Method for producing nucleic acid molecule

Abstract

The present disclosure provides a method for producing a nucleic acid molecule. In detail, the present disclosure achieves a shortening of the process and a significant increase in efficiency in ligation using a nucleic acid splint. Namely, the present disclosure is a method for producing a polynucleotide molecule having a specific sequence, the method comprising: 1) a step for providing two or more polynucleotide fragment molecules comprising a portion of the specific sequence; and 2) a step for linking the two or more polynucleotide fragment molecules in the presence of two or more nucleic acid splints that are substantially complementary to the polynucleotide molecules, in which the specific sequence is configured by integrating the sequences of the two or more polynucleotide fragment molecules. At least two nucleic acid splints of the nucleic acid splints include sequences that are substantially free of deletion when aligned with the specific sequence.

Description

Technical Field

[0001] The present disclosure relates to a ligation reaction for synthesizing a long-chain oligonucleotide or polynucleotide or a modified form thereof and its applications. Background Art

[0002] In genetic engineering, cleavage and ligation of DNA are one of the most important basic methods, and there are various methods. In addition, cleavage and ligation of RNA are also one of the important basic methods, and there are various methods. Summary of the Invention

[0003] Problems to be Solved by the Invention

[0004] The present disclosure has achieved shortening of the process and a significant improvement in efficiency in ligation by using a nucleic acid splint. That is, the present disclosure has found that in a nucleic acid ligation reaction, by adding two or more nucleic acid splints having a complementary sequence to the nucleic acid, deletions can be substantially eliminated, and the ligation efficiency between the 3'-end side and the 5'-end side of the nucleic acid can be significantly improved.

[0005] The present invention provides, for example, the following items.

[0006] (Item 1)

[0007] A method for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0008] 1) a step of providing two or more polynucleotide fragment molecules each containing a part of the specific sequence; and 2) a step of ligating the two or more polynucleotide fragment molecules in the presence of two or more nucleic acid splints,

[0009] wherein,

[0010] the set of each sequence of the two or more polynucleotide fragment molecules constitutes the specific sequence,

[0011] the nucleic acid splint is substantially complementary to the polynucleotide molecule,

[0012] at least two of the nucleic acid splints contain a sequence that is substantially free of deletions when aligned with the specific sequence.

[0013] (Item 2A)

[0014] The method according to any one of the foregoing items, wherein three or more of the polynucleotide fragment molecules used are present.

[0015] (Item 2B)

[0016] The method according to any one of the foregoing items, wherein four or more of the polynucleotide fragment molecules used are present.

[0017] (Item 2C)

[0018] The method according to any one of the preceding items, wherein there are more than 5 polynucleotide fragment molecules used.

[0019] (Item 2D)

[0020] The method according to any one of the preceding items, wherein there are more than 10 polynucleotide fragment molecules used.

[0021] (Item 2E)

[0022] The method according to any one of the preceding items, wherein there are 50 or less polynucleotide fragment molecules used.

[0023] (Item 2AA)

[0024] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0025] (Item 2AB)

[0026] The method according to any one of the preceding items, wherein the modification includes halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkoxy groups, etc.) or unsubstituted alkyl groups (such as methyl), nucleic acids or modified nucleic acids (such as BNA, LNA), phosphorothioate, etc.

[0027] (Item 2AC)

[0028] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is a monophosphate.

[0029] (Item 2AD)

[0030] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0031] (Item 2AE)

[0032] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis.

[0033] (Item 2AF)

[0034] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis.

[0035] (Item 2AG)

[0036] The method according to any one of the foregoing items, wherein the method comprises providing the polynucleotide fragment molecule by transcription synthesis, and comprises monophosphorylating the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0037] (Item 3)

[0038] The method according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by more than 8 mers.

[0039] (Item 4)

[0040] The method according to any one of the foregoing items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0041] (Item 5)

[0042] The method according to any one of the foregoing items, wherein the deletion is 2 bases or less.

[0043] (Item 6A)

[0044] The method according to any one of the foregoing items, wherein the nucleic acid splint is 10 mers to 50 mers.

[0045] (Item 6B)

[0046] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is 10 mers to 50 mers.

[0047] (Item 7)

[0048] The method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule.

[0049] (Item 7A)

[0050] The method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule by 2 to 8 mers or more.

[0051] (Item 7B)

[0052] The method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule by 5 mers or more.

[0053] (Item 7C)

[0054] The method according to any one of the preceding items, wherein the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by more than one base when aligned with the specific sequence.

[0055] (Item 8)

[0056] The method according to any one of the preceding items, wherein at least one end of the polynucleotide fragment molecule has a vector and a bond.

[0057] (Item 9)

[0058] The method according to any one of the preceding items, wherein the vector is polystyrene, CPG (Controlled pore glass), or magnetic beads.

[0059] (Item 9A)

[0060] The method according to any one of the preceding items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0061] (Item 9B)

[0062] The method according to any one of the preceding items, wherein the enzymatic ligation reactions are carried out simultaneously or not simultaneously.

[0063] (Item 9C)

[0064] The method according to any one of the preceding items, wherein the enzymatic ligation reactions are carried out simultaneously.

[0065] (Item 9D)

[0066] The method according to any one of the preceding items, characterized in that in the enzymatic ligation reaction, (A) after performing a single ligation reaction with a combination of the polynucleotide fragment molecule that is shorter than the specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0067] (Item 9E)

[0068] The method according to any one of the preceding items, wherein the combination is such that the total extension is 175 - 200 mer.

[0069] (Item 10)

[0070] A polynucleotide molecule produced by the method according to any one of the preceding items.

[0071] <Kit>

[0072] (Project A1)

[0073] A kit for producing a polynucleotide molecule having a specific sequence, comprising:

[0074] 1) More than two polynucleotide fragment molecules each containing a part of the specific sequence, and

[0075] 2) More than two nucleic acid splints,

[0076] The assembly of the sequences of the more than two polynucleotide fragment molecules constitutes the specific sequence,

[0077] The nucleic acid splint is substantially complementary to the polynucleotide molecule,

[0078] At least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

[0079] (Project A1A)

[0080] The kit according to any one of the preceding items, wherein there are more than 3 polynucleotide fragment molecules used.

[0081] (Project A1B)

[0082] The kit according to any one of the preceding items, wherein there are more than 4 polynucleotide fragment molecules used.

[0083] (Project A1C)

[0084] The kit according to any one of the preceding items, wherein there are more than 5 polynucleotide fragment molecules used.

[0085] (Project A1D)

[0086] The kit according to any one of the preceding items, wherein there are more than 10 polynucleotide fragment molecules used.

[0087] (Project A1E)

[0088] The kit according to any one of the preceding items, wherein there are 50 or fewer polynucleotide fragment molecules used.

[0089] (Project A1AA)

[0090] The kit according to any one of the preceding items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0091] (Project A1AB)

[0092] The kit according to any one of the foregoing items, wherein the modification includes halogenated (fluorine, chlorine, iodine, etc.), substituted (including alkoxy, etc.) or unsubstituted alkyl (such as methyl), nucleic acid or modified nucleic acid (such as BNA, LNA), phosphorothioate, etc.

[0093] (Item A1AC)

[0094] The kit according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate.

[0095] (Item A1AD)

[0096] The kit according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0097] (Item A1AE)

[0098] The kit according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by at least one kit selected from the group consisting of chemical synthesis and transcription synthesis.

[0099] (Item A1AF)

[0100] The kit according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis kits.

[0101] (Item A1AG)

[0102] The kit according to any one of the foregoing items, wherein the method includes providing the polynucleotide fragment molecule by transcription synthesis and includes monophosphorylating the 5'-end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0103] (Item A2)

[0104] The kit according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

[0105] (Item A3)

[0106] The kit according to any one of the foregoing items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the adjacent nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0107] (Item A4)

[0108] The kit according to any one of the foregoing items, wherein the deletion is less than 2 bases.

[0109] (Item A5)

[0110] The kit according to any one of the foregoing items, wherein the nucleic acid splint is 10mer to 50mer.

[0111] (Item A6)

[0112] The kit according to any one of the foregoing items, wherein the polynucleotide fragment molecule is 10mer to 50mer.

[0113] (Item A7)

[0114] The kit according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule.

[0115] (Item A7A)

[0116] The kit according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule by 2 to 8mer or more.

[0117] (Item A7B)

[0118] The kit according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule by 5mer or more.

[0119] (Item A7C)

[0120] The kit according to any one of the foregoing items, wherein the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by one or more bases when aligned with the specific sequence.

[0121] (Item A8)

[0122] The kit according to any one of the foregoing items, wherein at least one end of the polynucleotide fragment molecule has a carrier and a bond.

[0123] (Item A9)

[0124] The kit according to any one of the foregoing items, wherein the carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

[0125] (Item A9A)

[0126] The kit according to any one of the foregoing items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0127] (Item A9B)

[0128] The kit according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously or not simultaneously.

[0129] (Item A9C)

[0130] The kit according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously.

[0131] (Item A9D)

[0132] The kit according to any one of the foregoing items, characterized in that, in the enzymatic ligation reaction, (A) after carrying out a single ligation reaction with a combination of the polynucleotide fragment molecules that is shorter than a specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0133] (Item A9E)

[0134] The kit according to any one of the foregoing items, wherein the combination is such that the total extension becomes 175 - 200 mer.

[0135] <Material Provision>

[0136] (Item B1)

[0137] A method for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0138] A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence;

[0139] B) A step of designing two or more nucleic acid splints according to the specific sequence;

[0140] C) A step of providing the designed polynucleotide fragment molecules and nucleic acid splints; and

[0141] D) A step of ligating the designed polynucleotide fragment molecules in the presence of the designed nucleic acid splint,

[0142] wherein,

[0143] the collection of the sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence,

[0144] the nucleic acid splint is substantially complementary to the polynucleotide molecule,

[0145] At least two of the nucleic acid clamps in the nucleic acid clamp contain sequences that are substantially without deletion when aligned with the specific sequence.

[0146] (Item B2)

[0147] A method for producing a polypeptide fragment and a nucleic acid clamp for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0148] A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence;

[0149] B) A step of designing two or more nucleic acid clamps according to the specific sequence; and

[0150] C) A step of producing the designed polynucleotide fragment molecules and two or more nucleic acid clamps,

[0151] wherein,

[0152] The set of each sequence of the two or more polynucleotide fragment molecules constitutes the specific sequence,

[0153] The nucleic acid clamp is substantially complementary to the polynucleotide molecule,

[0154] At least two of the nucleic acid clamps in the nucleic acid clamp contain sequences that are substantially without deletion when aligned with the specific sequence.

[0155] (Item B2A)

[0156] According to the method described in any one of the foregoing items, wherein there are more than 3 polynucleotide fragment molecules used.

[0157] (Item B2B)

[0158] According to the method described in any one of the foregoing items, wherein there are more than 4 polynucleotide fragment molecules used.

[0159] (Item B2C)

[0160] According to the method described in any one of the foregoing items, wherein there are more than 5 polynucleotide fragment molecules used.

[0161] (Item B2D)

[0162] According to the method described in any one of the foregoing items, wherein there are more than 10 polynucleotide fragment molecules used.

[0163] (Item B2E)

[0164] The method according to any one of the foregoing items, wherein the number of polynucleotide fragment molecules used is less than 50.

[0165] (Item B2AA)

[0166] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0167] (Item B2AB)

[0168] The method according to any one of the foregoing items, wherein the modification includes halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkoxy, etc.) or unsubstituted alkyl (such as methyl), nucleic acid or modified nucleic acid (such as BNA, LNA), phosphorothioate, etc.

[0169] (Item B2AC)

[0170] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate.

[0171] (Item B2AD)

[0172] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0173] (Item B2AE)

[0174] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis.

[0175] (Item B2AF)

[0176] The method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis.

[0177] (Item B2AG)

[0178] The method according to any one of the foregoing items, wherein the method includes providing the polynucleotide fragment molecule by transcription synthesis and includes monophosphorylating the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0179] (Item B3)

[0180] The method according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

[0181] (Item B4)

[0182] The method according to any one of the preceding items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0183] (Item B5)

[0184] The method according to any one of the preceding items, wherein the deletion is 2 bases or less.

[0185] (Item B6)

[0186] The method according to any one of the preceding items, wherein the nucleic acid splint is 10mer to 50mer.

[0187] (Item B7)

[0188] The method according to any one of the preceding items, wherein the polynucleotide fragment molecule is 10mer to 50mer.

[0189] (Item B7-1)

[0190] The method according to any one of the preceding items, wherein the nucleic acid splint has a sequence protruding from the connection portion of the polynucleotide fragment molecule.

[0191] (Item B7A)

[0192] The method according to any one of the preceding items, wherein the nucleic acid splint has a sequence protruding 2 to 8mer or more from the connection portion of the polynucleotide fragment molecule.

[0193] (Item B7B)

[0194] The method according to any one of the preceding items, wherein the nucleic acid splint has a sequence protruding 5mer or more from the connection portion of the polynucleotide fragment molecule.

[0195] (Item B7C)

[0196] The method according to any one of the preceding items, wherein the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by one or more bases when aligned with the specific sequence.

[0197] (Item B8)

[0198] The method according to any one of the preceding items, wherein at least one end of the polynucleotide fragment molecule has a vector and a bond.

[0199] (Project B9)

[0200] The method according to any one of the foregoing items, wherein the carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

[0201] (Project B9A)

[0202] The method according to any one of the foregoing items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0203] (Project B9B)

[0204] The method according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously or not simultaneously.

[0205] (Project B9C)

[0206] The method according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously.

[0207] (Project B9D)

[0208] The method according to any one of the foregoing items, characterized in that in the enzymatic ligation reaction, (A) after performing a single ligation reaction with a combination of the polynucleotide fragment molecules that is shorter than a specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0209] (Project B9E)

[0210] The method according to any one of the foregoing items, wherein the combination is such that the total extension becomes 175 - 200 mer.

[0211] <Design Department>

[0212] (Project C1)

[0213] A design method for a polypeptide fragment and a nucleic acid splint for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0214] A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and

[0215] B) A step of designing two or more nucleic acid splints according to the specific sequence;

[0216] Wherein,

[0217] The set of the sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence,

[0218] The nucleic acid splint is substantially complementary to the polynucleotide molecule.

[0219] At least two nucleic acid splints in the nucleic acid splint contain sequences that are substantially without deletions when aligned with the specific sequence.

[0220] (Item C2A)

[0221] The design method according to any one of the foregoing items, wherein there are more than 3 polynucleotide fragment molecules used.

[0222] (Item C2B)

[0223] The design method according to any one of the foregoing items, wherein there are more than 4 polynucleotide fragment molecules used.

[0224] (Item C2C)

[0225] The design method according to any one of the foregoing items, wherein there are more than 5 polynucleotide fragment molecules used.

[0226] (Item C2D)

[0227] The design method according to any one of the foregoing items, wherein there are more than 10 polynucleotide fragment molecules used.

[0228] (Item C2E)

[0229] The design method according to any one of the foregoing items, wherein there are 50 or fewer polynucleotide fragment molecules used.

[0230] (Item C2AA)

[0231] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0232] (Item C2AB)

[0233] The design method according to any one of the foregoing items, wherein the modification includes halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkoxy groups, etc.) or unsubstituted alkyl groups (such as methyl), nucleic acids or modified nucleic acids (such as BNA, LNA), phosphorothioates, etc.

[0234] (Item C2AC)

[0235] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate.

[0236] (Project C2AD)

[0237] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0238] (Project C2AE)

[0239] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis.

[0240] (Project C2AF)

[0241] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis.

[0242] (Project C2AG)

[0243] The design method according to any one of the foregoing items, wherein the method includes that the polynucleotide fragment molecule is provided by transcription synthesis, and includes monophosphorylation of the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0244] (Project C2)

[0245] The design method according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

[0246] (Project C3)

[0247] The design method according to any one of the foregoing items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0248] (Project C4)

[0249] The design method according to any one of the foregoing items, wherein the deletion is 2 bases or less.

[0250] (Project C5)

[0251] The design method according to any one of the foregoing items, wherein the nucleic acid splint is 10 mers to 50 mers.

[0252] (Project C6)

[0253] The design method according to any one of the foregoing items, wherein the polynucleotide fragment molecule is 10 mers to 50 mers.

[0254] (Item C7)

[0255] The design method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule.

[0256] (Item C7A)

[0257] The design method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding 2 to 8 mers or more from the connecting portion of the polynucleotide fragment molecule.

[0258] (Item C7B)

[0259] The design method according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding 5 mers or more from the connecting portion of the polynucleotide fragment molecule.

[0260] (Item C7C)

[0261] The design method according to any one of the foregoing items, wherein the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by one or more bases when aligned with the specific sequence.

[0262] (Item C8)

[0263] The design method according to any one of the foregoing items, wherein at least one end of the polynucleotide fragment molecule has a vector and a bond.

