.g., Sant1).

[0272] Any RA signaling pathway activator that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one growth factor from the FGF family, at least one SHH pathway inhibitor, a ROCK inhibitor, and at least one growth factor from the TGF-β superfamily). In some embodiments, the RA signaling pathway activator includes retinoic acid. In some examples, the method comprises treating PDX1-positive pancreatic progenitor cells with a concentration such as about 0.02 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2.1 μM, about 2.2 μM, about 2.

[0014] In some embodiments, the present invention relates to contacting the activator of the RA signaling pathway, e.g., retinoic acid, with at least one RA signaling pathway activator, e.g., retinoic acid, ... In some instances, the method includes contacting the PDX1-positive pancreatic progenitor cells with a concentration of an RA signaling pathway activator (e.g., retinoic acid), such as about 70 nM-130 nM, about 80 nM-120 nM, about 90 nM-110 nM, or about 95 nM-105 nM. In some instances, the method includes contacting the PDX1-positive pancreatic progenitor cells with a concentration of about 100 nM of an RA signaling pathway activator (e.g., retinoic acid).

[0273] Any ROCK inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used (e.g., alone or in any combination with at least one growth factor from the FGF family, at least one SHH pathway inhibitor, an RA signaling pathway activator, and at least one growth factor from the TGF-β superfamily). In some embodiments, the ROCK inhibitor includes Thiazovivin, Y-27632, Fasudil / HA1077, or 14-1152. In some examples, the method comprises treating PDX1-positive pancreatic progenitor cells with a concentration such as about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about 60 μM, about 61 μM, about In some instances, the method includes contacting the PDX1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or Thiazovivin) at a concentration of about 2.2 μM-2.8 μM, about 2.3 μM-2.7 μM, or about 2.4 μM-2.6 μM. In some examples, the method comprises contacting the PDX1-positive pancreatic progenitor cells with a ROCK inhibitor (eg, Y-27632 or thiazovivin) at a concentration of about 2.5 μM.

[0274] Any activator from the TGF-β superfamily that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells (e.g., alone or in any combination with at least one growth factor from the FGF family, at least one SHH pathway inhibitor, RA signaling pathway activator, and ROCK inhibitor) can be used. In some embodiments, the activator from the TGF-β superfamily comprises activin A or GDF8. In some examples, the method comprises mixing PDX1-positive pancreatic progenitor cells with a concentration such as about 0.1 ng / mL, about 0.2 ng / mL, about 0.3 ng / mL, about 0.4 ng / mL, about 0.5 ng / mL, about 0.6 ng / mL, about 0.7 ng / mL, about 0.8 ng / mL, about 1 ng / mL, about 1.2 ng / mL, about 1.4 ng / mL, about 1.6 ng / mL, about 1.8 ng / mL, about 2 ng / mL, about 2.2 ng / mL, about 2.4 ng / mL, about 2.6 ng / mL, about 2.8 ng / mL, about 3 ng / mL, about 3.2 ng / mL, about 3.4 ng / mL, about 3.6 ng / mL, or about 4. In some embodiments, the invention relates to contacting a growth factor from the TGF-beta superfamily, such as activin A, with at least one ng / mL, about 3.8 ng / mL, about 4 ng / mL, about 4.2 ng / mL, about 4.4 ng / mL, about 4.6 ng / mL, about 4.8 ng / mL, about 5 ng / mL, about 5.2 ng / mL, about 5.4 ng / mL, about 5.6 ng / mL, about 5.8 ng / mL, about 6 ng / mL, about 6.2 ng / mL, about 6.4 ng / mL, about 6.6 ng / mL, about 6.8 ng / mL, about 7 ng / mL, about 8 ng / mL, about 9 ng / mL, about 10 ng / mL, about 20 ng / mL, about 30 ng / mL, or about 50 ng / mL of a growth factor from the TGF-beta superfamily, such as activin A. In some instances, the method comprises contacting the PDX1-positive pancreatic progenitor cells with a concentration, such as about 2 ng / ml-8 ng / ml, about 3 ng / ml-7 ng / ml, about 4 ng / ml-6 ng / ml, or about 4.5 ng / ml-5.5 ng / ml, of a growth factor from the TGF-β superfamily (e.g., activin A). In some instances, the method comprises contacting the PDX1-positive pancreatic progenitor cells with a concentration, such as about 5 ng / mL, of a growth factor from the TGF-β superfamily (e.g., activin A).

[0275] Any FoxO1 inhibitor that can induce differentiation of PDX1-positive pancreatic progenitor cells into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone or in any combination with at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, a ROCK inhibitor, at least one growth factor from the TGF-β superfamily, a PKC activator, and a Notch signaling pathway inhibitor). In some embodiments, the FoxO1 inhibitor is AS1842856. In some examples, the method comprises treating PDX1-positive pancreatic progenitor cells with a concentration such as about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0. In some examples, the method comprises contacting the PDX1-positive pancreatic progenitor cells with a FoxO1 inhibitor (e.g., AS1842856) at a concentration of about 0.7 μM-1.3 μM, about 0.8 μM-1.2 μM, or about 0.9 μM-1.1 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a FoxO1 inhibitor (eg, AS1842856) at a concentration, such as about 1 μM.

[0276] Any PKC activator capable of inducing PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone, or in any combination with at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, ROCK inhibitor, at least one growth factor from the TGF-β superfamily, FoxO1 inhibitor, and Notch signaling pathway inhibitor). In some embodiments, the PKC activator is PDBU. In some instances, the method includes inducing PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells at a concentration of, such as about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM , about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM or about 5 μM PKC activator (e.g., PDBU) contact. In some instances, the method includes contacting PDX1 positive pancreatic progenitor cells with a concentration of PKC activator (e.g., PDBU) such as about 0.2 μM-0.8 μM, about 0.3 μM-0.7 μM, about 0.4 μM-0.6 μM. In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a concentration of a PKC activator (eg, PDBU), such as about 0.5 μM.

[0277] Any Notch signaling pathway inhibitor that can induce PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells can be used in the methods provided herein (e.g., alone, or in any combination with at least one growth factor from the FGF family, at least one retinoic acid signaling pathway activator, a ROCK inhibitor, at least one growth factor from the TGF-β superfamily, a FoxO1 inhibitor, and a PKC activator). In some embodiments, the Notch signaling pathway inhibitor is XXI. In some examples, the method includes inducing PDX1-positive pancreatic progenitor cells to differentiate into NKX6.1-positive pancreatic progenitor cells at a concentration of, such as about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM or about 5 μM Notch signaling pathway inhibitor (for example, XXI) contact. In some instances, the method includes contacting PDX1 positive pancreatic progenitor cells with a concentration such as about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM or about 1.9 μM-2.1 μM Notch signaling pathway inhibitor (for example, XXI). In some examples, the method includes contacting PDX1-positive pancreatic progenitor cells with a Notch signaling pathway inhibitor (eg, XXI) at a concentration, such as about 2 μM.

[0278] In some embodiments, cell is further contacted with water-soluble synthetic polymer.In some embodiments, water-soluble synthetic polymer is polyvinyl alcohol.In some cases, polyvinyl alcohol is at least 78% hydrolysis, for example, 79%-81% hydrolysis, 87%-89% hydrolysis, 87%-90% hydrolysis or 99% hydrolysis.In some embodiments, polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% hydrolysis.In some embodiments, PVA is 80% hydrolysis.

[0279] In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, and RA for a period of 5 or 6 days under conditions that promote cell clustering. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, RA, thiazovivin, and activin A for a period of 5 or 6 days under conditions that promote cell clustering. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF for a period of 5 days under conditions that promote cell clustering. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by contacting PDX1-positive pancreatic progenitor cells with KGF for a period of 6 days under conditions that promote cell clustering. In some embodiments, PDX1-positive, NKX6.1-positive pancreatic progenitor cells are obtained by: a) contacting PDX1-positive pancreatic progenitor cells with KGF, Sant1, RA, thiazovivin, and activin A for a period of 3 days, 4 days, or 5 days (e.g., 4 days), and then b) contacting the cells of a) with PDBU, XXI, KGF, Sant1, RA, thiazovivin, and activin A, and optionally AS1842856, for a period of 1 day, 2 days, or 3 days (e.g., 2 days).

[0280] Insulin-positive endocrine cells

[0281] Aspects of the present disclosure relate to insulin-positive endocrine cells (e.g., NKX6.1 positive, ISL1 positive cells or beta-like cells) and other methods for producing insulin-positive endocrine cells. The insulin-positive endocrine cells used herein can be derived from any source or produced according to any suitable protocol. In some aspects, NKX6.1 positive pancreatic progenitor cells differentiate into insulin-positive endocrine cells (e.g., NKX6.1 positive, ISL1 positive cells or beta-like cells). In some aspects, insulin-positive endocrine cells further differentiate, for example, by induction or maturation into SC-β cells.

[0282] In some aspects, the method of generating insulin-positive endocrine cells from NKX6.1-positive pancreatic progenitor cells comprises contacting a cell population comprising NKX6.1-positive pancreatic progenitor cells (e.g., under conditions that promote cell clustering) with a) a TGF-β signaling pathway inhibitor, b) a thyroid hormone signaling pathway activator, c) a BMP pathway inhibitor, and / or d) a protein kinase inhibitor to induce at least one NKX6.1-positive pancreatic progenitor cell in the population to differentiate into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, the insulin-positive endocrine cell expresses PDX1, NKX6.1, ISL1, NKX2.2, Mafb, glis3, Sur1, Kir6.2, Znt8, SLC2A1, SLC2A3, and / or insulin.

