Tomato plants with improved whitefly resistance

By introducing ASAT3 and AP2e genes into tomato plants, the production of specific acyl sugars is promoted, and the problem of insufficient resistance to whitefly in tomato crops is solved, which significantly improves whitefly mortality and has a preventive effect on other insects.

CN120202301APending Publication Date: 2025-06-24ENZA ZADEN BEHEER BV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202280101831.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2022-11-15
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

Existing tomato crops have low resistance to whiteflies, which leads to whiteflies infestation, resulting in reduced crop quality and quantity. Whiteflies are prone to spreading plant diseases and causing economic losses.

Method used

By introducing a combination of ASAT3 gene and AP2e gene in tomato plants, the production of specific S4 acyl sugars is promoted and the resistance of the plant to whitefly is improved.

Benefits of technology

The resistance of tomato plants to whiteflies is significantly improved, with the whiteflies mortality rate reaching at least 50%, and these acyl sugars also have a preventive effect on other sucking insects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005399809920000131
    Figure BDA0005399809920000131
  • Figure BDA0005399809920000141
    Figure BDA0005399809920000141
  • Figure BDA0005399809920000161
    Figure BDA0005399809920000161
Patent Text Reader

Abstract

The present invention relates to tomato plants having improved insect resistance, more particularly whitefly resistance or mite resistance, wherein the plants comprise an ASAT3 gene encoding an acetyl-CoA-dependent acyltransferase and an AP2e gene encoding an APETALA2 ethylene response transcription factor. The invention also relates to a method for providing tomato plants with improved insect resistance, and the use of the ASAT3 gene in combination with the AP2e gene for providing insect resistant tomato plants.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Description

[0002] The present invention relates to tomato plants having improved insect resistance, more particularly whitefly resistance, wherein said plants comprise the ASAT3 gene encoding an acetyl-CoA-dependent acyltransferase and the AP2e gene encoding an APETALA2 ethylene-responsive transcription factor. The present invention also relates to a method for providing a tomato plant having improved insect resistance, and to the use of the combination of the ASAT3 gene and the AP2e gene for providing an insect-resistant tomato plant.

[0003] Economically, whiteflies are one of the most important pests of tomato crops. It causes direct damage by feeding on the phloem sap of the plant and indirect damage by virus transmission and the growth of sooty mold. Whitefly-related damage reduces crop quality and quantity, and it can cause reduced plant vigor and yield, early wilting, leaf chlorosis, and defoliation.

[0004] Whiteflies belong to the family Aleyrodidae and typically feed on the abaxial side of plant leaves. More than 1500 species have been described, and especially in warm or tropical climates and in greenhouses, whiteflies pose a major problem for crop protection in warm climates and for crops grown under greenhouse conditions, resulting in huge economic losses worldwide every year. Many whitefly species are very small in size, which makes their control in greenhouses complex, and if left uncontrolled, the whitefly population in greenhouses can increase rapidly. Whitefly-related damage reduces crop quality and quantity, such as reduced plant vigor and yield, early wilting, leaf chlorosis, and defoliation. The silverleaf whitefly (Bemisia tabaci) is a species of whitefly and is one of the most important agricultural pests at present.

[0005] Although several species of whiteflies can cause some crop losses simply by sucking sap when their numbers are high, the main damage they cause is indirect. Their main importance as crop pests lies in their role as vectors and in the transmission of plant diseases. Virus transmission is the main problem caused by whiteflies. Whiteflies are vectors of more than 200 plant viruses, the most relevant of which belong to the genus Begomovirus (such as TYLCV, etc.) and also various viruses in the genus Crinivirus (such as ToCV) and Torrado virus (ToANV, ToTV). In addition, whiteflies feed by invading the phloem of the plant, injecting toxic saliva, and reducing the overall turgor pressure of the plant. Whiteflies secrete large amounts of honeydew, which supports the harmful infestation of fungi (such as sooty mold). Due to the large aggregation of whiteflies, susceptible plants can quickly become overwhelmed.

[0006] Insecticides such as neonicotinoids, organochlorine compounds, and organophosphorus compounds are widely used and are an effective way to control whiteflies. However, the continuous application of insecticides has led to the occurrence of whiteflies becoming resistant. In addition, more environmentally friendly biological methods have also been proposed to control whitefly infestations, such as using natural predators and parasitoids (e.g., using green lacewing larvae) to control whitefly infestations, or washing the plants to reduce the number of pests on the plants. However, these methods also do not provide the best solution for the pests, and whiteflies remain difficult to control.