[0264] (Item C9)

[0265] The design method according to any one of the foregoing items, wherein the vector is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

[0266] (Item C9A)

[0267] The design method according to any one of the foregoing items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0268] (Item C9B)

[0269] The design method according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously or not simultaneously.

[0270] (Item C9C)

[0271] The design method according to any one of the foregoing items, wherein the enzymatic ligation reactions are carried out simultaneously.

[0272] (Project C9D)

[0273] The design method according to any one of the foregoing items, characterized in that, in the enzyme ligation reaction, (A) after performing a single ligation reaction with a combination of the polynucleotide fragment molecules that is shorter than a specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0274] (Project C9E)

[0275] The design method according to any one of the foregoing items, wherein the combination is such that the total extension is 175 - 200 mer.

[0276] <Procedure>

[0277] (Project D1)

[0278] A program for causing a computer to execute a design method for producing a polypeptide fragment and a nucleic acid splint of a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0279] A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and

[0280] B) A step of designing two or more nucleic acid splints according to the specific sequence;

[0281] Wherein,

[0282] The set of sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence,

[0283] The nucleic acid splint is substantially complementary to the polynucleotide molecule,

[0284] At least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

[0285] (Project D2A)

[0286] The program according to any one of the foregoing items, wherein there are three or more polynucleotide fragment molecules used.

[0287] (Project D2B)

[0288] The program according to any one of the foregoing items, wherein there are four or more polynucleotide fragment molecules used.

[0289] (Project D2C)

[0290] The procedure according to any one of the foregoing items, wherein there are more than 5 polynucleotide fragment molecules used.

[0291] (Item D2D)

[0292] The procedure according to any one of the foregoing items, wherein there are more than 10 polynucleotide fragment molecules used.

[0293] (Item D2E)

[0294] The procedure according to any one of the foregoing items, wherein there are 50 or less polynucleotide fragment molecules used.

[0295] (Item D2AA)

[0296] The procedure according to any one of the foregoing items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0297] (Item D2AB)

[0298] The procedure according to any one of the foregoing items, wherein the modification includes halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkoxy groups, etc.) or unsubstituted alkyl groups (such as methyl), nucleic acids or modified nucleic acids (such as BNA, LNA), phosphorothioates, etc.

[0299] (Item D2AC)

[0300] The procedure according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate.

[0301] (Item D2AD)

[0302] The procedure according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0303] (Item D2AE)

[0304] The procedure according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis.

[0305] (Item D2AF)

[0306] The procedure according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis.

[0307] (Item D2AG)

[0308] The procedure according to any one of the foregoing items, wherein the method comprises providing the polynucleotide fragment molecule by transcription synthesis, and comprises monophosphorylating the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0309] (Item D2)

[0310] The procedure according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by more than 8 mers.

[0311] (Item D3)

[0312] The procedure according to any one of the foregoing items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0313] (Item D4)

[0314] The procedure according to any one of the foregoing items, wherein the deletion is 2 bases or less.

[0315] (Item D5)

[0316] The procedure according to any one of the foregoing items, wherein the nucleic acid splint is 10 mers to 50 mers.

[0317] (Item D6)

[0318] The procedure according to Item D1, wherein the polynucleotide fragment molecule is 10 mers to 50 mers.

[0319] (Item D7)

[0320] The procedure according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule.

[0321] (Item D7A)

[0322] The procedure according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule by 2 to 8 mers or more.

[0323] (Item D7B)

[0324] The procedure according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the ligation portion of the polynucleotide fragment molecule by 5 mers or more.

[0325] (Item D7C)

[0326] The program according to any one of the foregoing items, wherein the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by more than one base when aligned with the specific sequence.

[0327] (Item D8)

[0328] The program according to any one of the foregoing items, wherein at least one end of the polynucleotide fragment molecule has a vector and a bond.

[0329] (Item D9)

[0330] The program according to any one of the foregoing items, wherein the vector is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

[0331] (Item D9A)

[0332] The program according to any one of the foregoing items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0333] (Item D9B)

[0334] The program according to any one of the foregoing items, wherein the enzymatic ligation reaction is carried out simultaneously or not simultaneously.

[0335] (Item D9C)

[0336] The program according to any one of the foregoing items, wherein the enzymatic ligation reaction is carried out simultaneously.

[0337] (Item D9D)

[0338] The program according to any one of the foregoing items, characterized in that in the enzymatic ligation reaction, (A) after carrying out a single ligation reaction with a combination of the polynucleotide fragment molecule that is shorter than a specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0339] (Item D9E)

[0340] The program according to any one of the foregoing items, wherein the combination is such that the total extension is 175 - 200 mer.

[0341] <Recording medium>

[0342] (Item E1)

[0343] A recording medium storing a program for causing a computer to execute a method for designing polypeptide fragments and nucleic acid splints for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps:

[0344] A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence based on the specific sequence; and

[0345] B) a step of designing two or more nucleic acid splints based on the specific sequence,

[0346] wherein,

[0347] the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence,

[0348] the nucleic acid splint is substantially complementary to the polynucleotide molecule,

[0349] at least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

[0350] (Item E2A)

[0351] The recording medium according to any one of the preceding items, wherein there are 3 or more polynucleotide fragment molecules used.

[0352] (Item E2B)

[0353] The recording medium according to any one of the preceding items, wherein there are 4 or more polynucleotide fragment molecules used.

[0354] (Item E2C)

[0355] The recording medium according to any one of the preceding items, wherein there are 5 or more polynucleotide fragment molecules used.

[0356] (Item E2D)

[0357] The recording medium according to any one of the preceding items, wherein there are 10 or more polynucleotide fragment molecules used.

[0358] (Item E2E)

[0359] The recording medium according to any one of the preceding items, wherein there are 50 or fewer polynucleotide fragment molecules used.

[0360] (Item E2AA)

[0361] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is RNA or modified RNA, the nucleic acid splint is DNA, and the ligation is carried out by an RNA ligase.

[0362] (Item E2AB)

[0363] The recording medium according to any one of the foregoing items, wherein the modification includes halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkoxy, etc.) or unsubstituted alkyl (such as methyl), nucleic acid or modified nucleic acid (such as BNA, LNA), thiophosphate, etc.

[0364] (Item E2AC)

[0365] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate.

[0366] (Item E2AD)

[0367] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is a monophosphate of RNA.

[0368] (Item E2AE)

[0369] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis.

[0370] (Item E2AF)

[0371] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is provided by both chemical synthesis and transcription synthesis.

[0372] (Item E2AG)

[0373] The recording medium according to any one of the foregoing items, wherein the method includes providing the polynucleotide fragment molecule by transcription synthesis and includes monophosphorylating the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is carried out by an RNA ligase.

[0374] (Item E2)

[0375] The recording medium according to any one of the foregoing items, wherein the nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

[0376] (Item E3)

[0377] The recording medium according to any one of the foregoing items, wherein the distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

[0378] (Item E4)

[0379] The recording medium according to any one of the foregoing items, wherein the deletion is 2 bases or less.

[0380] (Item E5)

[0381] The recording medium according to any one of the foregoing items, wherein the nucleic acid splint is 10mer to 50mer.

[0382] (Item E6)

[0383] The recording medium according to any one of the foregoing items, wherein the polynucleotide fragment molecule is 10mer to 50mer.

[0384] (Item E7)

[0385] The recording medium according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule.

[0386] (Item E7A)

[0387] The recording medium according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding 2 to 8mer or more from the connecting portion of the polynucleotide fragment molecule.

[0388] (Item E7B)

[0389] The recording medium according to any one of the foregoing items, wherein the nucleic acid splint has a sequence protruding 5mer or more from the connecting portion of the polynucleotide fragment molecule.

[0390] (Item E7C)

[0391] The recording medium according to any one of the foregoing items. Wherein, the two or more nucleic acid splints and the polynucleotide fragment molecule have sequences designed to be staggered by one or more bases when aligned with the specific sequence.

[0392] (Item E8)

[0393] The recording medium according to any one of the foregoing items, wherein at least one end of the polynucleotide fragment molecule has a vector and a bond.

[0394] (Item E9)

[0395] The recording medium according to any one of the foregoing items, wherein the carrier is polystyrene, CPG (controlled pore glass beads), or magnetic beads.

[0396] (Item E9A)

[0397] The recording medium according to any one of the foregoing items, wherein the ligation is carried out by an enzymatic ligation reaction.

[0398] (Item E9B)

[0399] The recording medium according to any one of the foregoing items, wherein the enzymatic ligation reaction is carried out simultaneously or not simultaneously.

[0400] (Item E9C)

[0401] The recording medium according to any one of the foregoing items, wherein the enzymatic ligation reaction is carried out simultaneously.

[0402] (Item E9D)

[0403] The recording medium according to any one of the foregoing items, characterized in that in the enzymatic ligation reaction, (A) after performing a single ligation reaction with a combination of the polynucleotide fragment molecules that is shorter than a specific sequence, the product of the single ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed.

[0404] (Item E9E)

[0405] The recording medium according to any one of the foregoing items, wherein the combination is such that the total extension becomes 175 - 200 mer.

[0406] In the present disclosure, it is intended that in addition to the combinations specifically described, the above one or more technical features can be further combined and provided. As needed, those skilled in the art will recognize further embodiments and advantages of the present disclosure after reading and understanding the following detailed description.

[0407] Effects of the Invention

[0408] Provided is a nucleic acid ligation reaction that uses a nucleic acid splint and a complementary sequence that is substantially free of deletions. By adopting this ligation reaction, the yield can be improved compared with conventional ligation reactions. The present disclosure also provides techniques for mRNA and for ligating DNA to its 3'-end, thereby providing methods for improving efficiency. The present disclosure also provides techniques that can also use the in vitro virus method, thereby providing a more efficient processing technique that contributes to the development of genetic engineering and is used for DNA-specific cleavage and ligation. Brief Description of the Drawings

[0409] Figure 1-1Shows the sequence for Example 1.

[0410] Figure 1-2 Shows the results of denatured PAGE of enzymatic ligation of ssRNA (short-chain RNA) 100mer in 6 segments by RNA ligase 2.

[0411] Figure 2 Shows the measurement results based on HPLC and LC-MS of enzymatic ligation of ssRNA (short-chain RNA) 100mer in 6 segments by RNA ligase 2.

[0412] Figure 3 Shows the reaction tracking results based on UHPLC of enzymatic ligation of ssRNA (short-chain RNA) 100mer in 6 segments by RNA ligase 2.

[0413] Figure 4 Shows the results of denatured PAGE of enzymatic ligation of ssRNA 220mer in 10 segments by RNA ligase 2.

[0414] Figure 5 Shows the results of UHPLC and LC-MS of Example 4.

[0415] Figure 6-1 Shows the sequence for Example 5.

[0416] Figure 6-2 Shows the results of denatured PAGE of Example 5.

[0417] Figure 7-1 Shows the sequence for Example 1.

[0418] Figure 7-2 Shows the results of denatured PAGE and activity measurement of Example 6.

[0419] Figure 8-1 Shows the sequence for Example 6.

[0420] Figure 8-2 Shows the sequence for Example 6.

[0421] Figure 8-3 Shows the results of denatured PAGE and activity measurement of Example 6.

[0422] Figure 9 Shows a schematic diagram of the method of the present disclosure.

[0423] Figure 10Shows a method of ligating transcriptionally synthesized long-chain RNA and chemically synthesized RNA using the research method of the present disclosure. The asterisk in chemical synthesis in the figure indicates modification. Different from the prior art, the method of the present disclosure is designed on the basis of a nucleic acid splint (here a DNA splint) in the form of forming a complementary strand with the entire target sequence as a specific sequence, and is carried out in segments instead of one strand, so that the strand length of the nucleic acid splint is very short compared to a single-stranded (ss) RNA and is easy to purify.

[0424] Figure 11 Shows an example of manufacturing in a manner that uses the strands between each other as a template instead of using template DNA.

[0425] Figure 12 Shows an application example of the enzymatic ligation reaction of ssRNA100mer ligated in 6 segments by RNA ligase 2. For example, it can be used for the cleavage and editing of genomic DNA using the CRISPR-Cas9 method.

[0426] Figure 13 Shows an overview of the experiment of ligating transcription products and chemically synthesized RNA using a DNA splint.

[0427] Figure 14 Is a schematic diagram of the target substance and the starting substance.

[0428] Figure 15 Shows an overview of the reaction experiment of ligating transcription products and chemically synthesized RNA using a DNA splint.

[0429] Figure 16 Shows the results of Example 8. The ligation of 36 fragments, a total of 790mer, was achieved. The synthesis of a product longer than the above example (560mer) (1) was achieved using a method of RNA synthesis that is not based on the ligation of transcriptionally synthesized RNA and chemically synthesized RNA. In addition, it was determined that when a DNA splint is assembled also outside the ligation part, the ligation reaction proceeds (1). In addition, if a complementary strand is not assembled outside the ligation site, the ligation reaction is difficult to proceed. It was found that non-specific ligation also occurs (2).

[0430] Figure 17 Is a schematic diagram of the experiment of ligating transcription products and chemically synthesized RNA using a DNA splint.

[0431] Figure 18 Shows the results of the experiment of ligating transcription products and chemically synthesized RNA using a DNA splint. Detailed Description of the Invention

[0432] The following further details the present disclosure.

[0433] Throughout this specification, unless otherwise stated, singular forms shall be construed to also include the concept of their plural forms. Therefore, unless otherwise stated, singular forms of articles (e.g., in the case of English, "a", "an", "the", etc.) shall be construed to also include the concept of their plural forms. Additionally, terms used in this specification shall, unless otherwise stated, be construed to be used in the meanings commonly used in the art. Therefore, all technical terms and scientific and technological terms used in this specification shall have the same meanings as those commonly understood by those skilled in the art to which this invention pertains, provided that they are not defined otherwise. In case of conflict, this specification (including definitions) shall prevail.

[0434] (Definition)

[0435] In this specification, "nucleotide" and "nucleotide molecule" refer to: a nucleoside in which the sugar moiety forms a phosphate ester. "Nucleoside" in this specification refers to a compound in which a base and a sugar are linked by an N-glycosidic bond. When the sugar moiety is D-ribose, it is called ribonucleotide and is obtained by RNA hydrolysis. When the sugar moiety is D-2'-deoxyribose, it is called deoxyribonucleotide and is obtained by enzymatic digestion of DNA. In this specification, nucleotides can be natural or non-natural, and can also be artificially synthesized. "Nucleotides" can be modified, and the modification can be carried out on any one or a combination of the base, sugar moiety, and phosphate group moiety. Preferably, the sugar moiety and phosphate group moiety of the nucleotide can be modified, and / or the nucleotide can be modified with a phosphate group at the 3'-position of the nucleotide. In a modified nucleotide, at the 3'-position of the nucleotide, at least one oxygen atom of the phosphate group can be replaced by a sulfur atom, boron (borophosphorylation), methyl (methylation), etc.

[0436] In this specification, "oligonucleotide", "oligonucleotide molecule", "polynucleotide" and "polynucleotide molecule" are used interchangeably and refer to a polymer of two or more nucleotides, including common polymers or oligomers of nucleotides. Sometimes, "oligonucleotide", "oligonucleotide molecule", "polynucleotide" and "polynucleotide molecule" are also referred to as "oligo", "nucleic acid" or "nucleic acid chain". "Oligonucleotide", "oligonucleotide molecule", "polynucleotide" and "polynucleotide molecule" can be modified.

[0437] In this specification, "modification" (also known as "modification", usually both "modification / modify" in English, including the concepts of substitution, substitute, displacement, displace, replacement, replace) used in the context of nucleic acids means that part or all of the structural unit of a nucleic acid or its terminus is replaced by other atomic groups, or the state of adding functional groups. A substance containing such "modification" is called a "modified form" (such as DNA, RNA, nucleic acid, oligonucleotide, etc.). Modification can be carried out on any one or a combination of the base, sugar moiety, and phosphate group moiety in a nucleotide. Preferably, the sugar moiety, phosphate group moiety of an oligonucleotide or polynucleotide, and / or the 3'-position at the 3'-terminus of an oligonucleotide or polynucleotide can be modified with a phosphate group. In a modified form of an oligonucleotide or polynucleotide, the 3'-position at the 3'-terminus of the oligonucleotide or polynucleotide can be modified with a phosphate group, and at least one oxygen atom of the phosphate group is replaced by a sulfur atom. In this specification, "modified form of oligonucleotide" and "modified form of polynucleotide" can be used interchangeably, and refer to a polymer or oligomer of nucleotides and / or modified forms of nucleotides. Examples of modified forms of oligonucleotides include all modified forms that can be alkylated such as methylation, and modified forms including any modification (modification by various substituents) disclosed in this specification. In addition, in this field, for example, BNA (Bridged Nucleic Acid), LNA (Locked Nucleic Acid), etc. can be cited. For modified forms of such artificial nucleic acids, etc., see Wengel et al., Eur. J. Org. Chem. 2297-2321 (2005). This document is cited as a reference in this specification. The "oligonucleotides", "oligonucleotide molecules", "polynucleotides", and "polynucleotide molecules" of the present disclosure can include such modifications.