[0283] Any TGF-β signaling pathway inhibitor that can induce NKX6.1 positive pancreatic progenitor cells to differentiate into insulin positive endocrine cells can be used (e.g., alone, or in combination with other β cell differentiation factors, e.g., thyroid hormone signaling pathway activators). In some embodiments, the TGF-β signaling pathway includes the TGF-β receptor type I kinase signaling pathway. In some embodiments, the TGF-β signaling pathway inhibitor includes Alk5 inhibitor II. In some examples, the method comprises treating NKX6.1-positive endocrine cells with a concentration such as about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 10.5 μM, about 11 μM, about 11.5 μM, about 12 μM. , about 12.5 μM, about 13 μM, about 13.5 μM, about 14 μM, about 14.5 μM, about 15 μM, about 15.5 μM, about 16 μM, about 16.5 μM, about 17 μM, about 17.5 μM, about 18 μM, about 18.5 μM, about 19 μM, about 19.5 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 45 μM or about 50 μM of a TGF-β signaling pathway inhibitor (e.g., an Alk5 inhibitor, e.g., Alk5 inhibitor II). In some instances, the method includes contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a TGF-β signaling pathway inhibitor (e.g., Alk5 inhibitor, such as Alk5 inhibitor II) such as about 7 μM-13 μM, about 8 μM-12 μM, or about 9 μM-11 μM. In some instances, the method includes contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a TGF-β signaling pathway inhibitor (e.g., Alk5 inhibitor, such as Alk5 inhibitor II) such as about 10 μM.

[0284] Any thyroid hormone signaling pathway activator that can induce NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with other β-cell differentiation factors, e.g., TGF-β signaling pathway inhibitors). In some embodiments, the thyroid hormone signaling pathway activator includes triiodothyronine (T3). In some embodiments, the thyroid hormone signaling pathway activator includes GC-1. In some examples, the method includes incubating NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about 0.23 μM, about 0.24 μM, about 0.25 μM, about 0.26 μM, about 0.27 μM, about 0.28 μM, about 0.29 μM, about 0.3 μM, about 0.31 μM, about 0.32 μM, about 0.33 μM, about 0.34 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM or about 5 μM of a thyroid hormone signaling pathway activator (e.g., GC-1). In some examples, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a thyroid hormone signaling pathway activator (e.g., GC-1), such as about 0.7 μM-1.3 μM, about 0.8 μM-1.2 μM or about 0.9 μM-1.1 μM. In some examples, the method includes contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a thyroid hormone signaling pathway activator (eg, GC-1), such as about 1 μM.

[0285] In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with at least one additional factor. In some embodiments, the method comprises contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) a γ-secretase inhibitor, iii) at least one growth factor from the epidermal growth factor (EGF) family, iv) a TGF-β signaling pathway inhibitor, or vii) a thyroid hormone signaling pathway activator. In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with at least one additional factor. In some embodiments, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a γ-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) a protein kinase inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viiii) a wnt signaling pathway inhibitor, or ix) a PKC activator.

[0286] In some embodiments, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a γ-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) a protein kinase inhibitor, or ix) a ROCK inhibitor.

[0287] In some embodiments, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with at least one of: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a γ-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) an epigenetic modifying compound, ix) a protein kinase inhibitor, or x) a ROCK inhibitor. In some embodiments, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells in culture with: i) an SHH pathway inhibitor, ii) an RA signaling pathway activator, iii) a γ-secretase inhibitor, iv) at least one growth factor from the epidermal growth factor (EGF) family, v) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, vi) a TGF-β signaling pathway inhibitor, vii) a thyroid hormone signaling pathway activator, viii) an epigenetic modification compound, ix) a protein kinase inhibitor, x) a ROCK inhibitor, xi) a PKC activator, and xii) a Wnt signaling pathway inhibitor for 1 day, 2 days, or 3 days (e.g., 1-2 days, 1-3 days, or 2-3 days), and then culturing the cells in the absence of the SHH pathway inhibitor. In the presence of a γ-secretase inhibitor, ii) at least one growth factor from the epidermal growth factor (EGF) family, iii) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, iv) a TGF-β signaling pathway inhibitor, v) a thyroid hormone signaling pathway activator, vi) an epigenetic modification compound, vii) a protein kinase inhibitor, and viiii) a ROCK inhibitor, the cells in culture are contacted for a period of 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, or 7 days (e.g., 1-7 days, 1-5 days, 1-3 days, 3-7 days, 3-5 days, 5-7 days, or 4-6 days) with: i) a γ-secretase inhibitor, ii) at least one growth factor from the epidermal growth factor (EGF) family, iii) at least one bone morphogenetic protein (BMP) signaling pathway inhibitor, iv) a TGF-β signaling pathway inhibitor, v) a thyroid hormone signaling pathway activator, vi) an epigenetic modification compound, vii) a protein kinase inhibitor, and viii) a ROCK inhibitor.

[0288] In some embodiments, in the method of generating insulin-positive endocrine cells from PDX1-positive, NKX6.1-positive pancreatic progenitor cells, some differentiation factors are present only during the first 1, 2, 3, 4, or 5 days of the differentiation step. In some embodiments, some differentiation factors, such as SHH pathway inhibitors, RA signaling pathway activators, PKC activators, and at least one growth factor from the EGF family, are removed from the culture medium after the first 1, 2, or 3 days of incubation.

[0289] Any γ-secretase inhibitor capable of inducing differentiation of NKX6.1-positive pancreatic progenitor cells in a population into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the γ-secretase inhibitor comprises XXI. In some embodiments, the γ-secretase inhibitor comprises DAPT. In some examples, the method comprises treating NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 0.01 μM, about 0.02 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.2 μM, about 0.3 μM, about 0.4 μM, about 0.5 μM, about 0.6 μM, about 0.7 μM, about 0.8 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about 2.3 μM, about 2. The invention relates to contacting the patient with a γ-secretase inhibitor (e.g., XXI) at least 4 μM, about 2.5 μM, about 2.6 μM, about 2.7 μM, about 2.8 μM, about 2.9 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.2 μM, about 5.4 μM, about 5.6 μM, about 5.8 μM, about 6 μM, about 6.2 μM, about 6.4 μM, about 6.6 μM, about 6.8 μM, about 7 μM, about 8 μM, about 9 μM, about 10 μM, about 20 μM, about 30 μM, or about 50 μM of the γ-secretase inhibitor (e.g., XXI). In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a γ-secretase inhibitor (e.g., XXI), such as about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a γ-secretase inhibitor (e.g., XXI), such as about 2 μM.

[0290] Any growth factor from the EGF family that can induce NKX6.1-positive pancreatic progenitor cells in the population to differentiate into insulin-positive endocrine cells (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator) can be used. In some embodiments, at least one growth factor from the EGF family includes betacellulin. In some embodiments, at least one growth factor from the EGF family includes EGF. In some examples, the method comprises contacting the NKX6.1-positive pancreatic progenitor cells with a concentration of, such as, about 1 ng / mL, about 2 ng / mL, about 4 ng / mL, about 6 ng / mL, about 8 ng / mL, about 10 ng / mL, about 12 ng / mL, about 14 ng / mL, about 16 ng / mL, about 18 ng / mL, about 20 ng / mL, about 22 ng / mL, about 24 ng / mL, about 26 ng / mL, about 28 ng / mL, about 30 ng / mL, about 40 ng / mL, about 50 ng / mL, about 75 ng / mL, about 80 ng / mL, about 90 ng / mL, about 95 ng / mL, about 100 ng / mL, about 150 ng / mL, about 200 ng / mL, about 250 ng / mL, or about 300 ng / mL of a growth factor from the EGF family (e.g., betacellulin). In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a growth factor from the EGF family (e.g., betacellulin), such as about 17 ng / ml-23 ng / ml, about 18 ng / ml-22 ng / ml, or about 19 ng / ml-21 ng / ml. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a growth factor from the EGF family (e.g., betacellulin), such as about 20 ng / ml.

[0291] Any RA signaling pathway activator that can induce NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the RA signaling pathway activator includes RA. In some examples, the method comprises treating NKX6.1-positive pancreatic progenitor cells with a concentration such as about 0.02 μM, about 0.05 μM, about 0.1 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 1 μM, about 1.1 μM, about 1.2 μM, about 1.3 μM, about 1.4 μM, about 1.5 μM, about 1.6 μM, about 1.7 μM, about 1.8 μM, about 1.9 μM, about 2 μM, about 2.1 μM, about 2.2 μM, about In some embodiments, the present invention relates to contacting the RA signaling pathway activator (e.g., retinoic acid) with about 2.3 μM, about 2.4 μM, about 2.5 μM, about 2.6 μM, about 2.7 μM, about 2.8 μM, about 3 μM, about 3.2 μM, about 3.4 μM, about 3.6 μM, about 3.8 μM, about 4 μM, about 4.2 μM, about 4.4 μM, about 4.6 μM, about 4.8 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 12 μM, about 14 μM, about 15 μM, about 16 μM, about 18 μM, about 20 μM, about 50 μM or about 100 μM of an RA signaling pathway activator (e.g., retinoic acid). In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of an RA signaling pathway activator (e.g., retinoic acid), such as about 20 nM-80 nM, about 30 nM-70 nM, or about 40 nM-60 nM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of an RA signaling pathway activator (e.g., retinoic acid), such as about 50 nM.

[0292] Any SHH pathway inhibitor that can induce NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used in the methods provided herein (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the SHH pathway inhibitor includes Sant1. In some examples, the method comprises treating NKX6.1-positive pancreatic progenitor cells with a concentration such as about 0.001 μM, about 0.002 μM, about 0.005 μM, about 0.01 μM, about 0.02 μM, about 0.03 μM, about 0.05 μM, about 0.08 μM, about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0. In some embodiments, the present invention relates to contacting an SHH pathway inhibitor (e.g., Sant1) with about 0.4 μM, about 0.5 μM, about 0.6 μM, about 0.8 μM, about 1 μM, about 2 μM, or about 5 μM of an SHH pathway inhibitor (e.g., Sant1). In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of an SHH pathway inhibitor (e.g., Sant1), such as about 220 nM-280 nM, about 230 nM-270 nM, about 240 nM-260 nM, or about 245 nM-255 nM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of an SHH pathway inhibitor (e.g., Sant1), such as about 250 nM.

[0293] Any BMP signaling pathway inhibitor that can induce NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the BMP signaling pathway inhibitor includes LDN193189 or DMH-1. In some examples, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 70 nM-130 nM, about 80 nM-120 nM, or about 90 nM-110 nM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 100 nM.