[0007] Whitefly infestation has proven to be a problem especially in tomato (tomato (Solanum lycopersicum)) and pepper (Capsicum spp.). Tomatoes are classified into the tomato group (Solanum sect. Lycopersicon) which includes 13 species, where tomato (Solanum lycopersicum) is the cultivated tomato, and the other 12 species are wild relatives. The genus Capsicum has 25 species, of which 5 are cultivated, including Capsicum annuum, Capsicum chinense, Capsicum baccatum, Capsicum pubescens, and Capsicum frutescens. The domestication of tomatoes and peppers has led to a loss of genetic diversity, which makes them vulnerable to abiotic and biotic stresses (such as pest attacks). So far, cultivated tomatoes and sweet peppers are not resistant to whiteflies. Several studies have been conducted previously to discover whitefly resistance in wild relatives of tomatoes and sweet peppers. Several wild relatives of tomatoes (Solanum pennellii, Solanum habrochaites, Solanum peruvianum, and Solanum pimpinellifolium) are known to be more resistant than the cultivated species. Due to the lower selection pressure on virus resistance genes, resistance to whiteflies can contribute to a higher level of virus resistance and higher persistence of virus resistance genes in use.

[0008] Antibiosis is one of the resistance mechanisms by which plants have an adverse effect on insect growth and survival. One of the most prominent tomato traits contributing to antibiosis against whiteflies is the trichomes, which are small protrusions or appendages on the plant, such as glandular hairs. Their function is to secrete metabolites in the plant that have different functions related to growth and development and stress responses, including terpenoids, phenylpropanoids, flavonoids, methyl ketones, and acyl sugars. For example, monoterpenes and sesquiterpenes, methyl ketones, and acyl sugars are secondary metabolites in tomatoes known to be related to whitefly resistance. Although glandular trichomes are shown to play an important role in whitefly resistance, the compounds within the trichomes are decisive. A high correlation has been found between the presence of specific trichomes (type IV trichomes) and whitefly resistance. Previous studies have shown that whitefly resistance is based on several mechanisms involving many genes, making it a complex trait. Efforts to introduce whitefly resistance into cultivated tomatoes have not been successful, and new methods and sources of resistance should be considered.

[0009] In summary, there is a need in the art for tomato plants with improved insect resistance. Additionally, there is a need in the art for methods for providing plants with improved insect resistance, and more particularly for methods for providing tomato plants with improved resistance against whiteflies.

[0010] In another aspect, an object of the present invention is to address the above needs in the art. In another aspect, the object of the present invention is met by the present invention as outlined in the appended claims.

[0011] Specifically, according to a first aspect of the present invention, in another aspect, the above object is met by the present invention by a tomato plant having improved whitefly resistance, wherein the plant comprises a combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) and an APETALA2e ethylene-responsive transcription factor gene (AP2e), the acetyl-CoA-dependent acyltransferase gene (ASAT3) encoding a cDNA sequence having at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No.1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encoding a cDNA sequence having at least 95%, preferably at least 98%, more preferably at least 99% sequence identity with SEQ ID No.3, wherein the combination of the genes results in a selection from C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 、C 40 H70 O 15 The acyl sugar content of one or more sugars of 15 is increased, preferably the acyl sugar content of all of said sugars is increased. Even more preferably, the ASAT3 gene encodes the cDNA of SEQ ID No.2, and the AP2e gene encodes the cDNA of SEQ ID No.4. Experiments have shown that the introgression and combination of the ASAT3 and AP2e genes into commercial tomato (S. lycopersicum) contribute to the production of specific acylsucroses that have a significant effect on the toxicity to whiteflies, resulting in increased whitefly resistance in tomato plants. Correlation analysis between individual acylsucroses and whitefly mortality revealed that different individual acylsucrose molecules play different roles in the resistance of tomato plants to whiteflies. When comparing whitefly mortality with individual acylsucroses, specific acylsucrose compounds showed a correlation coefficient higher than 0.5 and thus had a higher impact on resistance; C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 and C 40 H 70 O 15 。Bioassay experiments in tomato plants according to the present invention have shown that at the determined acyl sugar concentration of specifically designated acyl sugars, a resistance level, i.e., increased WF resistance of at least 50%, preferably at least 55%, more preferably at least 60%, even more preferably at least 65% whitefly mortality, was observed. Plants that do not contain the ASAT3 and / or AP2e genes in their genomes did not show the determined acyl sugar concentration of specifically designated acyl sugars and this level of resistance.