[0438] In this specification, a "fragment molecule" refers to a molecule that is shorter than the whole molecule when considering it as a whole in the case of a molecule that is the synthesis target in the synthesis technology disclosed in the present disclosure, and is a molecule that generates the whole molecule as the object through ligation. In the case of a certain polynucleotide, a polynucleotide with a desired sequence (as a whole) can be manufactured by ligating the fragment molecules of the polynucleotide.

[0439] In this specification, "deoxyribonucleic acid (DNA)" refers to a molecule containing at least one deoxyribonucleotide monomer moiety. DNA can be modified with any functional group. As modified forms of DNA, they include, but are not limited to, cross-linked nucleic acids: 2',4'-BNA / LNA, 2',4'-BNANC[N-Me], 2'-O,4'-C-ethylene-bridged nucleic acid (ENA), amide-cross-linked nucleic acid (AmNA), etc. Such modified DNAs are also within the scope of "oligonucleotide", "oligonucleotide molecule", "polynucleotide", and "polynucleotide molecule" disclosed in this application.

[0440] In this specification, "ribonucleic acid (RNA)" refers to a molecule containing at least one ribonucleotide monomer moiety. "Ribonucleotide" refers to a nucleotide having a hydroxyl group at the 2'-position of the β-D-ribofuranose moiety. RNA can be modified with any functional group. As modified forms of RNA, they include, but are not limited to, 2'-O-methyl RNA, 2'-fluoro-RNA, 2'-methoxyethyl-RNA (MOE), etc. Such modified RNAs are also within the scope of "oligonucleotide", "oligonucleotide molecule", "polynucleotide", and "polynucleotide molecule" disclosed in this application.

[0441] In this specification, "nucleic acid base" or "base" refers to the base component constituting a nucleic acid. For example, it includes, but is not limited to, adenine (A), guanine (G), cytosine (C), thymine (T), uracil (U), hypoxanthine (inosine), 5-methylcytosine, N6-methyladenine, 1-methyladenine, pseudouridine, 1-methylpseudouridine, 5-bromouracil, 5-iodouracil, 6-thioadenine, 6-thioguanine, 4-thiouracil, 2-aminopurine, 2,6-diaminopurine, etc.

[0442] In this specification, "template nucleic acid" refers to a nucleic acid having a sequence complementary to a polynucleotide, oligonucleotide, or a modified form thereof, which is the object of techniques such as the production methods disclosed in this application.

[0443] In this specification, the "3'-end" of an oligonucleotide (or polynucleotide) or its modified form refers to the terminal monomer moiety bound to the 3'-side of the oligonucleotide (or polynucleotide) or its modified form.

[0444] In this specification, the "5'-end" of an oligonucleotide (or polynucleotide) or its modified form refers to the terminal monomer moiety bound to the 5'-side of the oligonucleotide (or polynucleotide) or its modified form.

[0445] In this specification, "linkage" refers to the act of connecting or the connection made by means of any chemical bond, linker, etc. As such a chemical bond, it is usually a covalent bond, but is not limited thereto.

[0446] In this specification, the "conditions for ligation" refer to the conditions under which oligonucleotides (or polynucleotides) or their modified forms can be ligated. In the present disclosure, the "conditions for ligation" are contemplated to be conditions for using enzymes with nucleic acid ligation activity such as ligases and chemical ligation conditions. Examples of the conditions for chemical ligation include temperature, pH, solvent, salt concentration (buffer, sodium chloride, etc.), and those skilled in the art can make appropriate adjustments. The conditions for using enzymes are also conditions suitable for the required reactions catalyzed by the enzymes used. For example, examples include the concentration of substrates such as nucleic acid fragments, the concentration of enzymes, temperature, pH, solvent, salt concentration (buffer, sodium chloride, etc.), and those skilled in the art can make appropriate adjustments.

[0447] In this specification, an "ensemble" refers to an aggregate of sequences containing two or more fragment molecules. The fragment molecules are fragment molecules of oligonucleotides (or polynucleotides) or their modified forms.

[0448] In this specification, "splint" or "nucleic acid splint" can be used interchangeably and refers to a nucleic acid molecule that has a sequence complementary to a part of another nucleic acid molecule when used together with the other nucleic acid molecule. The nucleic acid splint can be DNA or RNA, but is preferably DNA, and in this case it is called a DNA splint.

[0449] In this specification, "complementary" refers to the relationship between one nucleic acid region and another nucleic acid region, and refers to the relationship in which the two can interact with a certain degree of affinity. Typically, it means that the nucleotide sequences in similar regions of two single-stranded nucleic acids or two different regions of the same single-stranded nucleic acid have nucleic acid base compositions capable of hybridizing. The sequences that hybridize to each other can be completely complementary or partially complementary to the expected target sequence through standard nucleic acid base pairs (for example, the pairing of G:C, A:T, or A:U). "Substantially complementary" means that as long as the conditions for hybridization can be carried out, they do not have to be exactly the same. Especially in the case of the nucleic acid molecules of the present disclosure, both or either of the 5'-end or 3'-end can be deficient. For example, it has been confirmed that when several bases are deficient at both the 5'-end and 3'-end, the reaction is not affected and can still proceed (see Examples, Figure 6-1 , 7-1 , 8-1, etc.).

[0450] In this specification, "hybridization" refers to the formation of a complex due to nucleic acid complementarity.

[0451] In this specification, "substantially complementary" means having a complementary sequence within the range where the nucleic acid splint and the single-stranded nucleic acid can form a double strand.

[0452] In this specification, the "linking portion" refers to the portion formed by the ligation of fragment molecules. In the present disclosure, polynucleotide fragment molecules are ligated through the linking portion to form polynucleotides.

[0453] In this specification, "protrusion" refers to the part where the 3'-end of a nucleic acid extends beyond the 5'-end of another complementary nucleic acid hybridized therewith, or conversely, the part where the 5'-end of a nucleic acid extends beyond the 3'-end of another complementary nucleic acid hybridized therewith. This situation can also be described as: two or more nucleic acid clamps and the polynucleotide fragment molecule have sequences designed to be staggered by more than 1 base (e.g., 2-8mer, etc.) when aligned with a specific sequence (preferably, the 3'-end of the nucleic acid extends beyond the 5'-end of another complementary nucleic acid hybridized therewith).

[0454] In this specification, "alignment" (and its English noun form "alignment") refers to the sorting of multiple polynucleotide fragment molecules or nucleic acid clamps in an interacting form when the polynucleotide fragment molecule hybridizes with the nucleic acid clamp, usually referring to the arrangement of a certain degree of complementary sequences in a consistent manner. Alignment can also be performed by any software used in this field. For example, publicly available software such as BLAST can be used, but the available software is not limited to this.

[0455] In this specification, "deletion" generally means that a sequence that should exist no longer exists. In the context of this disclosure, typically, it means that when a polynucleotide fragment molecule hybridizes with a nucleic acid clamp, a partial (which can be 1 base) base sequence does not exist.

[0456] In this specification, "substantially no deletion" generally means that a sequence that should exist exists, or even if it does not exist, there is only a deletion that does not interfere with the achievement of the purpose. In the context of this disclosure, typically, when a nucleic acid clamp forms a double strand with a single-stranded nucleic acid, the nucleic acid clamp is preferably deleted by 3 bases or less relative to the sequence of the single-stranded nucleic acid. More preferably, it is deleted by 2 bases or less (e.g., 2 bases, 1 base, or 0 bases), and even more preferably, it is deleted by 1 base or less. Here, it is not necessary that the two ends of the single-stranded nucleic acid are complementary. In addition, in the case of using multiple nucleic acid clamps, the multiple nucleic acid clamps may not cover the corresponding specific sequence. That is, it should be understood that in the case of using multiple nucleic acid clamps, there may be a deleted part when the nucleic acid clamp is compared with the corresponding specific sequence.

[0457] In this specification, "adjacent" refers to the positional relationship between two nucleic acids. Typically, the positional relationship between one nucleic acid and another nucleic acid is juxtaposed in the form of 2 bases or less (e.g., 2 bases, 1 base, or 0 bases).

[0458] In this specification, in the context of polynucleotide molecules and the like related to this disclosure, "distance" refers to the length between each molecule. Typically, it is represented by the number of bases of the nucleic acid.

[0459] In this specification, "carrier" refers to a substance used to immobilize nucleotide molecules when connecting nucleotide molecules. Examples of carriers include polystyrene, CPG (controlled pore glass beads), or magnetic beads, etc., but as long as it can immobilize nucleotide molecules, it is not limited to these.

[0460] In this specification, "kit" refers to a unit that is usually divided into two or more compartments and provides the parts that should be provided. When the purpose is to provide a composition that should not be provided mixed due to reasons such as stability, and is preferably mixed and used immediately before use, the kit form is preferred.

[0461] In this specification, "design" refers to providing a nucleic acid having a desired sequence and / or a schematic diagram for producing such a nucleic acid.

[0462] When used in this specification, "disease", "disorder", and "condition" (all referring to "condition") can be used interchangeably, and refer to any state in which the subject deviates from the normal state (normal or healthy).

[0463] (Preferred embodiment)

[0464] The preferred embodiments of the present disclosure are described below. It should be understood that the embodiments provided below are provided for better understanding of the present disclosure, and the scope of the present disclosure should not be limited to the following description. Therefore, it is obvious that those skilled in the art can make appropriate changes within the scope of the present invention with reference to the descriptions in this specification. In addition, it can be understood that the following embodiments of the present invention can be used alone or in combination.

[0465] (Ligation of polynucleotides using nucleic acid splints)

[0466] In one aspect, the present disclosure provides a method for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps: 1) a step of providing two or more polynucleotide fragment molecules each containing a part of the specific sequence; and 2) a step of ligating two or more polynucleotide fragment molecules in the presence of two or more nucleic acid splints, wherein the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, the nucleic acid splints are substantially complementary to the polynucleotide molecules, and at least two of the nucleic acid splints in the nucleic acid splints contain sequences that are substantially free of deletions when aligned with the specific sequence. The schematic diagram of the present disclosure is as Figure 9As shown. As shown in the figure, in one embodiment, the method of the present disclosure has the following features: Based on designing a nucleic acid splint (herein a DNA splint) in the form of forming a complementary strand with the entire target sequence as a specific sequence, different from the prior art, it is carried out in segments rather than in one strand, so that the strand length of the nucleic acid splint is very short compared to single-stranded (ss) RNA and is easy to purify. The schematic diagram is as Figure 10 shown.

[0467] As Figure 10 exemplified, in one embodiment, the method of the present disclosure has the following features: Based on designing a nucleic acid splint (herein a DNA splint) in the form of forming a complementary strand with the entire target sequence as a specific sequence, different from the prior art, it is in segments rather than one strand, and the segmented splints are prepared and implemented in a discontinuous form, so that the strand length of the nucleic acid splint is very short compared to single-stranded (ss) RNA and is easy to purify. This method can also be used for RNA synthesized by in vitro transcription. By partially ligating synthetic oligonucleic acids containing chemical modifications, long-chain nucleic acids with chemical modifications inserted at arbitrary positions can be synthesized.

[0468] In the present disclosure, the specific sequence can be any desired sequence for production or synthesis. As long as a part of the specific sequence is a part of the specific sequence for production or synthesis, it can be any part, preferably, it can be the 5' end or the middle part of the sequence. Regarding the polynucleotide fragment molecule containing a part of the specific sequence, once the specific sequence is determined, a polynucleotide containing the sequence can be prepared by synthesis or the like.

[0469] In a preferred embodiment, the number of fragments used is more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, more than 10. By using more than 3 fragments, the efficiency of the ligation reaction can be made good.

[0470] In the present disclosure, in the presence of two or more nucleic acid splints, two or more polynucleotide fragment molecules prepared as described above are ligated. This ligation can be carried out by any method. For example, conditions for enzymatic ligation or chemical ligation using enzymes such as ligases and polymerases are used, and those skilled in the art can use appropriate conditions. In the ligation process of the present disclosure, generally, the collection of the sequences of two or more polynucleotide fragment molecules substantially constitutes the specific sequence. Here, the nucleic acid splint used is substantially complementary to the polynucleotide molecule, and it is more advantageous that at least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

[0471] According to the technology of the present disclosure, by adopting the technology of using nucleic acid splints to ligate polynucleotides, it is possible to achieve an improvement in the reactivity between polynucleotides and a high reaction yield. In addition, by adopting the technology of the present disclosure, multiple or all ligation reactions can be initiated simultaneously, thereby enabling an improvement in reactivity and a high reaction yield.

[0472] In one embodiment, the polynucleotide fragment molecules used in the present disclosure are RNA or modified RNA. In this embodiment, the modification can be halogenation (such as fluorine, chlorine, iodine, etc.), substitution (including alkyl groups such as methyl; alkoxy groups such as methoxy, ethoxy, etc.) or unsubstituted alkyl groups (for example, methyl, ethyl, etc.), nucleic acids or modified nucleic acids (such as BNA, LNA, etc.), phosphorothioates, etc. Examples of other modifications are described elsewhere in this specification.

[0473] In one embodiment, the nucleic acid splint used in the present disclosure is DNA. The DNA splint can be modified.

[0474] In one embodiment, the polynucleotide fragment molecules used in the present disclosure are RNA or modified RNA, and the nucleic acid splint used in the present disclosure is DNA. In this case, an RNA fragment can be used as the ligation molecule, and a DNA splint is used. In this case, the ligation is usually carried out using an RNA ligase.

[0475] In a preferred embodiment, examples of the RNA ligase used include T4 RNA ligase, RtcB ligase, T4 DNA ligase (known to have RNA ligation activity), Splint (registered trademark) ligase, etc.

[0476] In one embodiment, the polynucleotide fragment molecules used in the present disclosure are monophosphates, more preferably monophosphates of RNA. Being a monophosphate is beneficial for use in synthetic reactions using ligases, etc. The monophosphate group can be present at the 5'-end or the 3'-end or both. In one embodiment, the polynucleotide fragment molecules used in the present disclosure may also not be phosphates.

[0477] In one embodiment, the polynucleotide fragment molecules used in the present disclosure are provided by at least one method selected from the group consisting of chemical synthesis and transcription synthesis. In the case of polynucleotide fragment molecules provided by chemical synthesis, not only unmodified RNA or DNA can be used, but also modified RNA or DNA can be used, which is preferred. In a specific embodiment, chemically synthesized RNA or modified RNA can be used. Such chemically synthesized RNA or modified RNA can be achieved by methods well known in the art (for example, but not limited to Roy, S.; Caruthers, M. Synthesis of DNA / RNA and Their Analogs via Phosphoramidite and H-Phosphonate Chemistries. Molecules 2013, 18, 14268-14284. https: / / doi.org / 10.3390 / molecules181114268).

[0478] In another embodiment, the polynucleotide fragment molecules used in the present disclosure are provided by both chemical synthesis and transcription synthesis. The technology of the present disclosure can use either chemical synthesis or transcription synthesis, or can be used in the case of mixing the two.

[0479] In a specific embodiment, the polynucleotide fragment molecules used in the present disclosure are provided by transcription synthesis, and a single phosphorylation is performed on the 5' end of the polynucleotide fragment molecule after the transcription synthesis, and the ligation is performed by an RNA ligase. Because of the single phosphorylation, the RNA ligase can be advantageously used. The single phosphorylation can be achieved by using an enzyme such as RppH (RNA 5' pyrophosphohydrolase), but is not limited thereto.

[0480] In one embodiment, the nucleic acid splint used in the present disclosure is complementary to the polynucleotide molecule used in the present disclosure by 8 mers or more. Preferably, it is complementary by 9 mers or more, 10 mers or more, 11 mers or more, 12 mers or more, 13 mers or more, 14 mers or more, 15 mers or more, 16 mers or more, 17 mers or more, 18 mers or more, 19 mers or more, 20 mers or more. By using the nucleic acid splint, it can be easily removed by purification, and the nucleic acid splint can also be reused. It has been observed that by having a certain degree of complementary length, the efficiency of the enzymatic dehydration condensation reaction can be improved.

[0481] In one embodiment, the distance between the nucleic acid splint aligned with the specific sequence used in the present disclosure and the adjacent nucleic acid splint is 2 bases or less. Compared with the case of forming base pairs only partially complementary, by assembling the nucleic acid splint and the fragment in such a way that the distance between adjacent nucleic acid splints is 2 bases or less, an improvement in reactivity and a high reaction yield can be achieved. By making the distance appropriate, an improvement in reactivity and a higher reaction yield can be achieved, preferably 2 bases or less, more preferably 1 base or less.