[0294] Any ROCK inhibitor that can induce NKX6.1-positive pancreatic progenitor cells in the population to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the ROCK inhibitor includes Thiazovivin, Y-27632, Fasudil / HA1077, or H-1152. In some embodiments, the ROCK inhibitor includes Y-27632. In some embodiments, the ROCK inhibitor includes Thiazovivin. In some examples, the method comprises treating PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about In some embodiments, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a ROCK inhibitor (e.g., Y-27632 or Thiazovivin) at a concentration of about 2.2 μM-2.8 μM, about 2.3 μM-2.7 μM or about 2.4 μM-2.6 μM. In some embodiments, the ROCK inhibitor comprises Thiazovivin. In some examples, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a ROCK inhibitor (eg, Y-27632 or Thiazovivin) at a concentration, such as about 2.5 μM.

[0295] Any epigenetic modification compound that can induce NKX6.1-positive pancreatic progenitor cells in the population to differentiate into insulin-positive endocrine cells can be used (e.g., alone, or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the epigenetic modification compound includes a histone methyltransferase inhibitor or an HDAC inhibitor. In some embodiments, the epigenetic modification compound includes a histone methyltransferase inhibitor, e.g., DZNep. In some embodiments, the epigenetic modification compound includes an HDAC inhibitor, e.g., KD5170. In some examples, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration of an epigenetic modifying compound (e.g., DZNep or KD5170), such as about 0.01 μM, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM. In some instances, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 70nM-130nM, about 80nM-120nM, or about 90nM-110nM of an epigenetic modification compound (e.g., DZNep or KD5170). In some instances, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 100nM of an epigenetic modification compound (e.g., DZNep or KD5170).

[0296] Any Wnt signaling pathway inhibitor that can induce NKX6.1-positive pancreatic progenitor cells in the population to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the Wnt signaling pathway inhibitor includes a tankyrase inhibitor. In some embodiments, the tankyrase inhibitor is NVP-TNKS656. In some examples, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration of, such as, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, about 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 0.95 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, or about 5 μM, of a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor such as NVP-TNKS656). In some instances, the method comprises contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 1.7 μM-2.3 μM, about 1.8 μM-2.2 μM, or about 1.9 μM-2.1 μM, of a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, such as NVP-TNKS656). In some instances, the method comprises contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration, such as about 2 μM, of a Wnt signaling pathway inhibitor (e.g., a tankyrase inhibitor, such as NVP-TNKS656).

[0297] Any PKC activator that can induce NKX6.1-positive pancreatic progenitor cells in the population to differentiate into insulin-positive endocrine cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the PKC activator is TPB or PDBU. In some examples, the method includes inducing PDX1-positive, NKX6.1-positive pancreatic progenitor cells to differentiate into insulin-positive endocrine cells at a concentration of, such as, about 0.01 μM, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.25 μM, about 0.3 μM, about 0.35 μM, about 0.4 μM, about 0.45 μM, about 0.5 μM, about 0.55 μM, About 0.6 μM, about 0.65 μM, about 0.7 μM, about 0.75 μM, about 0.8 μM, about 0.85 μM, about 0.9 μM, about 0.95 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM or about 20 μM of a PKC activator (e.g., TPB or PDBU). In some instances, the method includes contacting PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration of a PKC activator (TPB or PDBU), such as about 450 mM-550 mM, about 475 mM-525 nM, about 490 mM-510 nM or about 495 mM-505 nM. In some examples, the method comprises contacting the PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a concentration of a PKC activator (TPB or PDBU), such as about 500 nM.

[0298] In some embodiments, the cell colony is optionally contacted with a protein kinase inhibitor. In some embodiments, the cell colony is not contacted with a protein kinase inhibitor. In some embodiments, the cell colony is contacted with a protein kinase inhibitor. Any protein kinase inhibitor that can induce the NKX6.1-positive pancreatic progenitor cells in the colony to differentiate into insulin-positive endocrine cells can be used (e.g., alone, or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the protein kinase inhibitor includes staurosporine. In some examples, the method comprises treating NKX6.1-positive pancreatic progenitor cells with a concentration such as about 0.1 nM, about 0.2 nM, about 0.3 nM, about 0.4 nM, about 0.5 nM, about 0.6 nM, about 0.7 nM, about 0.8 nM, about 0.9 nM, about 1 nM, about 1.1 nM, about 1.2 nM, about 1.3 nM, about 1.4 nM, about 1.5 nM, about 1.6 nM, about 1.7 nM, about 1.8 nM, about 1.9 nM, about 2.0 nM, about 2.1 nM, about 2.2 nM, about 2.3 nM, about 2.4 nM, about The invention relates to contacting the patient with a protein kinase inhibitor (e.g., staurosporine) at about 2.5 nM, about 2.6 nM, about 2.7 nM, about 2.8 μM, about 2.9 nM, about 3 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 μM, about 4.9 nM, or about 5 nM. In some examples, the method comprises contacting the NKX6.1-positive pancreatic progenitor cells with a concentration of a protein kinase inhibitor (e.g., staurosporine), such as about 1 nM-5 nM, about 2 nM-4 nM, or about 2.5 nM-3.5 nM. In some examples, the method comprises contacting the NKX6.1-positive pancreatic progenitor cells with a concentration of a protein kinase inhibitor (e.g., staurosporine), such as about 3 nM.

[0299] In some embodiments, cell is further contacted with water-soluble synthetic polymer.In some embodiments, water-soluble synthetic polymer is polyvinyl alcohol.In some cases, polyvinyl alcohol is at least 78% hydrolysis, for example, 79%-81% hydrolysis, 87%-89% hydrolysis, 87%-90% hydrolysis or 99% hydrolysis.In some embodiments, polyvinyl alcohol (PVA) is 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% hydrolysis.In some embodiments, PVA is 89% hydrolysis.

[0300] In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with XXI, Alk5i, T3 or GC-1, RA, Sant1, betacellulin, PDBU, and NVP-TNKS656 for a period of 7 days to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with XXI, Alk5i, T3 or GC-1, RA, Sant1, betacellulin, and LDN193189 for a period of 7 days to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin. In some embodiments, one or more differentiation factors are added during a portion of stage 5, e.g., only on the first 1, 2, 3, 4, 5, or 6 days of the stage 5 period or on the last 1, 2, 3, 4, 5, or 6 days of the stage 5 period. In one example, cells are contacted with the SHH signaling pathway inhibitor, PKC activator, retinoic acid, and / or wnt signaling pathway inhibitor only on the first 2, 3, 4, or 5 days during stage 5, after which the SHH signaling pathway inhibitor, PKC activator, retinoic acid, and / or wnt signaling pathway inhibitor is not included in the culture medium or is removed from the culture medium. In another example, cells are contacted with the BMP signaling pathway inhibitor only on the first 1, 2, or 3 days during stage 5, after which the BMP signaling pathway inhibitor is removed from the culture medium.

[0301] In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with one or more metabolites. In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive pancreatic progenitor cells) with one or more of the following: acetyl-CoA-related metabolites, vitamins, histone deacetylase inhibitors (HDACi), redox homeostasis regulators, single-carbon metabolic pathway intermediates, and / or glutamine. Examples of metabolites include glutamine, taurine, acetate, β-hydroxybutyrate, biotin, and formate.

[0302] In some embodiments, the compositions of the present disclosure (e.g., culture medium) comprise acetyl-CoA-related metabolites. Exemplary acetyl-CoA-related metabolites include, but are not limited to, acetate, pyruvate, ketogenic amino acids, valine, leucine, isoleucine, phenylalanine, tyrosine, lysine, tryptophan, fatty acids, coenzyme A, isovaleryl-CoA, and β-hydroxybutyrate. In some embodiments, the acetyl-CoA-related metabolite is acetate. In some embodiments, an acetyl-CoA related metabolite is present in or added to a composition of the present disclosure at a concentration of about 10 nM, about 50 nM, about 80 nM, about 100 nM, about 120 nM, about 140 nM, about 150 nM, about 200 nM, about 300 nM, about 500 nM, about 800 nM, about 1 μM, about 10 μM, about 100 μM, about 500 μM, about 800 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 5 mM, or about 10 mM. In some embodiments, the acetyl-CoA related metabolite is present in or added to the compositions of the present disclosure at a concentration of about 0.01-50 mM, 0.1-50 mM, 0.5-50 mM, 0.01-20 mM, 0.1-20 mM, 0.5-20 mM, 0.01-10 mM, 0.1-10 mM, 0.5-10 mM, 0.8-25 mM, 0.8-10 mM, 0.8-5 mM, 0.8-2 mM, 0.8-1.5 mM, 0.8-1.2 mM, 0.9-1.1 mM, or 0.95-1.05 mM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 1 mM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 50 nM-1000 nM, 50 nM-800 nM, 50 nM-500 nM, 50 nM-300 nM, 50 nM-250 nM, 100 nM-200 nM, or 125 nM-175 nM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 160 nM.

[0303] In some embodiments, the compositions of the present disclosure (e.g., culture medium) include one or more vitamins. Exemplary vitamins include, but are not limited to, biotin, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6 (pyridoxine), and vitamin B12 (cyanocobalamin). In some embodiments, vitamins regulate fatty acid synthesis. In some embodiments, vitamins regulate branched-chain amino acid metabolism. In some embodiments, vitamins regulate or participate in the TCA cycle as cofactors, for example, as cofactors for pyruvate carboxylase. In some embodiments, the vitamin is biotin. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at the following concentrations: about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the vitamin is biotin present at a concentration of about 800 nM. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, 2 100 nM to 100 μM, 100 nM to 800 nM, 100 nM to 600 nM, 50 nM to 400 nM, 50 nM to 300 nM, 50 nM to 200 nM, 100 nM to 500 μM, 100 nM to 100 μM, 100 nM to 1 μM, 100 nM to 800 nM, 100 nM to 600 nM, 50 nM to 400 nM, 100 nM to 300 nM, or 100 nM to 200 nM.