[0012] The tomato plants of the present invention (preferably Solanum lycopersicum plants) have improved insect resistance, wherein the plants comprise a combination of the ASAT3 gene and the AP2e gene. The APETALA2 (AP2) gene family (sometimes also referred to as the AP2 / ethylene-responsive element-binding factor (ERF) gene family or the ERF / AP2 gene family) defines a large gene family (>100+ genes) of DNA-binding proteins called AP2 / ERF in tomato plants. The AP2 genes perform a series of functions, including hormone regulation, establishment of floral meristem organ identity, and regulation and growth and development of floral organs, as well as various responses to environmental stimuli and stresses. In addition, it is known that during seed development of the plants, multiple different AP2 genes provide changes in the hexose to sucrose ratio, and the AP2 proteins regulate the amount of sugars in the sugar utilization system of the plants and are involved in transport, shaping, and signaling. Unexpectedly, it was found that the combination of the ASAT3 gene and the AP2e gene promotes and regulates the production of the following specific S4-type acyl sugars: C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose), and the production of these specific increased acyl sugars is associated with a high level of insect resistance in the plants. The ASAT3 gene encodes an acyl-CoA-dependent acyltransferase (type III) capable of acylating the furanose ring of diacylsucrose. The ASAT3 gene is shown to participate in the last step of the acyl sugar pathway, catalyzing the acylation of triacylsucrose to produce specific tetraacylsucrose groups.

[0013] The AP2e gene encodes the APETALA2e ethylene-responsive transcription factor, which is involved in regulating acylsugar production. AP2e was shown to be associated with the ability to produce general amounts of different types of acylsugars, while ASAT3 promotes the production of specific S4-type acylsugars in plants that affect insect resistance. AP2e affects the total amount of acylsugar produced by switching genes involved in the biosynthetic pathway and trichome formation, while ASAT3 was shown to catalyze or carry out the last step of the acylsugar pathway, more specifically, converting S3 to S4 type. The active ASAT3 enzyme was shown to be responsible for adding an additional acyl group to acylsugars that already have three acyl groups. This results in an increase in the amount of specific tetraacylsugars, resulting in the improved insect resistance observed in the tomato plants of the present invention. When the ASAT3 gene is not present in the tomato plant, the plant shows reduced resistance to whiteflies compared to tomato plants containing the ASAT3 gene.

[0014] The experiments showed that the type of acylsugar is crucial for providing whitefly resistance in tomato plants. It was observed that plants containing the AP2e gene and producing acylsugars were not always resistant to whiteflies. However, in cases where the plants also contained the ASAT3 gene, the plants showed improved insect resistance compared to susceptible plants, which was associated with high levels of a specific tetraacyl (S4) sucrose, more specifically, C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 related.

[0015] The tomato plants of the present invention have an increased content of S4 acyl sugars compared to plants not comprising the combination of the ASAT3 gene and the AP2e gene. Acyl sugars are trichome secretions, more specifically, C 39 H 66 O 15 (S4:dC27 acyl sucrose), C 39 H 68 O 15 (S4: C27 acyl sucrose), C 38 H 66 O 15 (S4:C26 acyl sucrose) and C 40 H 70 O 15(S4: C28-acylsucrose) Acyl sugars are type-IV trichome secretions that confer insect resistance in tomato plants. AP2e is involved in both trichome development and acyl sugar production. Tomato plants containing the AP2e gene have increased type-IV trichomes on the leaf surface and stems. Many (about 90%) of the tomato trichome secretions contain acyl sugars, of which more than 70 compounds are known. The acyl sugars produced in tomatoes consist of different combinations of acyl groups, which are derived from different aliphatic acids having different chain lengths and esterified to the hydroxyl groups of glucose or sucrose. The acyl chains are mainly short- to medium-chain length aliphatic acids with branched or straight chains. In tomatoes, it has been shown that the major short acyl chains of acyl sugars are acetate (C2)-derived or branched amino acid-derived, namely 2-methylpropionate (C4) and 3-methylbutyrate (C5). Longer acyl groups may be derived from β-oxidation products of fatty acids. However, the presence and abundance of specific acyl sugars differ significantly between resistant and susceptible plants, where specifically, C 39 H 66 O 15 (S4: dC27-acylsucrose), C 39 H 68 O 15 (S4: C27-acylsucrose), C 38 H 66 O 15 (S4: C26-acylsucrose) and C 40 H 70 O 15 (S4: C28-acylsucrose) acyl sugars are present in high amounts. These acyl sugars are sticky substances that can act as glue traps and are also toxic to insects, more particularly to whiteflies, thus providing improved insect resistance to the plant. In addition, in the presence of these specific acyl sugars, not only whiteflies but also other piercing insects are deterred from landing on the leaves.