[0482] In one embodiment, the deletion used in the present disclosure is 2 bases or less, preferably 1 base or less. Although not wishing to be bound by theory, the reason for preferably having 1 or less deletions is that the ligation activity is high when the deletion is small.

[0483] In one embodiment, the polynucleotide fragment molecule used in the present disclosure is 10mer to 50mer. Preferably it is 10mer to 30mer.

[0484] There is no particular limitation on the length of the polynucleotide fragment molecule used in the present disclosure. These polynucleotide fragment molecules are preferably, for example, of a length capable of forming a double strand with the nucleic acid splint. Although not wishing to be bound by theory, this is because by setting the length to be capable of forming a double strand with the nucleic acid splint, the reaction of the present disclosure proceeds efficiently. Those skilled in the art can appropriately set such a length capable of forming a double strand with the nucleic acid splint after considering sequence information, reaction conditions, etc.

[0485] In one embodiment, the nucleic acid splint used in the present disclosure is 10mer to 50mer. Preferably it is 12mer to 35mer. By using a plurality of segmented nucleic acid splints instead of using a long fully matching single-stranded nucleic acid splint, an improvement in reactivity and a high reaction yield can be achieved.

[0486] There is no particular limitation on the length of the nucleic acid splint used in the present disclosure. These nucleic acid splints are preferably, for example, of a length capable of forming a double strand with the polynucleotide fragment molecule.

[0487] In one embodiment, the nucleic acid splint used in the present disclosure has a sequence that protrudes from the ligation portion of the polynucleotide fragment molecule. As long as the technology of the present disclosure can be carried out, the number of protruding bases can be any length, which can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases, etc. As long as the complementary sequences of the nucleic acid splint and the polynucleotide fragment molecule are of an appropriate length (for example, a length described elsewhere in this specification such as 8mer), it can be any length, for example, preferably 1-15mer, 1-10mer, 2-8mer, 3-8mer, etc., and for example, it can be 5mer or more. Although not wishing to be bound by theory, it is preferably 5mer or more protruding because of high ligation activity.

[0488] In one embodiment, the bases of the nucleotides constituting the present disclosure are usually the natural bases that constitute polynucleotide molecules existing in biology (for example, purine bases such as adenine and guanine, pyrimidine bases such as cytosine, uracil, and thymine). Depending on the situation, bases that do not constitute polynucleotide molecules existing in biology (referred to as "unnatural bases" in this specification) can also be used. Examples of such unnatural bases include inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, etc., or modified forms of the bases described in the present disclosure are exemplified.

[0489] Examples of bases include natural bases such as purine bases like adenine and guanine; pyrimidine bases such as cytosine, uracil, and thymine. In addition to these, bases include inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidine, etc. Examples of the bases include alkyl derivatives such as 2 - aminoadenine and 6 - methylated purine; alkyl derivatives such as 2 - propylated purine; 5 - halogenated uracil and 5 - halogenated cytosine; 5 - propynyl uracil and 5 - propynyl cytosine; 6 - azauracil, 6 - azacytosine, and 6 - azathymine; 5 - uracil (pseudouracil), 4 - thiouracil, 5 - halogenated uracil, 5-(2 - aminopropyl)uracil, 5 - aminoallyl uracil; 8 - halogenated, aminoated, thiolated, thioalkylated, hydroxylated, and other 8 - substituted purines; 5 - trifluoromethylated and other 5 - substituted pyrimidines; 7 - methylguanine; 5 - substituted pyrimidines; 6 - azapyrimidines; N - 2, N - 6, and O - 6 substituted purines (including 2 - aminopropyl adenine); 5 - propynyl uracil and 5 - propynyl cytosine; dihydrouracil; 3 - deaza - 5 - azacytosine; 2 - aminopurine; 5 - alkyl uracil; 7 - alkyl guanine; 5 - alkyl cytosine; 7 - deazaadenine; N6, N6 - dimethyladenine; 2,6 - diamino purine; 5 - amino - allyl - uracil; N3 - methyl uracil; substituted 1,2,4 - triazole; 2 - pyridone; 5 - nitroindole; 3 - nitropyrrole; 5 - methoxyuracil; uracil - 5 - oxyacetic acid; 5 - methoxycarbonylmethyl uracil; 5 - methyl - 2 - thiouracil; 5 - methoxycarbonylmethyl - 2 - thiouracil; 5 - methylaminomethyl - 2 - thiouracil; 3-(3 - amino - 3 - carboxypropyl)uracil; 3 - methylcytosine; 5 - methylcytosine; N4 - acetylcytosine; 2 - thiocytosine; N6 - methyladenine; N6 - isopentyladenine; 2 - methylthio - N6 - isopentenyladenine; N - methylguanine; O - alkylated bases, etc. In addition, purine bases and pyrimidine bases include bases disclosed in, for example, U.S. Patent No. 3,687,808, "Concise Encyclopedia Of Polymer Science And Engineering", pages 858 - 859, edited by Kroschwitz J.I., John Wiley & Sons, 1990, and Englisch et al., Angewandte Chemie, International Edition, 1991, volume 30, p. 613.

[0490] In one embodiment, at least one end of the polynucleotide fragment molecule used in the present disclosure has a carrier and a bond. Preferably, the carrier used in the present disclosure is polystyrene, CPG (controlled pore glass beads), or magnetic beads. By using the carrier, the yield can be increased.

[0491] In one embodiment, the polynucleotide ligation reaction used in the present disclosure is initiated simultaneously at multiple positions. Although not wishing to be bound by theory, the reason for preferably initiating simultaneously can be cited as the simplification of the ligation reaction process, but it is not limited thereto.

[0492] In one embodiment, the polynucleotide ligation reaction used in the present disclosure is initiated sequentially. Although not wishing to be bound by theory, the reason for preferably initiating sequentially is that the yield is sometimes high when the reaction is carried out by sequential initiation.

[0493] In a preferred embodiment, more preferably, the method for producing a polynucleotide molecule having a specific sequence in the present disclosure is characterized by implementing the following method:

[0494] 1) In the step of providing two or more polynucleotide fragment molecules each containing a part of the specific sequence, three or more fragment molecules are provided.

[0495] 2) In the step of ligating two or more polynucleotide fragment molecules in the presence of two or more nucleic acid clamps, three or more nucleic acid clamps are provided, and the ligation is carried out by dehydration condensation or the like.

[0496] The assembly of the sequences of two or more polynucleotide fragment molecules constitutes the specific sequence. The nucleic acid clamps are complementary to the polynucleotide molecules, and at least two of the nucleic acid clamps in the nucleic acid clamps contain sequences that are not missing when aligned with the specific sequence.

[0497] In one embodiment, the ligation is carried out by an enzyme ligation reaction. In this case, the enzyme ligation reaction can be carried out simultaneously or not simultaneously. Preferably, the enzyme ligation reaction is carried out simultaneously, but it is confirmed that even if it is not carried out simultaneously, the reaction is not affected and can still proceed, and there is no particular limitation. In the enzyme ligation reaction, (A) after carrying out a ligation reaction once with a combination of the polynucleotide fragment molecules that is shorter than the specific sequence, the product of the first ligation reaction is used for the next ligation reaction, and (B) (A) is repeated as needed. The combination with a total extension of 175 - 200 mer can be any length, for example, it can be 100 - 500 mer, 150 - 400 mer, or 175 - 200 mer, 50 - 300 mer, 80 - 500 mer, 200 - 400 mer, etc.

[0498] The technology of the present disclosure is considered to have the following features. As a non-limiting feature, it is confirmed that by simultaneously initiating all enzyme ligation reactions, for example, in the synthesis of a long sequence (such as 560mer), the reaction efficiency of a shorter sequence (such as 175 - 200mer) is better, and reaction products can be confirmed even when initiated simultaneously. Additionally, as a non-limiting feature, by designing a nucleic acid splint (such as a DNA splint) in such a way that all bases contained in the target sequence form base pairs, and using a segmented nucleic acid splint (such as a DNA splint) instead of simply using a long fully complementary single-stranded nucleic acid splint (such as a DNA splint), and designing it such that the ligation sites protrude by several bases, through the combination of solid-phase synthesis and ligation, the synthesis of, for example, a long (500mer or more, etc.) single-stranded RNA has been successfully provided, which has never been seen before.

[0499] Therefore, it should be understood that in the present disclosure, as a non-limiting feature, compared with assembling a nucleic acid splint (such as a DNA splint) at the ligation site ± several bases, the enzyme ligation reaction efficiency of the present disclosure is good, and, compared with the case of simply using a long fully complementary single-stranded nucleic acid splint (such as a DNA splint), the enzyme ligation reaction efficiency is good. Additionally, as a non-limiting feature, it should be understood that compared with the case where partial defects occur in base pair formation, the reaction efficiency of the method of assembling a nucleic acid splint (such as a DNA splint) for all fragments is good, which is preferred. Additionally, although not limited in the present disclosure, as a typical example, the chain length of the nucleic acid splint (such as a DNA splint) is shorter than the final product, so it is easily removed by purification. It should be understood that in principle, the nucleic acid splint (such as a DNA splint) can also be reused. As a non-limiting feature of the present disclosure, for example, a high-loading carrier such as polystyrene cannot be used when synthesizing a single-stranded long-chain target sequence nucleic acid (RNA, etc.) by continuous synthesis, but it can be used in a short target sequence nucleic acid (RNA, etc.), and an increase in the yield of RNA synthesis per batch can be expected.

[0500] In one aspect, the present disclosure provides a polynucleotide ligated by the ligation reaction described in this specification. Although not wishing to be bound by theory, this polynucleotide has the characteristics of a long-chain polynucleotide starting from multiple chemically synthesized short-chain polynucleotides, which can be a polynucleotide that could not be provided in the past.

[0501] (Manufacturing Kit)

[0502] In another aspect, the present disclosure provides a kit for producing a polynucleotide molecule having a specific sequence described in this specification, which comprises: 1) more than two polynucleotide fragment molecules each containing a part of the specific sequence described in this specification, and 2) more than two nucleic acid clamps, such that the sequences of the more than two polynucleotide fragment molecules together constitute the specific sequence described in this specification. The nucleic acid clamps described in this specification are substantially complementary to the polynucleotide molecule, and at least two of the nucleic acid clamps contain sequences that are substantially without gaps when aligned with the specific sequence. It should be understood that the various embodiments described herein can be appropriately combined and applied in any manner described in (ligation of polynucleotides using nucleic acid clamps).

[0503] In a preferred embodiment, more than 3, more than 4, more than 5, more than 6, more than 7, more than 8, more than 9, or more than 10 fragments are used. By using more than 3 fragments, the efficiency of the ligation reaction can be made good. There is no limitation in this regard, and the polynucleotide fragment molecules used can be 100 or less, 90 or less, 80 or less, 70 or less, 60 or less, 50 or less, 40 or less, etc., but are not limited thereto, and amounts more than this can also be used.

[0504] In one embodiment, a kit is provided in which the nucleic acid clamps used in the kit of the present disclosure are complementary to the polynucleotide molecule used in the present disclosure by 8 mers or more. Preferably, they are complementary by 9 mers or more, 10 mers or more, 11 mers or more, 12 mers or more, 13 mers or more, 14 mers or more, 15 mers or more, 16 mers or more, 17 mers or more, 18 mers or more, 19 mers or more, or 20 mers or more. By using nucleic acid clamps, which are shorter than the final product, they can be easily removed by purification and can also be reused. When configured in a kit, these nucleic acid clamps can include, in addition to the actually used nucleic acid clamps, spare nucleic acid clamps, nucleic acid clamps with slightly different sequences, and nucleic acid clamps with different lengths. Those skilled in the art can appropriately select a suitable nucleic acid clamp for use to implement the method of the present disclosure.

[0505] In one embodiment, in the kit of the present disclosure, the distance between the nucleic acid splint aligned with a specific sequence and the adjacent nucleic acid splint of the nucleic acid splint aligned with the specific sequence used in the present disclosure is 2 bases or less. Compared with the case of forming base pairs only partially complementary, by assembling the nucleic acid splint and the fragment in such a form that the distance between adjacent nucleic acid splints is 2 bases or less, an improvement in reactivity and a high reaction yield can be achieved. When configured in a kit, these nucleic acid splints may include, in addition to the actually used nucleic acid splints, spare nucleic acid splints, nucleic acid splints with slightly different sequences, and nucleic acid splints with different lengths. Those skilled in the art can appropriately select a suitable nucleic acid splint for use to implement the method of the present disclosure.

[0506] In one embodiment, when the nucleic acid splint used in the kit of the present disclosure is aligned with a specific sequence, the deletion is 2 bases or less.

[0507] In one embodiment, the polynucleotide fragment molecule used in the kit of the present disclosure is 14 mer to 46 mer. Preferably it is 10 mer to 30 mer. By using divided nucleic acid splints instead of using a long fully complementary single-stranded nucleic acid splint, an improvement in reactivity and a high reaction yield can be achieved. When configured in a kit, these polynucleotide fragment molecules may include, in addition to the actually used polynucleotide fragment molecules, spare polynucleotide fragment molecules, polynucleotide fragment molecules with slightly different sequences, and polynucleotide fragment molecules with different lengths. Those skilled in the art can appropriately select a suitable polynucleotide fragment molecule for use to implement the method of the present disclosure.

[0508] In one embodiment, the nucleic acid splint used in the kit of the present disclosure has a sequence that protrudes 4 mer or more from the ligation portion of the polynucleotide fragment molecule. When configured in a kit, these nucleic acid splints and polynucleotide fragment molecules may include, in addition to the actually used nucleic acid splints and polynucleotide fragment molecules, spare nucleic acid splints and polynucleotide fragment molecules, nucleic acid splints and polynucleotide fragment molecules with slightly different sequences, and nucleic acid splints and polynucleotide fragment molecules with different lengths, and labels that are easy to find a suitable combination can be attached. Those skilled in the art can appropriately select a suitable polynucleotide fragment molecule for use to implement the method of the present disclosure.

[0509] In one embodiment, at least one end of the polynucleotide fragment molecule included in the kit of the present disclosure has a carrier and a bond. Preferably, the carrier included in the kit of the present disclosure is polystyrene, CPG (controlled pore glass beads), or magnetic beads. By using the carrier, the yield can be increased.

[0510] (Material supply, design procedure)

[0511] When configured in a kit, in addition to the carriers actually used, these carriers may also include spare carriers and carriers of different types, and can be labeled to facilitate finding a suitable combination. Those skilled in the art can appropriately select a suitable carrier during use to implement the method of the present disclosure.

[0512] In another aspect, the present disclosure provides a method for producing a polynucleotide molecule having a specific sequence described in this specification. The method includes the following steps: A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; B) a step of designing two or more nucleic acid splints according to the specific sequence; C) a step of providing the designed polynucleotide fragment molecules and nucleic acid splints; and D) a step of ligating the designed polynucleotide fragment molecules in the presence of the designed nucleic acid splints, wherein the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, the nucleic acid splint is substantially complementary to the polynucleotide molecule, and at least two of the nucleic acid splints contain sequences that are substantially free of deletions when aligned with the specific sequence. It should be understood that the various embodiments described herein can be appropriately combined and applied in any manner described in (Ligation of Polynucleotides Using Nucleic Acid Splints).

[0513] In another aspect, the present disclosure provides a method for producing polypeptide fragments and nucleic acid splints for a polynucleotide molecule having a specific sequence described in this specification. The method includes the following steps: A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; B) a step of designing two or more nucleic acid splints according to the specific sequence; and C) a step of producing the designed polynucleotide fragment molecules and two or more nucleic acid splints, wherein the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, the nucleic acid splint is substantially complementary to the polynucleotide molecule, and at least two of the nucleic acid splints contain sequences that are substantially free of deletions when aligned with the specific sequence. It should be understood that the various embodiments described herein can be appropriately combined and applied in any manner described in (Ligation of Polynucleotides Using Nucleic Acid Splints).

[0514] In another aspect, the present disclosure provides a method for designing polypeptide fragments and nucleic acid splints for producing polynucleotide molecules having a specific sequence, the method comprising the following steps: A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and B) a step of designing two or more nucleic acid splints according to the specific sequence, wherein the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, the nucleic acid splints are substantially complementary to the polynucleotide molecules, and at least two of the nucleic acid splints contain sequences that are substantially free of deletions when aligned with the specific sequence. It should be understood that the various embodiments described herein can be combined and applied as appropriate in any of the ways described in (Ligation of polynucleotides using nucleic acid splints).

[0515] In another aspect, the present disclosure provides a program for causing a computer to execute a method for designing polypeptide fragments and nucleic acid splints for producing polynucleotide molecules having a specific sequence, the method comprising the following steps: A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence, and B) a step of designing two or more nucleic acid splints according to the specific sequence, wherein the sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, the nucleic acid splints are substantially complementary to the polynucleotide molecules, and at least two of the nucleic acid splints contain sequences that are substantially free of deletions when aligned with the specific sequence. It should be understood that the various embodiments described herein can be combined and applied as appropriate in any of the ways described in (Ligation of polynucleotides using nucleic acid splints).