[0304] In some embodiments, the compositions of the present disclosure (e.g., culture medium) comprise a histone deacetylase inhibitor (HDACi). Exemplary histone deacetylase inhibitors (HDACi) include, but are not limited to, β-hydroxybutyric acid, butyric acid, Class I HDACi, Class IIA HDACi, Class IIB HDACi, Class III HDACi, Class IV HDACi, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, HDAC-11, sirtuin, SIRT1, SIRT2, SIRT3, S IRT4, SIRT5, SIRT6, SIRT7, Vorinostat (suberoylanilide hydroxamic acid, SAHA, MK0683), Entinostat (MS-275, SNDX-275), Panobinostat (LBH589, NVP-LBH589), Trichostatin A (TSA), Motinostat (MGCD0103, MG0103), GSK3117391 (GSK3117391A, HDAC-IN-3), BRD3308, BRD3308, Tubastatin ATFA (Tubastatin A trifluoroacetate), Tubastatin A, SIS17, NKL 22, BML-210 (CAY10433), TC-H 106, SR-4370, belinostat (PXD101, NSC726630, PX-105684), romidipine (FK228, depsipeptide, FR 901228, NSC 630176), MC1568, givisostat (ITF2357), dacistat (LAQ824, NVP-LAQ824), CUDC-101, quinostat (JNJ-26481585), Pracinostat (SB939), PCI-34051, droxinostat (NS 41080), Abexostat (PCI-24781), Abexostat (PCI-24781, CRA-024781), RGFP966, AR-42 (HDAC-42), Ricolinostat (ACY-1215, Rosininostat), Valproate Sodium Salt (Sodium Valproate), Tasildinaline (CI994, PD-123654, GOE-5549, Acetyldinaline), Feminostat (CUDC-907), Sodium Butyrate (NaB), Curcumin, Diferuloylmethane, M344, Tubacin, RG2833 (RGFP109), RG2833 (RGFP109), Reminostat (RAS2410), Divalproex Sodium, Scriptaid (GCK 1026), Sodium Phenylbutyrate, Sinapic Acid (Sinapicacid), TMP269, Santacruzamate A (CAY10683), TMP195 (TFMO2), valproic acid (VPA), UF010, tasquinimod (ABR-215050), SKLB-23bb, isoguanosine, sulforaphane, BRD73954, citarinostat (ACY-241, HDAC-IN-2), suberoxime, splitomicin, HPOB, LMK-235, biphenyl-4-sulfonyl Chloro (p-phenylbenzenesulfonyl, 4-phenylbenzenesulfonyl, p-biphenylsulfonyl), NexturastatA, TH34, Chidamide tablets (Chidamide, HBI-8000, CS-055), (-)-parthenolide, WT161, CAY10603, CAY10603, ACY-738, cyperus rotundus A, tenomustine (EDO-S101), Domatinostat (4SC-202) and BG45. In some embodiments, the HDACi is β-hydroxybutyric acid. In some embodiments, the HDACi is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the HDACi is β-hydroxybutyrate present at a concentration of about 200 nM. In some embodiments, the HDACi is present in or added to the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, In some embodiments, the present invention relates to an aqueous solution of at least one amino acid sequence of the present invention. The aqueous solution of the present invention may be selected from the group consisting of 25nM to 200nM, 50nM to 500μM, 50nM to 100μM, 50nM to 10μM, 50nM to 1μM, 50nM to 800nM, 50nM to 600nM, 50nM to 400nM, 50nM to 300nM, 50nM to 200nM, 100nM to 500μM, 100nM to 100μM, 100nM to 10μM, 100nM to 1μM, 100nM to 800nM, 100nM to 600nM, 100nM to 400nM, 100nM to 300nM, or 100nM to 200nM.

[0305] In some embodiments, the compositions of the present disclosure (e.g., culture medium) include a redox homeostasis regulator. Exemplary redox homeostasis regulators include, but are not limited to, taurine, respiratory chain regulators, free radical scavengers, mitochondrial protein synthesis regulators, allium sulfur compounds, anthocyanidins, beta-carotene, catechins, copper, cryptoxanthins, flavonoids, indoles, isoflavones, lignans, lutein, lycopene, alpha lipoic acid, ellagic acid, manganese, polyphenols, selenium, glutathione, vitamin A, vitamin C, vitamin E, zinc, superoxide dismutase, GSHPx, Prx-I, catalase, and coenzyme Q10. In some embodiments, the redox homeostasis regulator is taurine. In some embodiments, the redox homeostasis regulator is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 500 nM, 1 μM, about 10 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, about 60 μM, about 70 μM, about 80 μM, about 90 μM, about 100 μM, about 110 μM, about 110 μM, about 150 μM, or about 200 μM. In some embodiments, the redox homeostasis regulator is taurine. In some embodiments, the redox homeostasis regulator is taurine present at a concentration of about 90 μM. In some embodiments, the redox homeostasis regulator is present or added at a concentration of about 100 nM to 1 mM, 500 nM to 1 mM, 1 μM to 1 mM, 10 μM to 1 mM, 20 μM to 1 mM, 30 μM to 1 mM, 30 μM to 1 mM, 40 μM to 1 mM, 50 μM to 1 mM, 60 μM to 1 mM, 70 μM to 1 mM, 80 μM to 1 mM, 100 nM to 250 μM, 500 nM to 250 μM, 1 μM to 250 μM, 10 μM to 250 μM, 20 μM to 2 10 μM to 100 μM, 50 μM to 250 μM, 30 μM to 250 μM, 40 μM to 250 μM, 50 μM to 250 μM, 60 μM to 250 μM, 70 μM to 250 μM, 100 nM to 100 μM, 500 nM to 100 μM, 1 μM to 100 μM, 10 μM to 100 μM, 20 μM to 100 μM, 30 μM to 100 μM, 40 μM to 100 μM, 50 μM to 100 μM, 60 μM to 100 μM, 70 μM to 100 μM or 80 μM to 100 μM.

[0306] In some embodiments, the compositions of the present disclosure (e.g., culture medium) comprise a one-carbon metabolic pathway intermediate. Exemplary one-carbon metabolic pathway intermediates include, but are not limited to, formate, tetrahydrofolate (THF), 10-formyl THF; 5,10-methyl THF; 5,10-methyl THF; and 10-formyl THF. In some embodiments, the one-carbon metabolic pathway intermediate is formate present at a concentration of about 50 μM. In some embodiments, the one-carbon metabolic pathway intermediate is present or added at a concentration of about 100 nM to 1 mM, 500 nM to 1 mM, 1 μM to 1 mM, 10 μM to 1 mM, 20 μM to 1 mM, 30 μM to 1 mM, 100 nM to 250 μM, 500 nM to 250 μM, 1 μM to 250 μM, 10 μM to 250 μM, 20 μM to 250 μM, 30 μM to 250 In some embodiments, the present invention relates to an aqueous solution of at least one amino acid sequence of the present invention and / or the like. In some embodiments, the aqueous solution of the present invention is preferably at least one amino acid sequence of the present invention and / or the like. In some embodiments, the aqueous solution of the present invention is preferably at least one amino acid sequence of the present invention and / or the like.

[0307] In some embodiments, the compositions of the present disclosure (e.g., culture medium) include glutamine. Therefore, in some embodiments, the compositions and methods of the present disclosure utilize glutamine in a form with increased bioavailability, such as a free glutamine form, such as a non-dipeptide form, a non-alanine-glutamine dipeptide form (e.g., a non-alanyl-l-glutamine form), a non-glycine-glutamine dipeptide form (e.g., a non-glycyl-l-glutamine form), a form in which glutamine is not conjugated to another amino acid or a stabilizing moiety, a monomeric form, a free form, or a combination thereof. In some embodiments, glutamine is provided as a protein hydrolyzate. In some embodiments, glutamine is present in or added to a composition of the present disclosure at a concentration of 0.5mM-20mM, 0.5mM-10mM, 0.5mM-5mM, 1mM-5mM, 2mM-5mM, or 1mM to 10mM. In some embodiments, glutamine is present in or added to the compositions of the present disclosure at a concentration of 3.8mM-4.2mM. In some embodiments, glutamine is present in or added to the compositions of the present disclosure at a concentration of 1mM-10mM, 1mM-7mM, 1mM-8mM, 1mM-6mM, 1mM-5mM, 1mM-4mM, 2mM-10mM, 2mM-7mM, 2mM-8mM, 2mM-6mM, 2mM-5mM, 2mM-4mM, 3mM-10mM, 3mM-7mM, 3mM-8mM, 3mM-6mM, 3mM-5mM, 3mM-4mM, 3.5mM-4.5mM, 3.8mM-4.2mM, or 3.9mM-4.1mM. In some embodiments, glutamine is present in or added to the compositions of the present disclosure at a concentration of about 4 mM. In some embodiments, at least 0.5 mM, 0.6 mM, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM, 1.5 mM, 2 mM, 2.5 mM, 3 mM, 3.5 mM, 4 mM, 4.5 mM, or 5 mM of the glutamine is not in the form of a dipeptide. In some embodiments, at least 500 μM, at least 750 μM, at least 1 mM, at least 1.5 mM, at least 2 mM, at least 2.5 mM, at least 2.6 mM, at least 2.7 mM, at least 2.8 mM, at least 2.9 mM, at least 3 mM, at least 3.1 mM, at least 3.2 mM, at least 3.3 mM, at least 3.4 mM, at least 3.5 mM, at least 3.6 mM, at least 3.7 mM, at least 3.8 mM, at least 3.9 mM, at least 4 mM, at least 5 mM, at least 5.5 mM, at least 6 mM, at least 6.5 mM, at least 7 mM, at least 7.5 mM, at least 8 mM, at least 8.5 mM, at least 9 mM, at least 9.5 mM, or at least 10 mM of the glutamine is in free form.

[0308] In some embodiments, the method comprises culturing a population of cells (eg, NKX6.1-positive pancreatic progenitor cells) in a culture medium to induce differentiation of at least one NKX6.1-positive pancreatic progenitor cell in the population into an insulin-positive endocrine cell, wherein the insulin-positive endocrine cell expresses insulin.