[0016] According to a preferred embodiment, the present invention relates to a tomato plant, wherein the whitefly is one or more selected from Aleurocanthus woglumi (citrus blackfly), Aleyrodes proletella (cabbage whitefly), Bemisia tabaci (silverleaf whitefly), Trialeurodes vaporariorum (greenhouse whitefly), preferably greenhouse whitefly and / or Bemisia tabaci.

[0017] According to a preferred embodiment of the present invention, the plant of the present invention detailed above is not a plant obtained specifically by basic biological methods.

[0018] Although the genomic regions or fragments of the present invention can be introduced into tomato plants by introgression, since the nucleotide sequences of the genomic fragments of the present invention are known, these genomic fragments can be artificially constructed, for example, in yeast and subsequently allowed to recombine with the susceptible tomato genome. Alternatively, these genomic regions or fragments can be amplified by long-distance PCR amplification, and the resulting amplified fragments can be transformed into plant cells in a single step or a series of transformations, ultimately producing the tomato plants of the present invention. The genomic fragments of the present invention (completely or partially subsequently reassembled) can also be isolated from a gel or column, for example, after restriction digestion, and subsequently transformed into tomato cells. In addition, mutations, deletions or insertions in the genome can be obtained by EMS mutagenesis and / or CRISPR technology. Alternatively, the target genomic fragment can be introduced into a vector under a (strong) promoter. Subsequently, the vector can be used to transform susceptible plants and express the target sequence, thereby generating resistance. These techniques are readily available to the skilled person. The construction of artificial chromosomes comprising genomic fragments of the present invention is also considered in the context of the present invention.

[0019] According to another preferred embodiment, the present invention relates to a tomato plant, wherein the ASAT3 gene encodes the protein sequence shown in SEQ ID No. 2, and wherein the AP2e gene encodes the protein sequence shown in SEQ ID No. 4.

[0020] According to another preferred embodiment, the present invention relates to a tomato plant, wherein C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 The acylsugar content of the acylsugars is at least 200 μg / g plant leaf fresh weight (FW), preferably at least 250 μg / g plant leaf fresh weight (FW), more preferably at least 300 μg / g plant leaf fresh weight (FW). Fresh weight (FW) is the weight of the plant or plant part (in this case the plant leaves) at harvest. Bioassay experiments in tomato plants according to the present invention have shown that at a determined acylsugar concentration of a specifically specified acylsugar, a resistance level of at least 50%, preferably at least 55%, more preferably at least 60%, even more preferably at least 65% whitefly mortality is observed.

[0021] According to another preferred embodiment, the present invention relates to a tomato plant, wherein C 39 H 66 O 15The acylsugar content is at least 1 μg / g of plant leaf FW, preferably at least 1.5 μg / g of plant leaf FW, more preferably at least 2 μg / g of plant leaf FW. Although present in small amounts relative to other identified acylsugars in tomato plants showing increased WF resistance, this specific acylsugar shows the greatest toxic effect against WF and contributes to resistance in the plant. 39 H 66 O 15 Present in small amounts, this specific acylsugar shows the greatest toxic effect against WF and contributes to resistance in the plant.

[0022] According to a preferred embodiment, the present invention relates to a tomato plant in which the acylsugar content of C 39 H 68 O 15 is at least 200 μg / g of plant leaf FW, preferably at least 250 μg / g of plant leaf FW, more preferably at least 300 μg / g of plant leaf FW.

[0023] According to another preferred embodiment, the present invention relates to a tomato plant in which the acylsugar content of C 38 H 66 O 15 is at least 5 μg / g of plant leaf FW, preferably at least 10 μg / g of plant leaf FW, more preferably at least 15 μg / g of plant leaf FW.

[0024] According to another preferred embodiment, the present invention relates to a tomato plant in which the acylsugar content of C 40 H 70 O 15 is at least 5 μg / g of plant leaf FW, preferably at least 10 μg / g of plant leaf FW, more preferably at least 15 μg / g of plant leaf FW.