[0516] (Applications in the pharmaceutical field, etc.)

[0517] The present invention can be used as a drug.

[0518] For example, the compositions and methods of the present disclosure can be used for the treatment of individuals in need. In certain embodiments, the individual is a mammal, such as a human, etc., or a non-human mammal. When administered to an animal, such as a human, etc., the composition or compound is preferably administered as a pharmaceutical composition, for example, comprising the compound of the present disclosure and a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include aqueous solutions well known in the art, such as water or buffered saline, or other solvents or excipients, such as oils like ethylene glycol, glycerol, olive oil, or organic esters for injection. In a preferred embodiment, such a pharmaceutical composition, when used for administration to humans, especially by an invasive route (i.e., for example, routes such as injection or implantation that avoid transport or diffusion through the epithelial barrier), the aqueous solution is pyrogen-free or substantially pyrogen-free. For example, excipients can be selected to achieve delayed release of the medicament or selectively target one or more cells, tissues, or organs. The pharmaceutical composition can be in unit dosage forms, such as tablets, capsules (including pellet capsules and gelatin capsules), granules, lyophilized reconstitutes, powders, liquid preparations, syrups, suppositories, or injections, etc. The composition can also be present in a transdermal delivery system, such as a skin patch. The composition can also be present in a liquid preparation suitable for topical administration, such as eye drops, etc.

[0519] The present disclosure can also be widely applied in genome editing technologies. Without limitation, for example, it can be applied to sgRNA used in genome editing, especially in its production (J. Filippova et al., Biochimie 167 2019 49 - 60, Ayal Hendel et al., nature biotechnology 33 2015 985 - 989). Although not wishing to be bound by theory, by using an oligonucleotide or its modified form (oligonucleic acid) containing the modified base of the present disclosure, the activity may be increased, and thus it can be envisaged as one use to ligate fragments of oligonucleic acids containing modified bases synthesized using the technology of the present disclosure for production. As another embodiment, it can also be envisaged to produce the relatively long double-strands described in T. Seya et al., Advanced Drug Delivery Reviews 147 2019 37 - 43 in a manner where the strands serve as templates for each other without using template DNA. Figure 11 )

[0520] As another embodiment, for example, long non-coding RNA (lncRNA), mRNA can be targeted.

[0521] When using the polynucleotide molecules produced by the present disclosure as a drug, the "subjects" to which administration can be considered include, but are not limited to, humans (i.e., males or females of any age group, e.g., pediatric subjects (such as infants, children, adolescents) or adult subjects (such as young people, middle-aged people, or the elderly)) and / or other non-human animals, such as mammals (such as primates (such as cynomolgus monkeys, rhesus monkeys), commercially relevant mammals such as cows, pigs, horses, sheep, goats, cats, and / or dogs) and avians (such as commercially relevant avians, such as chickens, ducks, geese, and / or turkeys), reptiles, amphibians, and fish. In certain embodiments, the non-human animal is a mammal. The non-human animal can be male or female at any stage of development. The non-human animal can be a transgenic animal.

[0522] As used in this specification, unless otherwise specifically defined, the terms "administer treatment", "treatment administered", and "treatment" (in English, treat, treating, treatment) refer to actions that occur during the period when a subject has a disease, disorder, or condition, and are used to reduce the severity of the disease, disorder, or condition or delay or slow down the progression of the disease, disorder, or condition (narrow sense of "treatment" (therapy)), or also include actions that prevent a subject from becoming a disease, disorder, or condition or reduce its severity in the case of actually developing into a disease, disorder, or condition before the subject has the disorder ("prevention").

[0523] Generally speaking, an "effective amount" of a compound refers to an amount that causes a desired biological response, e.g., an amount sufficient to treat a disease, disorder, or condition. Those skilled in the art will of course understand that the effective amount of the compounds of the present disclosure can vary depending on factors such as the desired biological endpoint, the pharmacokinetics of the compound, the disease, disorder, or condition to be treated, the mode of administration, and the age, health, and subject, etc. The effective amount includes both treatment and prophylactic treatment.

[0524] As used in this specification, unless otherwise specifically defined, a "therapeutically effective amount" of a compound refers to an amount sufficient to provide a therapeutic effect when treating a disease, disorder, or condition, or an amount sufficient to delay or alleviate one or more symptoms associated with the disease, disorder, or condition. The therapeutically effective amount of a compound refers to the amount of a therapeutic agent that provides a therapeutic effect when treating a disease, disorder, or condition alone or in combination with other therapies. The term "therapeutically effective amount" can cover an amount that improves the overall therapy, reduces or prevents the symptoms or causes of a disease, disorder, or condition, or enhances the therapeutic effectiveness of other therapeutic agents.

[0525] As used in this specification, unless otherwise specifically defined, a "prophylactically effective amount" of a compound means an amount sufficient to prevent a disease, disorder or condition, or one or more symptoms associated with the disease, disorder or condition, or sufficient to prevent its recurrence. A prophylactically effective amount of a compound means the amount of a therapeutic agent that, alone or in combination with other agents, provides a prophylactic effect when preventing a disease, disorder or condition. The term "prophylactically effective amount" can encompass an amount that improves overall prophylaxis or enhances the prophylactic effectiveness of other prophylactic agents.

[0526] Exemplary diseases, disorders or conditions include, but are not limited to, proliferative, neurological, immunological, endocrine, cardiovascular, hematological, inflammatory and disorders characterized by cell death.

[0527] As used in this specification, proliferative diseases, disorders or conditions include, but are not limited to, cancer, hematopoietic tumors, proliferative breast diseases, pulmonary proliferative disorders, colonic proliferative disorders, hepatic proliferative disorders and ovarian proliferative disorders.

[0528] The oligonucleotides or their modified forms described in this specification can be used in nucleic acid drugs.

[0529] (Method for producing the compound of the present disclosure)

[0530] Regarding the method for producing the compound of the present disclosure below, specific synthesis examples are listed in the examples, but are not limited thereto. Representative schemes are listed below for illustration, but the present disclosure is not limited thereto per se.

[0531] The compounds of the present disclosure can be produced, for example, by the production methods described below, but are not limited thereto. These production methods can be appropriately modified according to the knowledge of those skilled in organic synthetic chemistry. In the following preparation methods, the compounds used as raw materials can be used in the form of their salts as long as they do not interfere with the reaction.

[0532] The polynucleotide fragment molecules and nucleic acid splints of the present disclosure can be prepared, for example, by solid-phase synthesis. More specifically, they can be prepared according to the phosphoramidite method using a nucleic acid synthesizer (nS-8II; manufactured by GeneDesign Co., Ltd., Oligopilot; manufactured by Cytiva). The phosphoramidite method is a method in which three stages of deblocking, coupling, and oxidation are repeated as a cycle until the desired base sequence is obtained. Regarding each reagent, for example, porous glass or polystyrene can be used as the solid-phase carrier, a toluene solution of dichloroacetic acid or a dichloromethane solution of trichloroacetic acid can be used as the deblocking solution, 5-benzylthio-1H-tetrazole can be used as the coupling agent, an iodine solution can be used as the oxidizing agent, and an acetic anhydride solution and an N-methylimidazole solution can be used as the capping solution. Regarding cleavage and deprotection from the solid-phase carrier after solid-phase synthesis, for example, an aqueous ammonia solution, a mixture of an aqueous ammonia solution and ethanol, or a mixture of methylamine and an aqueous ammonia solution can be added. After deprotection of the base moiety and phosphate group and cleavage from the solid-phase carrier, the solid-phase carrier is filtered, and then 2'-hydroxy deprotection is carried out using tetrabutylammonium fluoride or hydrofluoric acid neutralized with triethylamine to prepare the polynucleotide fragment molecules and nucleic acid splints.

[0533] There is no particular limitation on the AMIDITE used in this solid-phase synthesis method. For example, TBDMS AMIDITE (TBDMS RNA Amidites, trade name ChemGenes Corporation), ACE AMIDITE, TOM AMIDITE, CEE AMIDITE, CEM AMIDITE, TEM AMIDITE (review by Chakhmakhcheva: Protective Groups in the Chemical Synthesis of Oligoribonucleotides, Russian Journal of Bioorganic Chemistry, 2013, Vol. 39, No. 1, pp. 1-21), EMM AMIDITE (described in International Publication No. 2013 / 027843), etc., in which R1 in the following structural formula (I) is protected by a tert-butyldimethylsilyl (TBDMS) group, bis(2-acetoxy)methyl (ACE) group, (triisopropylsilyloxy)methyl (TOM) group, (2-cyanoethoxy)ethyl (CEE) group, (2-cyanoethoxy)methyl (CEM) group, p-toluenesulfonylethoxymethyl (TEM) group, (2-cyanoethoxy)methoxymethyl (EMM) group, etc., can also be used.

[0534]

[0535] An in vitro transcription reaction is a reaction that typically uses T7 RNA polymerase or SP6 RNA polymerase to synthesize single-stranded RNA using double-stranded DNA with a promoter region sequence specifically recognized by the enzyme as a template (see, for example, Beckert B, Masquida B. Synthesis of RNA by in vitro transcription. Methods Mol Biol. 2011;703:29-41. doi:10.1007 / 978-1-59745-248-9_3. PMID:21125481.).

[0536] The above has described the present disclosure by showing preferred embodiments for ease of understanding. The following describes the present disclosure based on examples, but the above description and the following examples are provided for illustrative purposes only and not for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is not limited to the specific embodiments described in this specification nor to the examples, but is defined only by the patent claims.

[0537] Examples

[0538] In this example, examples related to the production and use of the compounds of the present disclosure will be described.

[0539] (Example 1) Tracking of ligation reaction when filling gaps in nucleic acid strands without gaps

[0540] In this example, a ligation reaction is carried out using gapless filling of nucleic acid strands. Specifically as follows.

[0541] (Materials and procedures)

[0542] The following reagents and fragments are used.

[0543] · Reagents

[0544] T4 RNA ligase 2 (manufactured by New England biolab, 10 U / μL)

[0545] 1M Tris-HCl (pH 7.5) (manufactured by NIPPON GENE)

[0546] 1M MgCl2 (manufactured by NIPPON GENE)

[0547] 100 mM ATP (manufactured by Fujifilm Wako Pure Chemical Corporation)

[0548] 1M DTT (manufactured by Sigma-Aldrich)

[0549] · Nucleic acid fragments

[0550] · Nucleic acid strand

[0551] (General)

[0552] 1. Sg1 5’-GGAAAUUAGGUGCGCUUGGC-3’ (SEQ ID NO: 1)

[0553] 2. sg2 5’-pGUUUUAGAGCUAGAA-3’ (SEQ ID NO: 2)

[0554] 3. sg3 5’-pAUAGCAAGUUAAAAUAAGG-3’ (SEQ ID NO: 3)

[0555] 4. sg4 5’-pCUAGUCCGUUAUCAACUU-3’ (SEQ ID NO: 4)

[0556] 5. sg5 5’-pGAAAAAGUGGCACC-3’ (SEQ ID NO: 5)

[0557] 6. sg6 5’-pGAGUCGGUGCUUUU-3’ (SEQ ID NO: 6)

[0558] (New method)

[0559] 7. Spsg1 5’-ctaaaacgccaagcgcacctaatttcc-3’ (SEQ ID NO: 7)

[0560] 8. Spsg2 5’-ttttaacttgctatttctagct-3’ (SEQ ID NO: 8)

[0561] 9. Spsg3 5’-ctttttcaagttgataacggactagcctta-3’ (SEQ ID NO: 9)

[0562] 10. Spsg4 5’-aaaagcaccgactcggtgcca-3’ (SEQ ID NO: 10)

[0563] (Existing method 1) 11. Spsg1_16 5’-tctaaaacgccaagcg-3’ (SEQ ID NO: 11)

[0564] 12. Spsg2_14 5’-ttgctatttctagc-3’ (SEQ ID NO: 12)

[0565] 13. Spsg3_18 5’-acggactagccttatttt-3’ (SEQ ID NO: 13)

[0566] 14. Spsg4_14 5’-ctttttcaagttga-3’ (SEQ ID NO: 14)

[0567] 15. Spsg5_14 5’-ccgactcggtgcca-3’ (SEQ ID NO: 15)

[0568] (Existing method 2)

[0569] 16. Spsg1005 5’-aaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaacgccaagcgcacctaatttcc-3’ (SEQ ID NO: 16)

[0570] The nucleic acid combination used is as Figure 1-1 shown.

[0571] The enzyme ligation is carried out according to the following steps.

[0572] (Method of the present disclosure)

[0573] In this example, segmented complementary strand nucleic acid splints were assembled on all RNAs.

[0574] The specific details of the steps are as follows.

[0575] (1) Mix nucleic acid strands 1 - 6 to a final concentration of 25 μM each, and strands 7 - 10 to a final concentration of 37.5 μM each. After heating at 80 °C for 3 minutes, cool to 5 °C over 25 minutes.

[0576] (2) Mix the nucleic acid strands and reaction reagents at the following concentrations.

[0577] 10 μM nucleic acid strands 1 - 6

[0578] 15 μM nucleic acid strands 7 - 10

[0579] [Dilute the solution from (1) 2.5 - fold]

[0580] 50 mM Tris - HCl (pH 7.5)

[0581] 2 mM MgCl2

[0582] 0.4 mM ATP

[0583] 1 mM DTT

[0584] 0.5 U / μL T4 RNA ligase 2

[0585] (3) Carry out the ligation reaction on the solution mixed in (2) at 25 °C.

[0586] (4) Appropriately sample the ligation reaction solution 1, 4, 24, and 48 hours after the start of the reaction, and mix it with an equal volume of 5 mM EDTA solution for subsequent analysis.

[0587] (Comparative Example 1: Existing Method 1)

[0588] Assemble the complementary strand nucleic acid splints starting from the ligation site in the form of several bases each time.

[0589] The details of the steps are as follows.

[0590] (Method)

[0591] (1) Mix nucleic acid strands 1 - 6 to a final concentration of 25 μM each, and nucleic acid strands 11 - 15 to a final concentration of 37.5 μM each. After heating at 80 °C for 3 minutes, cool to 5 °C in 25 minutes.

[0592] (2) Mix the nucleic acid strands and reaction reagents at the following concentrations.

[0593] 10 μM nucleic acid strands 1 - 6

[0594] 15 μM nucleic acid strands 11 - 15

[0595] [Dilute the solution in (1) 2.5 times.]

[0596] 50 mM Tris - HCl (pH 7.5)

[0597] 2 mM MgCl2

[0598] 0.4 mM ATP

[0599] 1 mM DTT

[0600] 0.5 U / μL T4 RNA ligase 2

[0601] (3) Allow the solution mixed in (2) to undergo a ligation reaction at 25 °C.

[0602] (4) Appropriately sample the ligation reaction solution 1, 4, 24, and 48 hours after the start of the reaction, and mix it with an equal volume of 5 mM EDTA solution for subsequent analysis.

[0603] (Comparative Example 2: Existing Method 2)

[0604] Except for using a single - stranded long - chain complementary strand nucleic acid splint, substantially the same conditions as in the above - mentioned example are adopted.

[0605] (Method)

[0606] The details of the steps are as follows.

[0607] (1) Mix nucleic acid strands 1 - 6 to a final concentration of 25 μM each, and mix nucleic acid strands 16 to a final concentration of 37.5 μM each. After heating at 80 °C for 3 minutes, cool to 5 °C over 25 minutes.

[0608] (2) Mix the nucleic acid strands and reaction reagents at the following concentrations.

[0609] 10 μM nucleic acid strands 1 - 6

[0610] 15 μM nucleic acid strands 16

[0611] [Dilute the solution from (1) 2.5 - fold.]

[0612] 50 mM Tris - HCl (pH 7.5)

[0613] 2 mM MgCl2

[0614] 0.4 mM ATP

[0615] 1 mM DTT

[0616] 0.5 U / μL T4 RNA ligase 2

[0617] (3) Carry out a ligation reaction on the solution mixed in (2) at 25 °C.

[0618] (4) Appropriately sample the ligation reaction solution 1, 4, 24, and 48 hours after the start of the reaction, and mix with an equal volume of 5 mM EDTA solution for subsequent analysis.

[0619] (Denaturing PAGE)

[0620] Details of the steps are as follows.

[0621] (1) Mix 1 μL of the enzyme ligation reaction sample with formamide containing bromophenol blue, and heat at 80 °C for 5 minutes. Immediately quench the heated sample in ice.

[0622] (2) Load 2 μL of the solution from (1) onto an 8% acrylamide gel containing 7.5 M urea and 1xTBE, and electrophorese at 300 V for 20 minutes using 1xTBE buffer.

[0623] (3) Stain the electrophoresed gel with ethidium bromide and then take a photo using a transilluminator.