[0309] Aspects of the present disclosure relate to treating a cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a PKC activator and / or a wnt signaling pathway inhibitor, which can result in an increase in the percentage of pancreatic α cells, an increase in the percentage of pancreatic δ cells, an increase in the percentage of pancreatic β cells, a decrease in the percentage of EC cells, or any combination thereof, in a pancreatic endocrine cell population produced according to the methods disclosed herein.

[0310] In some embodiments, the method comprises contacting a cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a first composition comprising a FOXO1 inhibitor, a notch signaling pathway inhibitor, a PKC activator, a ROCK inhibitor, a growth factor from the TGFβ superfamily, a growth factor from the FGF family, a RA signaling pathway activator, and a SHH pathway inhibitor for 1 to 2 days, thereby obtaining a first transformed cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells; and contacting the first transformed cell population comprising PDX1-positive, NKX6.1-positive pancreatic progenitor cells with a second composition comprising a PKC activator, a notch signaling pathway inhibitor, a TGF-β signaling pathway inhibitor, a TH signaling pathway activator, a BMP signaling pathway inhibitor, a ROCK inhibitor, retinoic acid and an EGF family growth factor, a wnt signaling pathway inhibitor, and / or an epigenetic modification compound for 1 to 2 days, thereby obtaining a second transformed cell population comprising NKX6.1-positive, ISL1-positive endocrine cells.

[0311] pancreatic beta cells

[0312] Aspects of the present disclosure relate to generating pancreatic β cells (e.g., non-natural pancreatic β cells / SC-β cells) and additional methods of generating them. In some embodiments, non-natural pancreatic β cells are similar in form and function to endogenous mature β cells, but are still different from natural β cells.

[0313] In some embodiments, insulin-positive pancreatic endocrine cells produced using the methods provided herein can form cell clusters alone or with other types of cells (e.g., their precursors, e.g., stem cells, definitive endoderm cells, primitive intestinal tube cells, PDX1-positive pancreatic progenitor cells, or NKX6.1-positive pancreatic progenitor cells).

[0314] In some embodiments, any of the cells or cell populations disclosed herein are in a cell cluster. In some embodiments, the present disclosure provides a composition comprising one or more cell clusters. In some embodiments, the composition comprises 500-20,000, 500-15,000, 500-10,000, 500-5,000, 500-2,000, 500-1,000, 1,000-20,000, 1,000-15,000, 1,000-10,000, 1,000-5,000, 1,000-2,000, In some aspects, provided herein are cell clusters that are similar to the function and feature of endogenous islets. Such cell clusters can simulate the function of endogenous islets in regulating the metabolism (for example, glucose metabolism) of experimenter.

[0315] In some embodiments, the compositions or cell populations of the present disclosure comprise NKX6.1-positive, ISL-positive cells that express lower levels of MAFA than NKX6.1-positive, ISL-positive cells from the pancreas of healthy control adult subjects. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express higher levels of MAFB than NKX6.1-positive, ISL-positive cells from the pancreas of healthy control adult subjects. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express higher levels of SIX2, HOPX, IAPP and / or UCN3 than NKX6.1-positive, ISL-positive cells from the pancreas of healthy control adult subjects.

[0316] In some embodiments, the compositions or cell populations of the present disclosure comprise NKX6.1-positive, ISL-positive cells that do not express MAFA. In some embodiments, the compositions or cell populations comprise NKX6.1-positive, ISL-positive cells that express MAFB.

[0317] In some embodiments, the cell colony comprising insulin-positive endocrine cells can be directly induced to mature into SC-β cells without adding any exogenous differentiation factors (such as inhibitors of the TGF-β signaling pathway, thyroid hormone signaling pathway activators, PKC activators, growth factors from the TGF-β superfamily, FGF family or EGF family, SHH signaling pathway inhibitors, γ-secretase inhibitors, ROCK inhibitors or BMP signaling pathway inhibitors). In some embodiments, the methods provided herein include contacting a cell colony comprising NKX6.1-positive, ISL1-positive endocrine cells with serum albumin, a TGF-β signaling pathway inhibitor, a SHH pathway inhibitor, a TH signaling pathway activator, a protein kinase inhibitor, a ROCK inhibitor, a BMP signaling pathway inhibitor and / or an epigenetic modification compound. In some embodiments, the methods provided herein include contacting a cell colony comprising NKX6.1-positive, ISL1-positive endocrine cells with human serum albumin. In some embodiments, the methods provided herein include contacting a cell colony comprising NKX6.1-positive, ISL1-positive endocrine cells with a PKC activator.

[0318] In some embodiments, by contacting insulin-positive endocrine cells with differentiation factors, a cell population comprising insulin-positive endocrine cells can be induced to mature into SC-β cells. Differentiation factors can include at least one TGF-β signaling pathway inhibitor and thyroid hormone signaling pathway activator as described herein. In some embodiments, SC-β cells can be obtained by contacting a cell population comprising insulin-positive endocrine cells with Alk5i and T3 or GC-1.

[0319] In some embodiments, the methods provided herein comprise contacting a cell population comprising NKX6.1-positive, ISL1-positive endocrine cells with (i) a growth factor from the FGF family, (ii) a TGF-β signaling pathway inhibitor, (iii) a thyroid hormone signaling pathway activator, (iv) an epigenetic modification compound, (v) a protein kinase inhibitor, (vi) a ROCK inhibitor, (vii) a BMP signaling pathway inhibitor, and (viii) a lipase inhibitor for about 1, 2, or 5 days. In some embodiments, the contacting lasts for about three days.

[0320] Any TGF-β signaling pathway inhibitor capable of inducing the differentiation and maturation of insulin-positive endocrine cells into SC-β cells can be used (e.g., alone, or in combination with other β cell differentiation factors, e.g., thyroid hormone signaling pathway activators). In some embodiments, the TGF-β signaling pathway includes the TGF-β receptor type I kinase signaling pathway. In some embodiments, the TGF-β signaling pathway inhibitor includes an Alk5 inhibitor II. In some examples, the method comprises treating the insulin-positive endocrine cells with a concentration such as about 0.1 μM, about 0.5 μM, about 1 μM, about 1.5 μM, about 2 μM, about 2.5 μM, about 3 μM, about 3.5 μM, about 4 μM, about 4.5 μM, about 5 μM, about 5.5 μM, about 6 μM, about 6.5 μM, about 7 μM, about 7.5 μM, about 8 μM, about 8.5 μM, about 9 μM, about 9.5 μM, about 10 μM, about 10.5 μM, about 11 μM, about 11.5 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about About 12.5 μM, about 13 μM, about 13.5 μM, about 14 μM, about 14.5 μM, about 15 μM, about 15.5 μM, about 16 μM, about 16.5 μM, about 17 μM, about 17.5 μM, about 18 μM, about 18.5 μM, about 19 μM, about 19.5 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 45 μM or about 50 μM TGF-β signaling pathway inhibitor (for example, Alk5 inhibitor, for example, Alk5 inhibitor II) contacts. In some instances, the method includes making insulin-positive endocrine cells contact with a certain concentration of TGF-β signaling pathway inhibitor (for example, Alk5 inhibitor, such as Alk5 inhibitor II) such as about 7 μM-13 μM, about 8 μM-12 μM or about 9 μM-11 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a TGF-β signaling pathway inhibitor (eg, an Alk5 inhibitor, such as Alk5 inhibitor II) at a concentration, such as about 10 μM.

[0321] Any thyroid hormone signaling pathway activator that can induce insulin-positive endocrine cells to differentiate and mature into SC-β cells can be used (e.g., alone, or in combination with other β cell differentiation factors such as TGF-β signaling pathway inhibitors). In some embodiments, the thyroid hormone signaling pathway activator includes triiodothyronine (T3). In some embodiments, the thyroid hormone signaling pathway activator includes GC-1. In some examples, the method includes contacting the insulin-positive endocrine cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration such as about 0.1 μM, about 0.12 μM, about 0.13 μM, about 0.14 μM, about 0.15 μM, about 0.16 μM, about 0.17 μM, about 0.18 μM, about 0.19 μM, about 0.2 μM, about 0.21 μM, about 0.22 μM, about In some examples, the method comprises contacting the insulin-positive endocrine cells with a thyroid hormone signaling pathway activator (e.g., GC-1) at a concentration such as about 0.7 μM-1.3 μM, about 0.8 μM-1.2 μM, or about 0.9 μM-1.1 μM. In some examples, the method includes contacting the insulin-positive endocrine cells with a concentration of a thyroid hormone signaling pathway activator (eg, GC-1), such as about 1 μM.

[0322] Any BMP signaling pathway inhibitor that can induce insulin-positive endocrine cells to differentiate and mature into SC-β cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the BMP signaling pathway inhibitor includes LDN193189 or DMH-1. In some examples, the method includes contacting the insulin-positive endocrine cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 30 nM, about 40 nM, about 50 nM, about 60 nM, about 70 nM, about 80 nM, about 90 nM, about 100 nM, about 110 nM, about 120 nM, about 130 nM, about 140 nM, about 150 nM, about 160 nM, about 170 nM, about 180 nM, about 190 nM, about 200 nM, about 210 nM, about 220 nM, about 230 nM, about 240 nM, about 250 nM, about 280 nM, about 300 nM, about 400 nM, about 500 nM, or about 1 μM. In some instances, the method comprises contacting insulin-positive endocrine cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 70 nM-130 nM, about 80 nM-120 nM, or about 90 nM-110 nM. In some instances, the method comprises contacting NKX6.1-positive pancreatic progenitor cells with a concentration of a BMP signaling pathway inhibitor (e.g., LDN1931189), such as about 100 nM.