[0025] According to another preferred embodiment, the present invention relates to a tomato plant, wherein the plant is available from deposit NCIMB 44054. Most preferably, the present invention relates to a tomato plant, wherein the AP2e gene and the ASAT3 gene are available from, derived from, or sourced from a tomato plant deposited under number NCIMB 44054 at NCIMB Ltd, Aberdeen, Scotland on October 14, 2022.

[0026] According to another preferred embodiment, the present invention relates to a tomato plant, wherein the plant is also resistant to mites, preferably Tetranychus urticae.

[0027] According to another preferred embodiment, the present invention relates to a tomato plant in which the acetyl-CoA-dependent acyltransferase gene (ASAT3) is present at least heterozygously in the genome of the plant, preferably homozygously.

[0028] According to another preferred embodiment, the present invention relates to a tomato plant in which the APETALA2e ethylene-responsive transcription factor gene (AP2e) is present at least heterozygously in the genome of the plant, preferably homozygously. Experiments have shown that when the plant contains both homozygous AP2e and ASAT3 in the genome, whitefly resistance is shown to be optimal. However, plants containing the heterozygous ASAT3 gene also exhibit resistance to whiteflies.

[0029] According to a preferred embodiment, the present invention relates to a tomato plant, wherein the plant is cherry tomato (Solanum lycopersicum var. cerasiforme).

[0030] According to another preferred embodiment, the present invention relates to a tomato plant in which the plant does not contain the SlAT2 gene encoding the cDNA sequence of SEQ ID No. 5 in its genome.

[0031] According to another preferred embodiment, the present invention relates to a tomato plant in which, compared to a tomato plant that does not contain the combination of the ASAT3 and AP2e genes, the combination of the genes also results in an increase in the acylsugar content of C 32 H 54 O 15 . In the case where the plant contains the AP2e and ASAT3 genes and does not contain the SlAT2 gene, in addition to the previously identified four sugars, C 32 H 54 O 15 also shows a phenotype that contributes to the improvement of WF resistance in the tomato plants of the present invention.

[0032] According to a second aspect, the present invention relates to seeds, fruits or plant parts of the tomato plants of the present invention.

[0033] According to another aspect, the present invention relates to a method for providing a tomato plant with improved whitefly resistance, the method comprising the steps of providing a whitefly-susceptible tomato plant and mutating its genome, the steps comprising;

[0034] -Providing a combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) and an APETALA2e ethylene-responsive transcription factor gene (AP2e), wherein the acetyl-CoA-dependent acyltransferase gene (ASAT3) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 3, wherein the combination of the genes results in increased acylsugar content of C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose), C 40 H 70 O 15 (S4:C28 acylsucrose) and C 32 H 54 O 15 (S4:C20 acylsucrose) compared to tomato plants that do not contain the combination of the ASAT3 and Ap2e genes.

[0035] According to another aspect, the present invention relates to a method for providing a tomato plant having improved whitefly resistance, wherein the method comprises the steps of;

[0036] a) Crossing a tomato plant susceptible to whiteflies with a tomato plant as disclosed above,

[0037] b) Selecting a tomato plant having improved insect resistance, the tomato plant comprising the AP2e gene and the ASAT3 gene.

[0038] According to a preferred embodiment, the present invention relates to a method for providing a tomato plant having improved whitefly resistance, wherein the presence of the AP2e gene in the tomato plant having improved insect resistance is determined by using markers SEQ ID No. 7 and SEQ ID No. 8, and wherein the presence of the ASAT3 gene is determined by using markers SEQ ID No. 9 and SEQ ID No. 10. Additionally, selection of whitefly-resistant tomato plants can also be performed by determining or identifying specific sequences (cDNA sequences or protein sequences) of ASAT3 and AP2e, such as those identified herein as SEQ ID NO. 1, 2, 3, and 4, respectively.

[0039] According to another preferred embodiment, the present invention relates to a method for providing tomato plants with improved whitefly resistance, wherein the selection of tomato plants with improved insect resistance is by determining C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 and / or C 40 H 70 O 15 acyl sugar content, wherein the total acyl sugar content of C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 and C 40 H 70 O 15 is at least 200 μg / g plant leaf fresh weight (FW), and / or the acyl sugar content of C 39 H 66 O 15 is at least 1 μg / g plant leaf FW, and / or the acyl sugar content of C 39 H 68 O 15 is at least 200 μg / g plant leaf FW, and / or the acyl sugar content of C 38 H 66 O 15 is at least 5 μg / g plant leaf FW. In addition to determining the presence of the AP2e and ASAT3 genes in the tomato plants, the selection of tomato plants with improved insect resistance can also be based on the determination of the C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 and C 40 H 70 O 15 acyl sugar content.