[0624] (Determination based on UHPLC, LC - MS)

[0625] Details of the steps are as follows.

[0626] Analyze the enzyme ligation reaction solution from which the enzyme protein has been removed by phenol, chloroform extraction, etc. by UHPLC and LC - MS under the following conditions.

[0627] · Column: ACQUITY UPLC Oligonucleotide BEH C18 Column, 130A, 1.7μm, 2.1mm x 100mm

[0628] · Mobile phase: A) 100 mM hexafluoro - 2 - propanol (HFIP) - 8 mM triethylamine (TEA), B) methanol (MeOH)

[0629] · Analysis conditions: B 5 - 20%, 60 min, 80 °C, 0.2 ml / min

[0630] (Reaction tracking by UHPLC)

[0631] Details of the steps are as follows

[0632] Perform UHPLC analysis according to the following conditions.

[0633] · Column: ACQUITY UPLC Oligonucleotide BEH C18 Column, 130A, 1.7μm, 2.1mm x 100mm

[0634] · Mobile phase: A) 100 mM hexafluoro - 2 - propanol (HFIP) - 8 mM triethylamine (TEA), B) methanol (MeOH)

[0635] · Analysis conditions: B 5 - 20%, 60 min, 80 °C, 0.2 ml / min

[0636] (Results)

[0637] The results of enzymatic ligation of 100 - mer ssRNA (short - chain RNA) in 6 segments by RNA ligase 2 are as Figure 1-2 shown.

[0638] In addition, the results of denaturing PAGE are shown in Figure 1

[0639] As Figure 1-2 shown, it can be clarified that in the new method, compared with the existing method 1, the ligation reaction product of 100 - mer is generated in a short time.

[0640] In addition, the measurement results based on HPLC and LC - MS are as Figure 2 shown.

[0641] The theoretical molecular weight of the target product in this experiment is 32285.2. The measured mass in LC - MS analysis is 32285.5. Therefore, it can be clarified that the enzymatic ligation product in this experiment is the target 100 - mer RNA.

[0642] Next, the results of reaction tracking by UHPLC are shown in Table 1 and Figure 3 as follows.

[0643] The UHPLC area % of the 100mer enzyme ligation product in this experiment is as Figure 3 shown. Compared with the existing methods 1 and 2, the reaction rate is high in the case of the ligation reaction by the new method.

[0644] [Table 1]

[0645]

[0646] (Example 2) Example using modified bases (PS-modified, 2'-OMe, 2'-F, etc.)

[0647] Next, the same ligation experiment was carried out using modified bases (PS-modified, 2'-OMe, 2'-F, etc.).

[0648] The steps are shown below.

[0649] (Materials)

[0650] The oligonucleic acids used

[0651] [Table 2]

[0652]

[0653] Sequence symbol: Upper Case = RNA / N(M) = 2'-OMe RNA / N(F) = 2'-F RNA / N(L) = LNA / N(E) = BNA C-NMe / N(m) = 2'-MOE / p = Phosphorylation / ^ = Phosphorothioated

[0654] The nucleic acid combinations in the ligation reaction are as follows.

[0655] [Table 3]

[0656] RNA fragments used Natural type 1，2，3，4，5，6 Terminal PS, 2'-OMe modified 2，3，4，5，7，8 Highly modified 1 9，10，11，12，13，14 Highly modified 2 9，10，13，14，15，16 Highly modified 3 - containing LNA 9，11，12，13，14，17 Highly modified 4 - containing BNA-NC(N-Me) 9，11，12，13，14，18 Highly modified 5 - containing 2'-MOE 9，11，12，13，14，19

[0657] The sequence after the ligation reaction is as follows.

[0658] [Table 4-1]

[0659]

[0660] [Table 4-2]

[0661]

[0662] (Steps)

[0663] sgRNA with 2'-O-methylation at around 3 to 5 bases at both the 5'- and 3'-ends (Hendel et al., Nat Biotechnol, 33; 985-989, 2015): Although there is no report on highly modified sgRNA, it is shown that highly modified sgRNA can be synthesized by referring to, for example, modified two-piece guide RNA (Mir et al., Nat Commun, 9; 2641, 2018).

[0664] The details of the steps are as follows.

[0665] (1) Mix nucleic acid strands 1 to 19 described in Table 2 according to the combinations in Table 3 to a final concentration of 25 μM each, and mix nucleic acid strands 20 to 23 to a final concentration of 37.5 μM each. After heating at 80 °C for 3 minutes, cool to 5 °C in 25 minutes.

[0666] (2) Mix the nucleic acid strands and reaction reagents at the following concentrations.

[0667] 10 μM nucleic acid strands 1 to 19 (combinations in Table 3)

[0668] 15 μM nucleic acid strands 20 to 23

[0669] [Dilute the solution in (1) 2.5-fold]

[0670] 50 mM Tris-HCl (pH 7.5)

[0671] 2 mM MgCl2

[0672] 0.4 mM ATP

[0673] 1 mM DTT

[0674] 0.5 U / μL T4 RNA ligase 2

[0675] (3) Allow the solution mixed in (2) to undergo a ligation reaction at 25 °C.

[0676] (4) Appropriately sample the ligation reaction solution 1, 4, 24, and 48 hours after the start of the reaction, and mix with an equal volume of 5 mM EDTA solution for subsequent analysis.

[0677] (Results)

[0678] Use the reaction product 48 hours after the start of the reaction for LC-MS analysis.

[0679] The results are as follows.

[0680] [Table 5]

[0681]

[0682] As described above, long-chain nucleic acids containing modified nucleic acids can also be ligated by this method.

[0683] The RNA synthesized by this method can be used, for example, for the cleavage and editing of genomic DNA based on the CRISPR-Cas9 method. Specifically, a 100-mer RNA synthesized by this method and a double-stranded DNA of any length with 20 bases at its 5'-end as the target are mixed with Cas9 protein in a suitable buffer, and the cleavage activity of the DNA can be studied. In addition, the RNA-Cas9 complex can be administered to cultured cells and organisms using a suitable DDS to edit genomic DNA.( Figure 12 )。

[0684] (Example 4) Enzymatic ligation of ssRNA 220-mer in 10 segments by RNA ligase 2

[0685] Next, enzymatic ligation of ssRNA 220-mer in 10 segments by RNA ligase 2 was performed.

[0686] Details are as follows.

[0687] (Materials)

[0688] Except for using the nucleic acid fragments shown in Table 6 below, the procedure was the same as in Example 1.

[0689] (Steps)

[0690] Except for using the nucleic acid fragments shown in Table 6 below, the procedure was the same as in Example 1.

[0691] [Table 6]

[0692] U3-1_1 GGGAAGACUAUACUUUCAGGGAUCA (SEQ ID NO: 47) U3-2_2 p UUUCUAUAGUGUGUUACUAGA (SEQ ID NO: 48) U3-3_2 p GAAGUUUCUCUGAACGUGUAGAGC (SEQ ID NO: 49) U3-4_1 p ACCGAAAACCACGAGGAAGAG (SEQ ID NO: 50) U3-5_1 p AGGUAGCGUUUUCUCCUGAGCGUGA (SEQ ID NO: 51) U3-6_1 p AGCCGGCUUUCUGGCGUUG (SEQ ID NO: 52) U3-7_1 p CUUGGCUGCAACUGCCGUCAGCCAU (SEQ ID NO: 53) U3-8_1 p UGAUGAUCGUUCUUCUCUC (SEQ ID NO: 54) U3-9_1 p CGUAUUGGGGAGUGAGAGGGAGAGA (SEQ ID NO: 55) U3-10_1 p ACGCGGUCUGAGUGGU (SEQ ID NO: 56)

[0693] [Table 7]

[0694] SpU3-1_1 tgaaagtatagtcttccc (SEQ ID NO: 57) SpU3-2_1 acttctctagtaacacactatagaaatgatccc (SEQ ID NO: 58) SpU3-3_1 acgttcagagaa (SEQ ID NO: 59) SpU3-4_2 tacctctcttcctcgtggttttcggtgctctac (SEQ ID NO: 60) SpU3-5_2 aggagaaaacgc (SEQ ID NO: 61) SpU3-6_1 ccaagcaacgccagaaagccggcttcacgctc (SEQ ID NO: 62) SpU3-7_1 acggcagttgcag (SEQ ID NO: 63) SpU3-8_1 aatacggagagaagaacgatcatcaatggctg (SEQ ID NO: 64) SpU3-9_1 ctctcactcccc (SEQ ID NO: 65) SpU3-10_1 accactcagaccgcgttctctcc (SEQ ID NO: 66)

[0695] (Results)

[0696] Figure 4 The results of denaturing PAGE are shown.

[0697] The fragments in 10 segments were used for the enzymatic ligation reaction. The product after 72 hours of reaction was analyzed by denaturing PAGE. As a control, an in vitro transcription product with the same sequence as the ligation product was analyzed simultaneously. The results are as Figure 4 shown. An enzymatic ligation product considered to be the same as the 220-mer transcription product was confirmed.

[0698] Next, the results of UHPLC and LC-MS are as Figure 5 shown.

[0699] The theoretical molecular weight of the target product in this experiment was 71035.9. The measured mass in LC-MS analysis was 71035.3. Therefore, it was clear that the enzyme ligation product in this experiment was the target 220mer RNA.

[0700] (Example 5) Experiments Based on Various Sequences

[0701] Next, experiments based on various sequences were conducted. The experiments were carried out using the sequences shown in Table 3. (Some used the sequences of the above examples)

[0702] Details are as follows.

[0703] (Materials)

[0704] Except for using the nucleic acid splints shown in Table 8, it was the same as in Example 4.

[0705] [Table 8]

[0706] ①

[0707] SpU3-1_1 tgaaagtatagtcttccc (SEQ ID NO: 67) SpU3-2_1 acttctctagtaacacactatagaaatgatccc (SEQ ID NO: 68) SpU3-3_1 acgttcagagaa (SEQ ID NO: 69) SpU3-4_2 tacctctcttcctcgtggttttcggtgctctac (SEQ ID NO: 70) SpU3-5_2 aggagaaaacgc (SEQ ID NO: 71) SpU3-6_1 ccaagcaacgccagaaagccggcttcacgctc (SEQ ID NO: 72) SpU3-7_1 acggcagttgcag (SEQ ID NO: 73) SpU3-8_1 aatacggagagaagaacgatcatcaatggctg (SEQ ID NO: 74) SpU3-9_1 ctctcactcccc (SEQ ID NO: 75) SpU3-10_1 accactcagaccgcgttctctcc (SEQ ID NO: 76)

[0708] [Table 9]

[0709] ②

[0710] SpU3-1_13 tgaaagtatagtc (SEQ ID NO: 77) SpU3-2_1 acttctctagtaacacactatagaaatgatccc (SEQ ID NO: 78) SpU3-3_1 acgttcagagaa (SEQ ID NO: 79) SpU3-4_2 tacctctcttcctcgtggttttcggtgctctac (SEQ ID NO: 80) SpU3-5_2 aggagaaaacgc (SEQ ID NO: 81) SpU3-6_1 ccaagcaacgccagaaagccggcttcacgctc (SEQ ID NO: 82) SpU3-7_1 acggcagttgcag (SEQ ID NO: 83) SpU3-8_1 aatacggagagaagaacgatcatcaatggctg (SEQ ID NO: 84) SpU3-9_1 ctctcactcccc (SEQ ID NO: 85) SpU3-10_18 tcagaccgcgttctctcc (SEQ ID NO: 86)

[0711] [Table 10]

[0712] ③

[0713] SpU3-2_1 acttctctagtaacacactatagaaatgatccc (SEQ ID NO: 87) SpU3-42 tacctctcttcctcgtggttttcggtgctctac (SEQ ID NO: 88) SpU3-6_1 ccaagcaacgccagaaagccggcttcacgctc (SEQ ID NO: 89) SpU3-8_1 aatacggagagaagaacgatcatcaatggctg (SEQ ID NO: 90) SpU3-10_1 accactcagaccgcgttctctcc (SEQ ID NO: 91)

[0714] [Table 11]

[0715] ④

[0716] SpU3-1_18 ctatagaaatgatccctg (SEQ ID NO: 92) SpU3-2_18 agaaacttctctagtaac (SEQ ID NO: 93) SpU3-3_18 gttttcggtgctctacac (SEQ ID NO: 94) SpU3-4_18 acgctacctctcttcctc (SEQ ID NO: 95) SpU3-5_18 aagccggcttcacgctca (SEQ ID NO: 96) SpU3-6_18 gcagccaagcaacgccag (SEQ ID NO: 97) SpU3-7_18 cgatcatcaatggctgac (SEQ ID NO: 98) SpU3-8_18 cccaatacggagagaaga (SEQ ID NO: 99) SpU3-9_18 agaccgcgttctctccct (SEQ ID NO: 100)

[0717] [Table 12]

[0718] ⑤

[0719] SpU3-1_4 gaaagtatagtcttcc (SEQ ID NO: 101) SpU3-2_4 cttctctagtaacacactatagaaatgatcc (SEQ ID NO: 102) SpU3-3_4 cgttcagaga (SEQ ID NO: 103) SpU3-4_4 acctctcttcctcgtggttttcggtgctcta (SEQ ID NO: 104) SpU3-5_4 ggagaaaacg (SEQ ID NO: 105) SpU3-6_4 caagcaacgccagaaagccggcttcacgct (SEQ ID NO: 106) SpU3-7_4 cggcagttgca (SEQ ID NO: 107) SpU3-8_4 atacggagagaagaacgatcatcaatggct (SEQ ID NO: 108) SpU3-9_4 tctcactccc (SEQ ID NO: 109) SpU3-10_4 ccactcagaccgcgttctctc (SEQ ID NO: 110)

[0720] (Steps)

[0721] Except for using the nucleic acid splints shown in Tables 8 to 12, it was the same as in Example 4.

[0722] 1 was an experiment using the same nucleic acid splint as in Example 4 (the nucleic acid splint formed base pairs with all fragments).

[0723] 2 was an experiment in which the chain lengths of the 5' and 3' terminal nucleic acid splints were shortened by 5 bases.

[0724] 3 is an experiment using only long chains of 23 - 33 mers in a nucleic acid splint.

[0725] 4 is an experiment forming base pairs with 9 mers before and after the ligation site.

[0726] 5 is an experiment shortening both ends of the nucleic acid splint by 1 base.

[0727] The sequences used are as Figure 6-1 shown.

[0728] (Results)

[0729] The results of denaturing PAGE are as Figure 6-2 shown.

[0730] The results of denaturing PAGE of the enzyme ligation product in Example 5 are shown. Compared with 1, in the test of 2, the amount of the full-length product did not change. That is, it shows that even if the two ends of the nucleic acid splint are shortened relative to the full length, the ligation reaction proceeds equally. In the test of 3, the amount of the full-length product decreased significantly. It shows that the nucleic acid splint not related to the ligation part is also important for the ligation reaction. In the test of 4, the amount of the full-length reaction product decreased slightly. In addition, the side reaction products against the molecular weight increased. In the test of 5, the amount of the full-length product decreased significantly. It can be concluded that when there is a gap in the double-strand formation between the nucleic acid splint and the RNA fragment, the reaction is difficult to proceed.

[0731] (Example 6) Enzyme ligation of ssRNA 560 mer in 28 segments with RNA ligase 2

[0732] Next, enzyme ligation of ssRNA 560 mer in 28 segments with RNA ligase 2 was carried out. The sequence information is shown in Tables 13 and 14.

[0733] Details are as follows.

[0734] (Materials)

[0735] [Table 13]

[0736]

[0737] [Table 14]

[0738]

[0739] The sequences used are as Figure 7-1 shown.

[0740] (Procedure)

[0741] (1) After mixing the RNA strand and the nucleic acid splint, heat at 80 °C for 3 minutes and then cool to 5 °C in 25 minutes.

[0742] (2) Mix the nucleic acid strands and reaction reagents at the following concentrations.