[0323] Any ROCK inhibitor that can induce insulin-positive endocrine cells to differentiate and mature into SC-β cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, ROCK inhibitors include Thiazovivin, Y-27632, Fasudil / HA1077, or H-1152. In some embodiments, ROCK inhibitors include Y-27632. In some embodiments, ROCK inhibitors include Thiazovivin. In some examples, the method comprises treating insulin-positive endocrine cells with a concentration of, for example, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 11 μM, about 12 μM, about 13 μM, about 14 μM, about 15 μM, about 16 μM, about 17 μM, about 18 μM, about 19 μM, about 20 μM, about 21 μM, about 22 μM, about 23 μM, about 24 μM, about 25 μM, about 26 μM, about 27 μM, about 28 μM, about 29 μM, about 30 μM, about 31 μM, about 32 μM, about 33 μM, about 34 μM, about 35 μM, about 36 μM, about 37 μM, about 38 μM, about 39 μM, about 40 μM, about 41 μM, about 42 μM, about 43 μM, about 44 μM, about 45 μM, about 46 μM, about 47 μM, about 48 μM, about 49 μM, about 50 μM, about 51 μM, about 52 μM, about 53 μM, about 54 μM, about 55 μM, about 56 μM, about 57 μM, about 58 μM, about 59 μM, about 60 μM, about 61 μM, about 62 μM, about 63 μM, about 64 μM, about 65 μM, about 66 μM, about In some embodiments, the method comprises contacting the insulin-positive endocrine cells with a ROCK inhibitor (e.g., Y-27632 or Thiazovivin) at a concentration of about 2.2 μM, about 2.8 μM, about 2.3 μM-2.7 μM or about 2.4 μM-2.6 μM. In some embodiments, the ROCK inhibitor comprises Thiazovivin. In some examples, the method includes contacting the insulin-positive endocrine cells with a ROCK inhibitor (eg, Y-27632 or Thiazovivin) at a concentration, such as about 2.5 μM.

[0324] Any epigenetic modification compound that can induce insulin-positive endocrine cell differentiation to mature into SC-β cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the epigenetic modification compound includes a histone methyltransferase inhibitor or an HDAC inhibitor. In some embodiments, the epigenetic modification compound includes a histone methyltransferase inhibitor, e.g., DZNep. In some embodiments, the epigenetic modification compound includes an HDAC inhibitor, e.g., KD5170. In some examples, the method comprises contacting insulin-positive endocrine cells with a concentration of an epigenetic modifying compound (e.g., DZNep or KD5170) such as about 0.01 μM, about 0.025 μM, about 0.05 μM, about 0.075 μM, about 0.1 μM, about 0.15 μM, about 0.2 μM, about 0.5 μM, about 0.75 μM, about 1 μM, about 2 μM, about 3 μM, about 4 μM, about 5 μM, about 6 μM, about 7 μM, about 7.5 μM, about 8 μM, about 9 μM, about 10 μM, about 15 μM, about 20 μM, about 25 μM, about 30 μM, about 35 μM, about 40 μM, about 50 μM, or about 100 μM to mature into SC-β cells. In some instances, the method includes contacting the insulin-positive endocrine cells with an epigenetic modification compound (e.g., DZNep or KD5170) at a concentration such as about 70 nM-130 nM, about 80 nM-120 nM, or about 90 nM-110 nM to mature into SC-β cells. In some instances, the method includes contacting the insulin-positive endocrine cells with an epigenetic modification compound (e.g., DZNep or KD5170) at a concentration such as about 100 nM to mature into SC-β cells.

[0325] Any protein kinase inhibitor that can induce differentiation of insulin-positive endocrine cells to mature into SC-β cells can be used (e.g., alone or in combination with any one of a TGF-β signaling pathway inhibitor and / or a thyroid hormone signaling pathway activator). In some embodiments, the protein kinase inhibitor includes staurosporine. In some examples, the method comprises treating insulin-positive endocrine cells with a concentration such as about 0.1 nM, about 0.2 nM, about 0.3 nM, about 0.4 nM, about 0.5 nM, about 0.6 nM, about 0.7 nM, about 0.8 nM, about 0.9 nM, about 1 nM, about 1.1 nM, about 1.2 nM, about 1.3 nM, about 1.4 nM, about 1.5 nM, about 1.6 nM, about 1.7 nM, about 1.8 nM, about 1.9 nM, about 2.0 nM, about 2.1 nM, about 2.2 nM, about 2.3 nM, about 2.4 nM, about The invention also provides methods for contacting the patient with a protein kinase inhibitor (e.g., staurosporine) at a concentration of about 2.5 nM, about 2.6 nM, about 2.7 nM, about 2.8 μM, about 2.9 nM, about 3 nM, about 3.1 nM, about 3.2 nM, about 3.3 nM, about 3.4 nM, about 3.5 nM, about 3.6 nM, about 3.7 nM, about 3.8 nM, about 3.9 nM, about 4.0 nM, about 4.1 nM, about 4.2 nM, about 4.3 nM, about 4.4 nM, about 4.5 nM, about 4.6 nM, about 4.7 nM, about 4.8 μM, about 4.9 nM, or about 5 nM. In some instances, the method comprises contacting the insulin-positive endocrine cells with a concentration of a protein kinase inhibitor (e.g., staurosporine), such as about 1 nM to 5 nM, about 2 nM to 4 nM, or about 2.5 nM to 3.5 nM. In some instances, the method comprises contacting the insulin-positive endocrine cells with a concentration of a protein kinase inhibitor (e.g., staurosporine), such as about 3 nM.

[0326] In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive, ISL1-positive, insulin-positive cells) with one or more metabolites. In some embodiments, the method comprises contacting a cell population (e.g., NKX6.1-positive, ISL1-positive, insulin-positive cells) with one or more of acetyl-CoA-related metabolites, vitamins, histone deacetylase inhibitors (HDACi), redox homeostasis regulators, single-carbon metabolic pathway intermediates, glutamate, and / or carnitine. Examples of metabolites include taurine, acetate, β-hydroxybutyrate, biotin, carnitine, glutamate, and formate.

[0327] In some embodiments, the compositions of the present disclosure (e.g., culture medium) comprise acetyl-CoA-related metabolites. Exemplary acetyl-CoA-related metabolites include, but are not limited to, acetate, pyruvate, ketogenic amino acids, valine, leucine, isoleucine, phenylalanine, tyrosine, lysine, tryptophan, fatty acids, coenzyme A, isovaleryl-CoA, and β-hydroxybutyrate. In some embodiments, the acetyl-CoA-related metabolite is acetate. In some embodiments, an acetyl-CoA related metabolite is present in or added to a composition of the present disclosure at a concentration of about 10 nM, about 50 nM, about 80 nM, about 100 nM, about 120 nM, about 140 nM, about 150 nM, about 200 nM, about 300 nM, about 500 nM, about 800 nM, about 1 μM, about 10 μM, about 100 μM, about 500 μM, about 800 μM, about 900 μM, about 1 mM, about 2 mM, about 3 mM, about 5 mM, or about 10 mM. In some embodiments, the acetyl-CoA related metabolite is present in or added to the compositions of the present disclosure at a concentration of about 0.01-50 mM, 0.1-50 mM, 0.5-50 mM, 0.01-20 mM, 0.1-20 mM, 0.5-20 mM, 0.01-10 mM, 0.1-10 mM, 0.5-10 mM, 0.8-25 mM, 0.8-10 mM, 0.8-5 mM, 0.8-2 mM, 0.8-1.5 mM, 0.8-1.2 mM, 0.9-1.1 mM, or 0.95-1.05 mM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 1 mM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 50 nM-1000 nM, 50 nM-800 nM, 50 nM-500 nM, 50 nM-300 nM, 50 nM-250 nM, 100 nM-200 nM, or 125 nM-175 nM. In some embodiments, the acetyl-CoA related metabolite is acetate present at a concentration of about 160 nM.

[0328] In some embodiments, the compositions of the present disclosure (e.g., culture medium) include one or more vitamins. Exemplary vitamins include, but are not limited to, biotin, vitamin B1 (thiamine), vitamin B2 (riboflavin), vitamin B3 (niacin), vitamin B6 (pyridoxine), and vitamin B12 (cyanocobalamin). In some embodiments, vitamins regulate fatty acid synthesis. In some embodiments, vitamins regulate branched-chain amino acid metabolism. In some embodiments, vitamins regulate or participate in the TCA cycle as cofactors, for example, as cofactors for pyruvate carboxylase. In some embodiments, the vitamin is biotin. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at the following concentrations: about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the vitamin is biotin present at a concentration of about 800 nM. In some embodiments, the vitamin is present in or added to the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, 2 100 nM to 100 μM, 100 nM to 800 nM, 100 nM to 600 nM, 50 nM to 400 nM, 50 nM to 300 nM, 50 nM to 200 nM, 100 nM to 500 μM, 100 nM to 100 μM, 100 nM to 1 μM, 100 nM to 800 nM, 100 nM to 600 nM, 50 nM to 400 nM, 100 nM to 300 nM, or 100 nM to 200 nM.

[0329] In some embodiments, the compositions of the present disclosure (e.g., culture medium) comprise a histone deacetylase inhibitor (HDACi). Exemplary histone deacetylase inhibitors (HDACi) include, but are not limited to, β-hydroxybutyric acid, butyric acid, Class I HDACi, Class IIA HDACi, Class IIB HDACi, Class III HDACi, Class IV HDACi, HDAC-1, HDAC-2, HDAC-3, HDAC-4, HDAC-5, HDAC-6, HDAC-7, HDAC-8, HDAC-9, HDAC-10, HDAC-11, sirtuin, SIRT1, SIRT2, SIRT3, S IRT4, SIRT5, SIRT6, SIRT7, Vorinostat (suberoylanilide hydroxamic acid, SAHA, MK0683), Entinostat (MS-275, SNDX-275), Panobinostat (LBH589, NVP-LBH589), Trichostatin A (TSA), Motinostat (MGCD0103, MG0103), GSK3117391 (GSK3117391A, HDAC-IN-3), BRD3308, BRD3308, Tubastatin ATFA (Tubastatin A trifluoroacetate), Tubastatin A, SIS17, NKL 22, BML-210 (CAY10433), TC-H 106, SR-4370, belinostat (PXD101, NSC726630, PX-105684), romidipine (FK228, depsipeptide, FR 901228, NSC 630176), MC1568, givisostat (ITF2357), dacistat (LAQ824, NVP-LAQ824), CUDC-101, quinostat (JNJ-26481585), Pracinostat (SB939), PCI-34051, droxinostat (NS 41080), Abexostat (PCI-24781), Abexostat (PCI-24781, CRA-024781), RGFP966, AR-42 (HDAC-42), Ricolinostat (ACY-1215, Rosininostat), Valproate Sodium Salt (Sodium Valproate), Tasildinaline (CI994, PD-123654, GOE-5549, Acetyldinaline), Feminostat (CUDC-907), Sodium Butyrate (NaB), Curcumin, Diferuloylmethane, M344, Tubacin, RG2833 (RGFP109), RG2833 (RGFP109), Reminostat (RAS2410), Divalproex Sodium, Scriptaid (GCK 1026), Sodium Phenylbutyrate, Sinapic Acid (Sinapicacid), TMP269, Santacruzamate A (CAY10683), TMP195 (TFMO2), valproic acid (VPA), UF010, tasquinimod (ABR-215050), SKLB-23bb, isoguanosine, sulforaphane, BRD73954, citarinostat (ACY-241, HDAC-IN-2), suberoxime, splitomicin, HPOB, LMK-235, biphenyl-4-sulfonyl Chloro (p-phenylbenzenesulfonyl, 4-phenylbenzenesulfonyl, p-biphenylsulfonyl), NexturastatA, TH34, Chidamide tablets (Chidamide, HBI-8000, CS-055), (-)-parthenolide, WT161, CAY10603, CAY10603, ACY-738, cyperus rotundus A, tenomustine (EDO-S101), Domatinostat (4SC-202) and BG45. In some embodiments, the HDACi is β-hydroxybutyric acid. In some embodiments, the HDACi is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 300 nM, about 500 nM, about 600 nM, about 700 nM, about 800 nM, about 900 nM, about 1 μM, about 1.5 μM, about 3 μM, about 5 μM, about 10 μM, or about 100 μM. In some embodiments, the HDACi is β-hydroxybutyrate present at a concentration of about 200 nM. In some embodiments, the HDACi is present in or added to the compositions of the present disclosure at a concentration of about 1 nM to 500 μM, 1 nM to 100 μM, 1 nM to 10 μM, 1 nM to 1 μM, 1 nM to 800 nM, 1 nM to 600 nM, 1 nM to 400 nM, 1 nM to 300 nM, 1 nM to 200 nM, 25 nM to 500 μM, 25 nM to 100 μM, 25 nM to 10 μM, 25 nM to 1 μM, 25 nM to 800 nM, 25 nM to 600 nM, 25 nM to 400 nM, 25 nM to 300 nM, In some embodiments, the present invention relates to an aqueous solution of at least one amino acid sequence of the present invention. The aqueous solution of the present invention may be selected from the group consisting of 25nM to 200nM, 50nM to 500μM, 50nM to 100μM, 50nM to 10μM, 50nM to 1μM, 50nM to 800nM, 50nM to 600nM, 50nM to 400nM, 50nM to 300nM, 50nM to 200nM, 100nM to 500μM, 100nM to 100μM, 100nM to 10μM, 100nM to 1μM, 100nM to 800nM, 100nM to 600nM, 100nM to 400nM, 100nM to 300nM, or 100nM to 200nM.

[0330] In some embodiments, the compositions of the present disclosure (e.g., culture medium) include a redox homeostasis regulator. Exemplary redox homeostasis regulators include, but are not limited to, taurine, respiratory chain regulators, free radical scavengers, mitochondrial protein synthesis regulators, allium sulfur compounds, anthocyanidins, beta-carotene, catechins, copper, cryptoxanthins, flavonoids, indoles, isoflavones, lignans, lutein, lycopene, alpha lipoic acid, ellagic acid, manganese, polyphenols, selenium, glutathione, vitamin A, vitamin C, vitamin E, zinc, superoxide dismutase, GSHPx, Prx-I, catalase, and coenzyme Q10. In some embodiments, the redox homeostasis regulator is taurine. In some embodiments, the redox homeostasis regulator is present in or added to the compositions of the present disclosure at a concentration of about 100 nM, about 500 nM, 1 μM, about 10 μM, about 20 μM, about 30 μM, about 40 μM, about 50 μM, about 60 μM, about 70 μ...

Claims

1. A mammalian cell that has been genetically engineered to have reduced or no expression of the renalase gene, and wherein the cell has also been genetically engineered to have, compared to the expression level of the same cell type that has not been genetically engineered: a) Reduced or no expression of the ABO gene; b) Reduced or no expression of the CXCL10 gene; c) Reduced or no expression of the β-2 microglobulin (B2M) gene; d) Reduced or no expression of the tissue factor (F3) gene; and / or e) Increased expression of CD47 or expression of mutant CD47.

2. The cell according to claim 1, wherein the cell has been genetically engineered to have reduced or no expression of the ABO gene compared to the expression level of the same cell type that has not been genetically engineered.

3. The cell according to claim 1 or 2, wherein the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene compared to the expression level of the same cell type that has not been genetically engineered.

4. The cell according to any one of claims 1-3, wherein the cell has been genetically engineered to have reduced or no expression of the B2M gene compared to the expression level of the same cell type that has not been genetically engineered.

5. The cell according to any one of claims 1-4, wherein the cell has been genetically engineered to have reduced or no expression of the F3 gene compared to the expression level of the same cell type that has not been genetically engineered.

6. The cell according to any one of claims 1-5, wherein the cell has been genetically engineered to have increased expression of CD47 compared to the expression level of the same cell type that has not been genetically engineered.

7. The cell according to claim 6, wherein the cell contains an insertion of an exogenous CD47 gene.

8. The cell according to any one of claims 1-5, wherein the cell has been genetically engineered to express mutant CD47.

9. A mammalian cell that has been genetically engineered to have reduced or no expression of the CXCL10 gene, and wherein the cell has also been genetically engineered to have reduced or no expression of the following: a) The ABO gene; and / or b) The tissue factor (F3) gene.

10. The cell according to claim 9, wherein the cell has been genetically engineered to have reduced or no expression of the ABO gene compared to the expression level of the same cell type that has not been genetically engineered.

11. The cell according to claim 9 or 10, wherein the cell has been genetically engineered to have reduced or no expression of the tissue factor gene compared to the expression level of the same cell type that has not been genetically engineered.

12. The cell according to any one of claims 9-11, wherein the cell has been genetically engineered to have reduced or no expression of the β-2 microglobulin (B2M) gene compared to the expression level of the same cell type that has not been genetically engineered.

13. The cell according to any one of claims 9-12, wherein the cell has been genetically engineered to have a reduced or no expression of the renalase gene as compared to the expression level of the same cell type that has not been genetically engineered.

14. The cell according to any one of claims 9-13, wherein the cell has been genetically engineered to have an increased expression of CD47 as compared to the expression level of the same cell type that has not been genetically engineered.

15. The cell according to claim 14, wherein the cell comprises an insertion of an exogenous CD47 gene.

16. The cell according to any one of claims 9-13, wherein the cell has been genetically engineered to express a mutant CD47 protein.

17. The cell according to any one of claims 1-16, wherein the cell has been genetically engineered to: a) have a reduced or no expression of the B2M, CXCL10, renalase, ABO, and F3 genes, and b) have an increased expression of CD47, as compared to the expression level of the same cell type that has not been genetically engineered.

18. The cell according to any one of claims 1-16, wherein the cell has been genetically engineered to: a) have a reduced or no expression of the B2M, CXCL10, renalase, ABO, and F3 genes, and b) express mutant CD47, as compared to the expression level of the same cell type that has not been genetically engineered.

19. The cell according to claim 8, 16, or 18, wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

20. The cell according to claim 8, 16, or 18, wherein the mutant CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, but wherein the Q at position 1 is replaced by at least 3 amino acids.

21. The cell according to claim 20, wherein the Q at position 1 is replaced by any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP, and WQM.

22. The cell according to claim 20 or 21, wherein the cell comprises a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein having at least three amino acids added between the start of the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the start of the mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146).

23. The cell according to claim 20 or 21, wherein the cell comprises a gene encoding the CD47 protein, and wherein the gene encodes a CD47 protein in which the "Q" at the position corresponding to position 19 of an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 14 or 243 is replaced by at least three amino acids.

24. The cell according to claim 22 or 23, wherein the at least three amino acids are selected from any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP or WQM.

25. The cell according to claim 24, wherein the at least three amino acids are WQPP.

26. The cell according to claim 21, wherein the Q at position 1 is replaced by WQPP.

27. The cell according to claim 20, wherein the at least three amino acids comprise the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M.

28. The mammalian cell according to claim 19, wherein the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, and wherein the 3 added amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M.

29. The mammalian cell according to claim 19 or 28, wherein the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP and WQM.

30. A mammalian cell, wherein the cell is of ABO blood type O, and wherein the cell has been genetically engineered to: a) have reduced or no expression of the renalase gene and / or the CXCL10 gene; and / or b) express a mutant CD47 protein.

31. The cell according to claim 30, wherein the cell has been genetically engineered to have, as compared to the expression level of the same cell type that has not been genetically engineered: a) reduced or no expression of B2M, CXCL10, renalase and F3 genes, and b) increased expression of CD47.

32. A mammalian cell, wherein the cell expresses a membrane-bound CD47 protein, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, and wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M.

33. The cell according to claim 32, wherein the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the added 3 amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A and G; and X1 is selected from R, P, L, T, F, I and M.

34. The cell according to claim 32 or 33, wherein the three amino acids are selected from WQR, WAP, WQL, WQP, WQT, WQF, WQI, WGP and WQM.

35. A mammalian cell, wherein the cell expresses a membrane-bound CD47 protein, wherein the CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 145 or 146, but wherein the Q at position 1 is replaced by at least 3 amino acids.

36. The cell according to claim 35, wherein the Q at position 1 is replaced by any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP and WQM.

37. The cell according to claim 35 or 36, wherein the cell comprises a gene encoding a mutant CD47 protein, wherein the gene encodes a CD47 protein with at least three amino acids added between the start of the CD47 leader sequence (e.g., the amino acid sequence of SEQ ID NO: 244) and the start of the mature CD47 amino acid sequence (e.g., an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO: 145 or 146).

38. The cell according to claim 35 or 36, wherein the cell comprises a gene encoding the mutant CD47 protein, wherein the gene encodes a CD47 protein in which the "Q" at position 19 corresponding to a position that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the amino acid sequence of SEQ ID NO: 14 or 243 is replaced by at least three amino acids.