[0743] 1 (total 560mer)

[0744] 1 μM RNA nucleic acid strands 1 - 28, 28 kinds

[0745] 1.5 μM nucleic acid splints 1 - 28, 28 kinds

[0746] 50 mM Tris - HCl (pH 7.5)

[0747] 2 mM MgCl2

[0748] 0.4 mM ATP

[0749] 1 mM DTT

[0750] 5% PEG8000

[0751] 0.5 U / μL T4 RNA ligase 2

[0752] 2_1 - 10 (total 200mer)

[0753] 2.8 μM RNA nucleic acid strands 1 - 10, 10 kinds

[0754] 4.2 μM nucleic acid splints 1 - 10, 10 kinds

[0755] 50 mM Tris - HCl (pH 7.5)

[0756] 2 mM MgCl2

[0757] 0.4 mM ATP

[0758] 1 mM DTT

[0759] 5% PEG8000

[0760] 0.5 U / μL T4 RNA ligase 2

[0761] 2_11 - 19 (total 185mer)

[0762] 3.1 μM RNA nucleic acid strands 11 - 19, 9 kinds

[0763] 4.7 M nucleic acid splints 11 - 19, 9 kinds

[0764] 50 mM Tris - HCl (pH 7.5)

[0765] 2 mM MgCl2

[0766] 0.4 mM ATP

[0767] 1 mM DTT

[0768] 5% PEG8000

[0769] 0.5 U / μL T4 RNA ligase 2

[0770] 2_20 - 28 (total 175 mer)

[0771] 3.1 μM RNA nucleic acid strand 20 - 28, 9 kinds

[0772] 4.7 M nucleic acid splint 20 - 28, 9 kinds

[0773] 50 mM Tris - HCl (pH 7.5)

[0774] 2 mM MgCl2

[0775] 0.4 mM ATP

[0776] 1 mM DTT

[0777] 5% PEG8000

[0778] 0.5 U / μL T4 RNA ligase 2

[0779] (3) Incubate the solution mixed in (2) at 25 °C for ligation reaction.

[0780] (4) After 16 hours from the start of the reaction, mix the reaction solutions of 2 to make the composition the same as that of 1, and continue the reaction. The scheme is shown in Table 4.

[0781] [Table 15]

[0782]

[0783] (In vitro translation)

[0784] (1) Use the purified ligation product for in vitro translation. Use PUREfrex (registered trademark) 2.0 (manufactured by Genefrontier Corporation), and mix the reagents and RNA according to the method recommended by the manufacturer.

[0785] (2) React at 37 °C for 6 hours.

[0786] (3) Store the product after the reaction at -30 °C for subsequent measurement.

[0787] (Luciferase assay)

[0788] (1) The translation product was mixed with the Nano-Glo® Lusiferase Assay System (manufactured by Promega), and the luminescence intensity was measured using GloMax Explorer (manufactured by Promega).

[0789] (Result)

[0790] The results of denaturing PAGE and the activity assay are shown in Figure 7.

[0791] In both Tests 1 and 2, the full-length reaction product of 560mer was confirmed. It was confirmed that the amount of the full-length reaction product was larger in Test 2. After purifying the ligation reaction product of 2 by HPLC, the purified product was used for in vitro translation reaction. When the translation solution was used for luciferase assay to measure the luminescence activity, luminescence was observed, and it was determined that the protein translated from the ligation reaction product was active.

[0792] (Example 7) Comparison of the lengths of polynucleotide fragment molecules and the spacing of nucleic acid splints

[0793] In this example, experiments were conducted to compare the lengths of polynucleotide fragment molecules and to study the spacing of nucleic acid splints.

[0794] (Materials and procedures)

[0795] (Materials)

[0796] [Table 16-1]

[0797]

[0798] [Table 16-2]

[0799]

[0800] The sequences used were as Figure 8-1 and Figure 8-2 shown.

[0801] (Procedures)

[0802] Except for using the nucleic acid fragments shown in Table 16 above, the procedure was the same as in Example 1. The combinations of nucleic acid fragments used are shown in Table 17.

[0803] [Table 17]

[0804] RNA Nucleic acid splint ① 1～10 13～22 ⑤ 1～10 23～32 ⑥ 1～10 14，16，18、20，22，23，25，27，29，31 ⑦ 1～10 13，15，17，19，21，24，，26，28，30，32 ④ 1～10 33～41 ⑧ 1～10 42～52 ⑨ 2～10、11 13，53，17～22 ⑩ 1、3～10、12 13，53，17～22

[0805] (Result)

[0806] The results of denaturing PAGE were as Figure 6-2 shown. An enzyme ligation product considered to be the same as the 220mer transcript was confirmed.

[0807] (Example 8: Ligation of Transcription Products and Chemically Synthesized RNAs Using a DNA Splint)

[0808] Next, a DNA splint was used to ligate the transcription product and the chemically synthesized RNA.

[0809] In this example, a ligation reaction was carried out using a combination of a long-chain RNA synthesized by transcription and a chemically synthesized RNA, and an attempt was made to apply it to the synthesis of a longer-chain RNA. In addition, by assembling the DNA splint outside the ligation site as well, the change in ligation efficiency was investigated, thereby confirming the superiority of this method.

[0810] (Procedure)

[0811] (Chemical Synthesis)

[0812] (1) Oligonucleic acids other than NL537-p were synthesized by a conventional method of the phosphoramidite method.

[0813] (Transcriptional Synthesis of 537mer RNA)

[0814] (1) A transcriptional synthesis template dsDNA with a T7 promoter sequence added to the 5'-end side was synthesized by the PCR method.

[0815] (2) Using the template synthesized in (1), 537mer RNA was synthesized by in vitro transcription.

[0816] (3) The RNA synthesized in (2) was treated with RppH pyrophosphatase (manufactured by New England Biolabs) to convert the 5'-end of the RNA into a monophosphate.

[0817] (Ligation Reaction)

[0818] (1) After mixing the RNA strand and the nucleic acid splint, it was heated at 80 °C for 3 minutes and then cooled to 5 °C over 25 minutes.

[0819] (2) The nucleic acid strands and reaction reagents were mixed at the following concentrations.

[0820] (1) After mixing the RNA strand and the nucleic acid splint, it was heated at 80 °C for 3 minutes and then cooled to 5 °C over 25 minutes.

[0821] (2) The nucleic acid strands and reaction reagents were mixed at the following concentrations.

[0822] 1 (total 560mer)

[0823] 1 μM RNA nucleic acid strands, 37 types (see the table below)

[0824] 37 types of 1.5 μM nucleic acid splints (see the following table)

[0825] 50 mM Tris-HCl (pH 7.5)

[0826] 2 mM MgCl2

[0827] 0.4 mM ATP

[0828] 1 mM DTT

[0829] 5% PEG8000

[0830] (3) Carry out a ligation reaction on the solution mixed in (2) at 25°C.

[0831] (Denaturing PAGE)

[0832] Details of the steps are as follows.

[0833] (1) Mix 1 μL of the enzyme ligation reaction sample with formamide containing bromophenol blue and heat at 80°C for 5 minutes. Immediately quench the heated sample in ice.

[0834] (2) Load 2 μL of the solution in (1) onto a 5% acrylamide gel containing 7.5 M urea and 1xTBE, and electrophorese at 300 V for 15 minutes or 70 minutes using 1xTBE buffer.

[0835] (3) Stain the electrophoresed gel with SYBR Gold (manufactured by Thermo fisher) and photograph it with a transilluminator.

[0836] (4) Measure the band intensity of the ligation product in the photographed electrophoretic image and numericalize the relative intensity.

[0837] Details of the steps are as Figure 13 shown.

[0838] Schematic diagrams of the target product and the starting material are as Figure 14 shown.

[0839] (Ligation reaction experiment of transcription product and chemically synthesized RNA using DNA splint)

[0840] Next, an overview of the ligation reaction experiment of the transcription product and the chemically synthesized RNA using the DNA splint is shown ( Figure 15 ).

[0841] The following shows the sequence information used.

[0842] [Table 18]

[0843]

[0844] [Table 19]

[0845]

[0846] [Table 20]

[0847]

[0848] [Table 21]

[0849] 25 SpNL-3_1 ccccaacgaaatctt SEQ ID NO: 141 26 SpNL-4_1 gttgtagccggctgtctgtcgccagt SEQ ID NO: 142 27 SpNL-5_1 aggacttggtccag SEQ ID NO: 143 28 SpNL-6_1 caaactggacacacctccctgttca SEQ ID NO: 144 29 SpNL-7_1 cccgagattctgaaa SEQ ID NO: 145 30 SpNL-8_1 tcctttggatcggagttacggacac SEQ ID NO: 146 31 SpNL-9_1 accgctcaggacaa SEQ ID NO: 147 32 SpNL-10_1 tggatgtcgatcttcagcccattttc SEQ ID NO: 148 33 SpNL-11_2 cgggatgatgaca SEQ ID NO: 149 34 SpNL-12_2 ccatttggtcgccgctcagaccttcata SEQ ID NO: 150 35 SpNL-13_1 aaaattttttcgatctggc SEQ ID NO: 151 36 SpNL-14_2 catccacagggtacaccacctta SEQ ID NO: 152 37 SpNL-15_2 atcaccttaaagtgatgat Serial number 153 38 SpNL-16_2 agtgtgccatagtgcagg Serial number 154 39 SpNL-17_1 accccgtcgattacc Serial number 155 40 SpNL-18_1 cgaaatagtcgatcatgttcggcgta Serial number 156 41 SpNL-19_1 ttcatacggccgtc Serial number 157 42 SpNL-20_1 ttttgccgtcgaacacggcgatgcc Serial number 158 43 SpNL-21_1 gttacagtgatct Serial number 159 44 SpNL-22_1 attttgttgccgttccacagggtccct Serial number 160 45 SpNL-23_1 aggcgctcgtcgata Serial number 161 46 SpNL-24_1 acagcagggagccgtcggggttgatc Serial number 162 47 SpNL-25_1 gatggttactcgga Serial number 163 48 SpNL-26_1 agccgccagccggtcactccgtt Serial number 164 49 SpNL-27_1 ccagaatgcgttcgcac Serial number 165

[0850] (Result)

[0851] The result is as Figure 16 shown.

[0852] In this embodiment, as Figure 16 shown, the ligation of 36 fragments, totaling 790 mer, was achieved. Using a method other than the RNA synthesis method based on the ligation of transcription-synthesized RNA and chemically synthesized RNA, a product (1) longer than that of the above-described embodiment (560 mer) can be synthesized. As Figure 16 shown, it was determined that the ligation reaction also proceeds when a DNA splint is assembled not only at the ligation site (2). In addition, if a complementary strand is not assembled outside the ligation site, the ligation reaction hardly proceeds. It was also determined that non-specific ligation is also caused (3).

[0853] Thus, the superiority of the method of the present disclosure in which a DNA splint is assembled for all RNA sequences was demonstrated.

[0854] From the results of this embodiment, it can be understood that, although not limited, for long-chain RNA, the ligation reaction easily proceeds when a DNA splint is assembled for all parts except the ligation site. In addition, it should be understood that, although not limited, if a complementary strand is not assembled outside the ligation site, the ligation reaction hardly proceeds, and in addition, non-specific ligation is also caused, and thus it is not preferred. Although not limited, it was shown that even in the ligation reaction of a transcription product having a relatively long chain length, it is effective to assemble a complementary strand for all parts of the long-chain RNA using a short-chain DNA splint.

[0855] (Ligation of a transcription product and chemically synthesized RNA using a DNA splint)

[0856] As Figure 17 shown, an experiment was conducted to ligate a transcription product and chemically synthesized RNA using a DNA splint. Among them, how the reaction would change when a part of the DNA splint was removed was investigated. Roughly as follows.

[0857] As Figure 17As shown in Test Areas 1 to 27, experiments were conducted to sequentially remove DNA clamps one by one from 25 fragments of complementary strands that were assembled except for the part for ligating and transcriptionally synthesizing long-chain RNA. That is, experiments were conducted in such a way that DNA clamp of complementary strands was not assembled except for the part for ligating and transcriptionally synthesizing long-chain RNA.

[0858] The combinations of its DNA clamps are as follows.

[0859] (Test Area, Nucleic Acid Sequence Number Used)

[0860] [Table 22]

[0861] Test area number RNA DNA splint 1 1～11、13 14～49 2 1～11、13 14～24 3 1～11、13 14～24、26～49 4 1～11、13 14～25、27～49 5 1～11、13 14～26、28～49 6 1～11、13 14～27、29～49 7 1～11、13 14～28、30～49 8 1～11、13 14～29、31～49 9 1～11、13 14～30、32～49 1O 1～11、13 14～31、33～49 11 1～11、13 14～32、34～49 12 1～11、13 14～33、35～49 13 1～11、13 14～34、36～49 14 1～11、13 14～35、37～49 15 1～11、13 14～36、38～49 16 1～11、13 14～37、39～49 17 1～11、13 14～38、40～49 18 1～11、13 14～39、41～49 19 1～11、13 14～40、42～49 20 1～11、13 14～41、43～49 21 1～11、13 14～42、44～49 22 1～11、13 14～43、45～49 23 1～11、13 14～44、46～49 24 1～11、13 14～45、47～49 25 1～11、13 14～46、48～49 26 1～11、13 14～47、49 27 1～11、13 14～48

[0862] (Results)

[0863] The results are as Figure 18 shown. Figure 18 The modified PAGE results and relative band intensities are shown. As shown in the figure, the results of the experiment in which DNA clamps were sequentially removed from 25 fragments of complementary strands that were assembled except for the part for ligating and transcriptionally synthesizing long-chain RNA showed that when there was a part where DNA clamp was not assembled, the reaction efficiency varied depending on its position.

[0864] In addition, when there was a part where DNA clamp was not assembled near the ligation site, a decrease in reaction efficiency was observed. Although it can be considered that the decrease in this reaction efficiency is within an acceptable range, considering the time and cost for studying which position of the DNA clamp can be removed, it is considered that the efficiency of assembling outside the part for ligating and transcriptionally synthesizing long-chain RNA is relatively high.

[0865] (Example 9: Preparation Example)

[0866] The compounds of the present disclosure can be provided in appropriate dosage forms. One example is shown below.

[0867] Tablets, capsules, powders, granules, liquid preparations, suspensions, injections, patches, wet compresses, etc. can be cited. In addition, these preparations can be manufactured by a known method including steps such as using additives used as conventional pharmaceutical excipients and appropriately mixing them.

[0868] (Example 10: Animal Experiment)

[0869] Mice suffering from a disease (for example, tumor-bearing mice) were used, and the polynucleotide of the present disclosure or a placebo was administered intraperitoneally.

[0870] Then, a comparison between the placebo and the polynucleotide can be made to evaluate the effectiveness of the polynucleotide of the present disclosure against diseases in mice.

[0871] (Supplementary Note)

[0872] As described above, the preferred embodiments of the present disclosure have been exemplified, but it should be understood that the scope of the present disclosure is defined only by the claims. It should be understood that the contents of patents, applications and other documents cited in this specification should be cited as references in this specification as if their contents were specifically recited in this specification. This application claims the priority of Japanese Patent Application No. 2022-138632 filed with the Japan Patent Office on August 31, 2022, and all of its contents are incorporated herein by reference as needed.

[0873] Industrial Applicability

[0874] The technology provided by the present disclosure can be used in all fields that utilize polynucleotide ligation technology.

[0875] Sequence Listing Free Text

[0876] Sequence No. 1: sg1

[0877] Sequence No. 2: sg2

[0878] Sequence No. 3: sg3

[0879] Sequence No. 4: sg4

[0880] Sequence No. 5: sg5

[0881] Sequence No. 6: sg6

[0882] Sequence No. 7: Spsg1

[0883] Sequence No. 8: Spsg2

[0884] Sequence No. 9: Spsg3

[0885] Sequence No. 10: Spsg4

[0886] Sequence No. 11: Spsg1_16

[0887] Sequence No. 12: Spsg2_14

[0888] Sequence No. 13: Spsg3_18

[0889] Sequence No. 14: Spsg4_14

[0890] Sequence No. 15: Spsg5_14

[0891] Sequence No. 16: Spsg100

[0892] Sequence No. 17: sg1_1

[0893] Sequence No. 18: sg2_1

[0894] Serial number 19: sg3_1

[0895] Serial number 20: sg4_1

[0896] Serial number 21: sg5_1

[0897] Serial number 22: sg6_1

[0898] Serial number 23: sg1_1_PS_OMe_3

[0899] Serial number 24: sg6_1_PS_OMe_3

[0900] Serial number 25: sg1_1_C20

[0901] Serial number 26: sg2_1_C20

[0902] Serial number 27: sg3_1_T2

[0903] Serial number 28: sg4_1_T2

[0904] Serial number 29: sg5_1_T2

[0905] Serial number 30: sg6_1_T2

[0906] Serial number 31: sg3_1_T8

[0907] Serial number 32: sg4_1_T8

[0908] Serial number 33: sg2_1_C20_LNA

[0909] Serial number 34: sg2_1_C20_BNA

[0910] Serial number 35: sg2_1_C20_MOE

[0911] Serial number 36: Spsg1_2

[0912] Serial number 37: Spsg2_2

[0913] Serial number 38: Spsg_3_1

[0914] Serial number 39: Spsg_4_1

[0915] Serial number 40: Natural type

[0916] Serial number 41: Terminal PS, 2'-OMe modified

[0917] Serial number 42: Highly modified 1.

[0918] Serial number 43: Highly modified 2.