39. The cell according to claim 37 or 38, wherein the at least three amino acids are selected from any one of WQR, WAP, WQL, WQP, WQPP, WQT, WQF, WQI, WGP or WQM.

40. The cell according to claim 39, wherein the at least three amino acids are WQPP.

41. The cell according to claim 36, wherein Q at position 1 is replaced by WQPP.

42. The cell according to claim 35, wherein the at least three amino acids comprise the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

43. The cell according to any one of claims 32-42, wherein the cell has been genetically engineered to have reduced or no expression of the B2M gene.

44. The cell according to any one of claims 32-43, wherein the cell has been genetically engineered to have reduced or no expression of the F3 gene.

45. The cell according to any one of claims 32-44, wherein the cell has been genetically engineered to have reduced or no expression of the CXCL10 gene.

46. The cell according to any one of claims 32-45, wherein the cell has been genetically engineered to have reduced or no expression of the renin gene.

47. The cell according to any one of claims 32-46, wherein the cell is of ABO blood type O.

48. The cell according to claim 47, wherein the cell has been genetically engineered to have reduced or no expression of the ABO gene.

49. The cell according to claim 47, wherein the cell is a natural ABO blood type O cell.

50. The cell according to any one of claims 32-49, wherein the transgene encoding the CD47 protein is inserted into the genome of the cell such that the expression of the CD47 transgene is bundled with the expression of an endogenous target gene in the cell.

51. The cell according to any one of claims 32-49, wherein the endogenous target gene is a housekeeping gene, such as ACTB, NANOG, or GAPDH.

52. The cell according to claim 51, wherein the transgene is inserted in such a way that the 3'UTR of the housekeeping gene (e.g., the 3'UTR of the GAPDH gene) is intact.

53. The cell according to any one of claims 32-49, wherein the endogenous CD47 gene of the cell is mutated such that the cell expresses a CD47 protein comprising an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the sequence of SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises at least 3 amino acids added to the N-terminus of the mature CD47 protein, wherein the 3 added amino acids have the formula X3-X2-X1, wherein X3 is W; X2 is selected from Q, A, and G; and X1 is selected from R, P, L, T, F, I, and M.

54. The cell according to any one of claims 32 - 53, wherein the CD47 protein comprises an amino acid sequence that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence of SEQ ID NO: 245, 162 or 163.

55. The cell according to any one of the preceding claims, wherein the cell is a stem cell.

56. The cell according to any one of the preceding claims, wherein the cell is a pluripotent stem cell (PSC), an embryonic stem cell (ESC), an induced pluripotent stem cell (iPSC) or an embryonic germ stem cell (EGSC).

57. The cell according to any one of claims 1 - 54, wherein the cell is differentiated from a pluripotent stem cell.

58. The cell according to any one of claims 1 - 54, wherein the cell is a somatic cell.

59. The cell according to any one of claims 1 - 54, wherein the cell is a definitive endoderm cell.

60. The cell according to any one of claims 1 - 54, wherein the cell is a primitive gut tube cell.

61. The cell according to any one of claims 1 - 54, wherein the cell is a PDX1 - positive pancreatic progenitor cell.

62. The cell according to any one of claims 1 - 54, wherein the cell is an NKX6.1 - positive pancreatic progenitor cell.

63. The cell according to any one of claims 1 - 54, wherein the cell is an Ngn3 - positive endocrine progenitor cell.

64. The cell according to any one of claims 1 - 54, wherein the cell is an insulin - positive endocrine cell.

65. The cell according to any one of claims 1 - 54, wherein the cell is a pancreatic SC - β cell.

66. The cell according to any one of claims 1 - 54, wherein the cell is NKX6.1 - positive.

67. The cell according to claim 66, wherein the cell is ISL1 - negative.

68. The cell according to any one of claims 1 - 54, wherein the cell is NKX6.1 - positive and ISL1 - positive.

69. The cell according to any one of claims 1 - 54, wherein the cell is NKX6.1 - negative and ISL1 - negative.

70. The cell according to any one of claims 1 - 53, wherein the cell is ISL1 - positive.

71. The cell according to claim 70, wherein the cell is NKX6.1 - negative.

72. The cell according to any one of the preceding claims, wherein the genetic manipulation is performed using CRISPR / Cas, piggybac transposon, TALEN, zinc finger technology, homing endonuclease or meganuclease.

73. The cell according to any one of the preceding claims, wherein at least one genetic modification is made in the intron region of the gene.

74. A cell according to any one of the preceding claims, wherein at least one genetic modification has been made in an exon of said gene.

75. A cell according to any one of the preceding claims, wherein at least one genetic modification has been made in a promoter of said gene.

76. A cell according to any one of the preceding claims, wherein the mammalian cell has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5, and wherein the cell has also been genetically engineered to have, as compared to the expression level of the same cell type that has not been genetically engineered: a) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1; b) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7; c) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9; d) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:11; and / or e) increased expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:

15.

77. A mammalian cell that has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:7, and wherein the cell has also been genetically engineered to contain, as compared to the expression level of the same cell type that has not been genetically engineered: a) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:1; and / or b) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:

11.

78. The mammalian cell according to claim 77, wherein the mammalian cell has also been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9 as compared to the expression level of the same cell type that has not been genetically engineered.

79. The cell according to any one of claims 77-78, wherein the cell has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5 as compared to the expression level of the same cell type that has not been genetically engineered.

80. The cell according to any one of claims 77-79, wherein the cell has been genetically engineered to have increased expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15 as compared to the expression level of the same cell type that has not been genetically engineered.

81. The cell according to any one of claims 76-80, wherein the cell has been genetically engineered to: a) have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, SEQ ID NO:7, SEQ ID NO:1 and SEQ ID NO:11; b) have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5; and c) have increased expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:15 as compared to the expression level of the same cell type that has not been genetically engineered.

82. A mammalian cell, wherein the cell is of ABO blood type O and has been genetically engineered to have reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3, SEQ ID NO:5 and / or SEQ ID NO:7 as compared to the expression level of the same cell type that has not been genetically engineered.

83. The cell according to claim 82, wherein the cell has been genetically engineered to have, as compared to the expression level of the same cell type that has not been genetically engineered: a) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:9, SEQ ID NO:7 and SEQ ID NO:11; b) reduced or no expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:3 and / or SEQ ID NO:5; and c) increased expression of a protein encoded by a nucleic acid that is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to SEQ ID NO:13 and / or SEQ ID NO:

15.

84. A mammalian cell that has been genetically engineered to have reduced or no expression of a protein encoded by the renin enzyme gene, and wherein the cell has also been genetically engineered to have, as compared to the protein expression level of the same cell type that has not been genetically engineered: a) reduced or no expression of a protein encoded by the ABO gene; b) reduced or no expression of a protein encoded by the CXCL10 gene; c) reduced or no expression of a protein encoded by the beta-2 microglobulin (B2M) gene; d) reduced or no expression of a protein encoded by the tissue factor (F3) gene; and / or e) increased expression of a protein encoded by the CD47 gene.

85. A cell according to any one of claims 8, 16, 18, 19, 28 - 30, 32 - 34, and 43 - 83, wherein the CD47 protein comprises an amino acid sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 145 or 146, and wherein the CD47 protein comprises a substitution at one or more amino acid positions corresponding to amino acid positions Q1, L3, A53, and L54 of SEQ ID NO: 145 or 146.

86. A cell according to claim 85, wherein the CD47 protein comprises P or L at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

87. A cell according to claim 85, wherein the CD47 protein comprises R, A, K, N, E, or V at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146.

88. A cell according to claim 85, wherein the CD47 protein comprises W, Y, D, Q, or V at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146.

89. A cell according to claim 85, wherein the CD47 protein comprises A, I, K, M, E, W, S, or V at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146.

90. A cell according to claim 85, wherein the CD47 protein comprises P at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

91. A cell according to claim 85, wherein the CD47 comprises an amino acid other than Q at the amino acid position corresponding to position 1 of SEQ ID NO: 145 or 146.

92. A cell according to claim 85, wherein the CD47 comprises an amino acid other than L at the amino acid position corresponding to position 3 of SEQ ID NO: 145 or 146.

93. A cell according to claim 85, wherein the CD47 comprises an amino acid other than A at the amino acid position corresponding to position 53 of SEQ ID NO: 145 or 146.

94. A cell according to claim 85, wherein the CD47 comprises an amino acid other than L at the amino acid position corresponding to position 54 of SEQ ID NO: 145 or 146.

95. A cell according to any one of claims 1 - 94, wherein the CD47 protein is membrane - bound.

96. A composition comprising one or more cells according to any one of claims 1 - 95.

97. A composition according to claim 96, wherein the composition comprises more than one non - natural cell; wherein: a) at least 30% of the cells in the composition are NKX6.1 - positive, ISL1 - positive cells; b) At least 25% of the cells in the composition are NKX6.1-negative and ISL1-positive cells; c) There are more NKX6.1-positive and ISL1-positive cells than NKX6.1-negative and ISL1-positive cells in the composition; d) i) Less than 12% of the cells in the composition are NKX6.1-negative and ISL1-negative cells; and / or ii) 9%-25% of the cells in the composition are NKX6.1-positive and ISL1-negative cells; and e) Less than 40% of the cells in the composition are VMAT1-positive cells.

98. A method of administering the composition according to claim 96 or 97 to a subject.

99. The method according to claim 98, wherein the subject has diabetes.

Citation Information

Patent Citations

  • a CONNECTOR FOR FEEDING ELECTRICAL CURRENT IN A TOOL LOCATED IN A DRILLING OR OIL WELL

    AR014418A1

  • annular gap magnet system

    FR901228A

  • High affinity CD47 analogs

    US10358472B2

  • Hedgehog antagonists, methods and uses related thereto

    US20040060568A1

  • Use of compounds that interfere with the Hedgehog signaling pathway for the manufacture of a medicament for preventing, inhibiting, and / or reversing ocular diseases related with ocular neovascularization

    US20060276391A1