[0919] Serial number 44: Highly modified 3. Containing LNA

[0920] Serial number 45: Highly modified 4. Containing BNA-NC(N-Me)

[0921] Serial number 46: Highly modified 5. Containing 2’-MOE

[0922] Serial number 47: U3-1_1

[0923] Serial number 48: U3-2_2

[0924] Serial number 49: U3-3_2

[0925] Serial number 50: U3-4_1

[0926] Serial number 51: U3-5_1

[0927] Serial number 52: U3-6_1

[0928] Serial number 53: U3-7_1

[0929] Serial number 54: U3-8_1

[0930] Serial number 55: U3-9_1

[0931] Serial number 56: U3-10_1

[0932] Serial number 57: SpU3-1_1

[0933] Serial number 58: SpU3-2_1

[0934] Serial number 59: SpU3-3_1

[0935] Serial number 60: SpU3-4_2

[0936] Serial number 61: SpU3-5_2

[0937] Serial number 62: SpU3-6_1

[0938] Serial number 63: SpU3-7_1

[0939] Serial number 64: SpU3-8_1

[0940] Serial number 65: SpU3-9_1

[0941] Serial number 66: SpU3-10_1

[0942] Serial number 67: SpU3-1_1

[0943] Serial number 68: SpU3-2_1

[0944] Serial number 69: SpU3-3_1

[0945] Serial number 70: SpU3-4_2

[0946] Serial number 71: SpU3-5_2

[0947] Serial number 72: SpU3-6_1

[0948] Serial number 73: SpU3-7_1

[0949] Serial number 74: SpU3-8_1

[0950] Serial number 75: SpU3-9_1

[0951] Serial number 76: SpU3-10_1

[0952] Serial number 77: SpU3-1_13

[0953] Serial number 78: SpU3-2_1

[0954] Serial number 79: SpU3-3_1

[0955] Serial number 80: SpU3-4_2

[0956] Serial number 81: SpU3-5_2

[0957] Serial number 82: SpU3-6_1

[0958] Serial number 83: SpU3-7_1

[0959] Serial number 84: SpU3-8_1

[0960] Serial number 85: SpU3-9_1

[0961] Serial number 86: SpU3-10_18

[0962] Serial number 87: SpU3-2_1

[0963] Serial number 88: SpU3-4_2

[0964] Serial number 89: SpU3-6_1

[0965] Serial number 90: SpU3-8_1

[0966] Serial number 91: SpU3-10_1

[0967] Serial number 92: SpU3-1_18

[0968] Serial number 93: SpU3-2_18

[0969] Serial number 94: SpU3-3_18

[0970] Serial number 95: SpU3-4_18

[0971] Serial number 96: SpU3-5_18

[0972] Serial number 97: SpU3-6_18

[0973] Serial number 98: SpU3-7_18

[0974] Serial number 99: SpU3-8_18

[0975] Serial number 100: SpU3-9_18

[0976] Serial number 101: SpU3-1_4

[0977] Serial number 102: SpU3-2_4

[0978] Serial number 103: SpU3-3_4

[0979] Serial number 104: SpU3-4_4

[0980] Serial number 105: SpU3-5_4

[0981] Serial number 106: SpU3-6_4

[0982] Serial number 107: SpU3-7_4

[0983] Serial number 108: SpU3-8_4

[0984] Serial number 109: SpU3-9_4

[0985] Serial number 110: SpU3-10_4

[0986] Serial number 111: NL-1_1

[0987] Serial number 112: NL-2_1

[0988] Serial number 113: NL-3_1

[0989] Serial number 114: NL-4_1

[0990] Serial number 115: NL-5_2

[0991] Serial number 116: NL-6_2

[0992] Serial number 117: NL-7_1

[0993] Serial number 118: NL-8_1

[0994] Serial number 119: NL-9_1

[0995] Serial number 120: NL-10_1

[0996] Serial number 121: NL-11_4

[0997] Serial number 122: NL-12_4

[0998] Serial number 123: NL-13_2

[0999] Serial number 124: NL-14_2

[1000] Serial number 125: NL-15_2

[1001] Serial number 126: NL-16_2

[1002] Serial number 127: NL-17_1

[1003] Serial number 128: NL-18_1

[1004] Serial number 129: NL-19_1

[1005] Serial number 130: NL-20_1

[1006] Serial number 131: NL-21_1

[1007] Serial number 132: NL-22_1

[1008] Serial number 133: NL-23_1

[1009] Serial number 134: NL-24_1

[1010] Serial number 135: NL-25_1

[1011] Serial number 136: NL-26_1

[1012] Serial number 137: NL-27_1

[1013] Serial number 138: NL-28_1

[1014] Serial number 139: SpNL-1_1

[1015] Serial number 140: SpNL-2_1

[1016] Serial number 141: SpNL-3_1

[1017] Serial number 142: SpNL-4_1

[1018] Serial number 143: SpNL-5_1

[1019] Serial number 144: SpNL-6_1

[1020] Serial number 145: SpNL-7_1

[1021] Serial number 146: SpNL-8_1

[1022] Serial number 147: SpNL-9_1

[1023] Serial number 148: SpNL-10_1

[1024] Serial number 149: SpNL-11_2

[1025] Serial number 150: SpNL-12_2

[1026] Serial number 151: SpNL-13_1

[1027] Serial number 152: SpNL-14_2

[1028] Serial number 153: SpNL-15_2

[1029] Serial number 154: SpNL-16_2

[1030] Serial number 155: SpNL-17_1

[1031] Serial number 156: SpNL-18_1

[1032] Serial number 157: SpNL-19_1

[1033] Serial number 158: SpNL-20_1

[1034] Serial number 159: SpNL-21_1

[1035] Serial number 160: SpNL-22_1

[1036] Serial number 161: SpNL-23_1

[1037] Serial number 162: SpNL-24_1

[1038] Serial number 163: SpNL-25_1

[1039] Serial number 164: SpNL-26_1

[1040] Serial number 165: SpNL-27_1

[1041] Serial number 166: SpNL-28_1

[1042] Serial number 167: U3-1_1

[1043] Serial number 168: U3-2_2

[1044] Serial number 169: U3-3_2

[1045] Serial number 170: U3-4_1

[1046] Serial number 171: U3-5_1

[1047] Serial number 172: U3-6_1

[1048] Serial number 173: U3-7_1

[1049] Serial number 174: U3-8_1

[1050] Serial number 175: U3-9_1

[1051] Serial number 176: U3-10_1

[1052] Serial number 177: U3-1-2_1

[1053] Serial number 178: U3-2-3_1

[1054] Serial number 179: SpU3-1_1

[1055] Serial number 180: SpU3-2_1

[1056] Serial number 181: SpU3-3_1

[1057] Serial number 182: SpU3-4_2

[1058] Serial number 183: SpU3-5_2

[1059] Serial number 184: SpU3-6_1

[1060] Serial number 185: SpU3-7_1

[1061] Serial number 186: SpU3-8_1

[1062] Serial number 187: SpU3-9_1

[1063] Serial number 188: SpU3-10_1

[1064] Serial number 189: SpU3-1_4

[1065] Serial number 190: SpU3-2_4

[1066] Serial number 191: SpU3-3_4

[1067] Serial number 192: SpU3-4_4

[1068] Serial number 193: SpU3-5_4

[1069] Serial number 194: SpU3-6_4

[1070] Serial number 195: SpU3-7_4

[1071] Serial number 196: SpU3-8_4

[1072] Serial number 197: SpU3-9_4

[1073] Serial number 198: SpU3-10_4

[1074] Serial number 199: SpU3-1_18

[1075] Serial number 200: SpU3-2_18

[1076] Serial number 201: SpU3-3_18

[1077] Serial number 202: SpU3-4_18

[1078] Serial number 203: SpU3-5_18

[1079] Serial number 204: SpU3-6_18

[1080] Serial number 205: SpU3-7_18

[1081] Serial number 206: SpU3-8_18

[1082] Serial number 207: SpU3-9_18

[1083] Serial number 208: SpU3-1_5

[1084] Serial number 209: SpU3-2_5

[1085] Serial number 210: SpU3-3_5

[1086] Serial number 211: SpU3-4_5

[1087] Serial number 212: SpU3-5_5

[1088] Serial number 213: SpU3-6_5

[1089] Serial number 214: SpU3-7_5

[1090] Serial number 215: SpU3-8_5

[1091] Serial number 216: SpU3-9_5

[1092] Serial number 217: SpU3-10_5

[1093] Serial number 218: SpU3-11_5

[1094] Serial number 219: SpU3-2-4_1

[1095] Serial number 220: NL790-1

[1096] Serial number 221: NL790-2

[1097] Serial number 222: NL790-3

[1098] Serial number 223: NL790-4

[1099] Serial number 224: NL790-5

[1100] Serial number 225: NL790-6

[1101] Serial number 226: NL790-8

[1102] Serial number 227: NL790-9

[1103] Serial number 228: NL790-10

[1104] Serial number 229: NL790-11

[1105] Serial number 230: NL-1_3(790)

[1106] Serial number 231: NL537-p

[1107] Serial number 232: SpNL790-1

[1108] Serial number 233: SpNL790-2

[1109] Serial number 234: SpNL790-3

[1110] Serial number 235: SpNL790-4

[1111] Serial number 236: SpNL790-5

[1112] Serial number 237: SpNL790-6

[1113] Serial number 238: SpNL790-9

[1114] Serial number 239: SpNL790-10

[1115] Serial number 240: SpNL790-11

[1116] Serial number 241: SpNL-1_2

[1117] Serial number 242: SpNL790-7-8

[1118] Serial number 243: NL-2-3_3(790)

Claims

1. A method for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps: 1) A step of providing two or more polynucleotide fragment molecules each containing a part of the specific sequence; and 2) A step of ligating the two or more polynucleotide fragment molecules in the presence of two or more nucleic acid clamps, wherein the assembly of the sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence, the nucleic acid clamp is substantially complementary to the polynucleotide molecule, at least two of the nucleic acid clamps contain sequences that are substantially free of deletions when aligned with the specific sequence.

2. The method according to claim 1, wherein, Three or more of the polynucleotide fragment molecules used are present.

3. The method according to claim 1, wherein The nucleic acid clamp is complementary to the polynucleotide molecule by 8 mers or more.

4. The method according to claim 1, wherein, The distance between a nucleic acid clamp aligned with the specific sequence and an adjacent nucleic acid clamp aligned with the specific sequence is 2 bases or less.

5. The method according to claim 1, wherein The deletion is 2 bases or less.

6. The method according to claim 1, wherein, The nucleic acid clamp has a sequence protruding from the ligation portion of the polynucleotide fragment molecule.

7. The method according to claim 1, wherein, At least one end of the polynucleotide fragment molecule has a carrier and a bond.

8. The method according to claim 7, wherein The carrier is polystyrene, CPG (controlled pore glass beads), or magnetic beads.

9. A polynucleotide molecule produced by the method according to any one of claims 1 to 8.

10. A kit for producing a polynucleotide molecule having a specific sequence, comprising: 1) Two or more polynucleotide fragment molecules each containing a part of the specific sequence, and 2) Two or more nucleic acid clamps, wherein the assembly of the sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence, the nucleic acid clamp is substantially complementary to the polynucleotide molecule, at least two of the nucleic acid clamps contain sequences that are substantially free of deletions when aligned with the specific sequence.

11. The kit according to claim 10, wherein, The nucleic acid clamp is complementary to the polynucleotide molecule by 8 mers or more.

12. The kit according to claim 10, wherein The distance between a nucleic acid clamp aligned with the specific sequence and an adjacent nucleic acid clamp aligned with the specific sequence is 2 bases or less.

13. The kit according to claim 10, wherein, The deletion is 2 bases or less.

14. The method according to claim 10, wherein, The nucleic acid clamp has a sequence protruding from the ligation portion of the polynucleotide fragment molecule.

15. The kit according to claim 10, wherein, At least one end of the polynucleotide fragment molecule has a carrier and a bond.

16. The kit according to claim 15, wherein, The carrier is polystyrene, CPG (controlled pore glass beads), or magnetic beads.

17. A method for producing a polynucleotide molecule having a specific sequence, the method comprising the following steps: A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; B) A step of designing two or more nucleic acid clamps according to the specific sequence; C) A step of providing the designed polynucleotide fragment molecules and nucleic acid clamps; and D) A step of ligating the designed polynucleotide fragment molecules in the presence of the designed nucleic acid clamps, wherein the assembly of the sequences of the two or more polynucleotide fragment molecules constitutes the specific sequence, the nucleic acid clamp is substantially complementary to the polynucleotide molecule, At least two of the nucleic acid splints contain sequences that are substantially without deletions when aligned with the specific sequence.

18. A method for producing a polypeptide fragment and a nucleic acid splint for a polynucleotide molecule having a specific sequence, the method comprising the following steps: A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; B) A step of designing two or more nucleic acid splints according to the specific sequence; and C) A step of producing the designed polynucleotide fragment molecules and two or more nucleic acid splints, wherein, The sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, The nucleic acid splint is substantially complementary to the polynucleotide molecule, At least two of the nucleic acid splints contain sequences that are substantially without deletions when aligned with the specific sequence.

19. The method according to claim 17 or 18, wherein The nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

20. The method according to claim 17 or 18, wherein The distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to it is 2 bases or less.

21. The method according to claim 17 or 18, wherein, The deletion is 2 bases or less.

22. The method according to claim 17 or 18, wherein, The nucleic acid splint has a sequence protruding from the connection part of the polynucleotide fragment molecule.

23. The method according to claim 17, wherein At least one end of the polynucleotide fragment molecule has a carrier and a bond.

24. The method according to claim 23, wherein, The carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

25. A method for designing a polypeptide fragment and a nucleic acid splint for a polynucleotide molecule having a specific sequence, the method comprising the following steps: A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and B) A step of designing two or more nucleic acid splints according to the specific sequence, wherein, The sequences of the two or more polynucleotide fragment molecules are assembled to form the specific sequence, The nucleic acid splint is substantially complementary to the polynucleotide molecule, At least two of the nucleic acid splints contain sequences that are substantially without deletions when aligned with the specific sequence.

26. The design method according to claim 25, wherein, The nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

27. The design method according to claim 25, wherein The distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to it is 2 bases or less.

28. The design method according to claim 27, wherein, The deletion is 2 bases or less.

29. The design method according to claim 25, wherein The nucleic acid splint is 10 mers to 50 mers.

30. The design method according to claim 25, wherein, The polynucleotide fragment molecule is 10 mers to 50 mers.

31. The design method according to claim 25, wherein, The nucleic acid splint has a sequence protruding from the connection part of the polynucleotide fragment molecule.

32. The design method according to claim 25, wherein, At least one end of the polynucleotide fragment molecule has a carrier and a bond.

33. The design method according to claim 32, wherein, The carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

34. A program for causing a computer to execute a method for designing a polypeptide fragment and a nucleic acid splint for a polynucleotide molecule having a specific sequence, the method comprising the following steps: A) A step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and B) A step of designing two or more nucleic acid splints according to the specific sequence, wherein, The sequence sets of the two or more polynucleotide fragment molecules constitute the specific sequence. The nucleic acid splint is substantially complementary to the polynucleotide molecule. At least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

35. The program according to claim 34, wherein, The nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

36. The program according to claim 34, wherein, The distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

37. The program according to claim 34, wherein, The gap is 2 bases or less.

38. The program according to claim 34, wherein, The nucleic acid splint is 10 mers to 50 mers.

39. The program according to claim 34, wherein, The polynucleotide fragment molecule is 10 mers to 50 mers.

40. The program according to claim 34, wherein, The nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule.

41. The program according to claim 34, wherein, At least one end of the polynucleotide fragment molecule has a carrier and a bond.

42. The program according to claim 41, wherein The carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

43. A recording medium storing a program for causing a computer to execute a design method for producing a polypeptide fragment and a nucleic acid splint of a polynucleotide molecule having a specific sequence, the method comprising the following steps: A) a step of designing two or more polynucleotide fragment molecules each containing a part of the required sequence according to the specific sequence; and B) a step of designing two or more nucleic acid splints according to the specific sequence, wherein the sequence sets of the two or more polynucleotide fragment molecules constitute the specific sequence, the nucleic acid splint is substantially complementary to the polynucleotide molecule, at least two of the nucleic acid splints contain sequences that are substantially without gaps when aligned with the specific sequence.

44. The recording medium according to claim 43, wherein, The nucleic acid splint is complementary to the polynucleotide molecule by 8 mers or more.

45. The recording medium according to claim 43, wherein, The distance between the nucleic acid splint aligned with the specific sequence and the nucleic acid splint adjacent to the nucleic acid splint aligned with the specific sequence is 2 bases or less.

46. The recording medium according to claim 43, wherein, The gap is 2 bases or less.

47. The recording medium according to claim 43, wherein, The nucleic acid splint has a sequence protruding from the connecting portion of the polynucleotide fragment molecule.

48. The recording medium according to claim 43, wherein, At least one end of the polynucleotide fragment molecule has a carrier and a bond.

49. The recording medium according to claim 48, wherein, The carrier is polystyrene, CPG (controlled pore glass beads) or magnetic beads.

Images