[0040] According to another aspect, the present invention relates to a method for providing tomato plants with improved whitefly resistance, wherein the method comprises the following steps:

[0041] a) providing a tomato plant as described herein, comprising the AP2e and ASAT3 genes,

[0042] b) crossing the tomato plant of step a) with a tomato plant that is more susceptible to whiteflies and does not contain the AP2e and ASAT3 genes,

[0043] c) optionally, selfing the plants obtained in step b) at least once,

[0044] d) Selecting plants with improved whitefly resistance.

[0045] According to another aspect, the present invention relates to a combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) encoding a cDNA sequence having at least 95% sequence identity to SEQ ID No. 1 and an APETALA2e ethylene-responsive transcription factor gene (AP2e) for providing insect resistance in tomato plants. The acetyl-CoA-dependent acyltransferase gene (ASAT3) encodes a cDNA sequence having at least 95% sequence identity to SEQ ID No. 1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity to SEQ ID No. 3.

[0046] According to another aspect, the present invention relates to the use of a combination of the two genes AP2e and ASAT3 as defined above in tomato plants for providing whitefly resistant tomato plants.

[0047] The present invention will be further described in detail in the following examples and accompanying drawings, in which:

[0048] Figure 1 : Shown are leaves of a tomato plant (S. lycopersicum) according to the invention (upper panel) and leaves of an insect susceptible tomato plant (Solanum lycopersicum) (lower panel). Both tomato plants have been exposed to in vitro whitefly infestation in glass petri dishes. The leaves of the plant of the invention have no live whitefly infestation; most of the whiteflies are deformed and dead. This is in contrast to the leaves of the insect susceptible tomato plant, which are clearly infested with live and healthy-looking whiteflies.

[0049] Figure 2 : shows the percentage of dead whiteflies (WF) as the concentration of acylsugar in tomato plants increases. The figure shows the number of dead whiteflies and the relationship between acylsugar C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O15 There is a correlation between the concentrations. These specific acyl sugars all show a negative impact on the survival of whiteflies. On the other hand, other acyl sugars present in the plant, such as C 34 H 58 O 15 have no effect on whiteflies. Fresh weight (FW) is the weight of the plant at harvest, which in this case is the FW of the plant leaves. The bioassay shows that the level of acyl sugar content in the plant leaves directly affects the level of resistance, which is observed as the mortality rate of whiteflies.

[0050] Figure 3 : shows the average whitefly (WF) toxicity levels determined in tomato plants containing the homozygous (+ / +) or heterozygous (+ / -) ASAT3 gene, or in the absence of the ASAT3 gene (- / -) Figure 3 A), and C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 and C 40 H 70 O 15 the average amounts of acyl sugars ( Figure 3 B, and expressed as μg of S4-type acyl sugar / g of plant Fw). The absence / presence of the ASAT3 gene is directly correlated with the WF toxicity level and the amount of the specific sugar in the tomato plant. All plants contain the homozygous AP2e gene. When the observed WF toxicity is higher than 50%, more preferably higher than 60% of the WF toxicity level, the plant is considered to have WF resistance.

[0051] Figure 4 : shows the AP2e and ASAT3 gene expressions determined by RT-PCR using β-actin as an endogenous control. The expression values of each gene are normalized relative to the endogenous β-actin gene, and the AP2e and ASAT3 gene expression levels are determined in whitefly-resistant and -susceptible tomato plants. Three types of plants are included: plant A with homozygous (+ / +) AP2e gene and heterozygous (+ / -) ASAT3 gene, plant B with both AP2e and ASAT3 heterozygous, and plant C with absent (- / -) AP2e and heterozygous ASAT3. The presence / absence of the AP2e gene is correlated with the expression of the ASAT3 gene and the WF toxicity level and the amount of the specific sugar in the tomato plant. Example

[0052] Isolated leaf bioassay

[0053] Separate the newly emerged leaflets from the third leaf from tomato plants at least 12 weeks old. Next, place the petioles of the leaflets into tubes filled with nutrient agar to avoid dehydration. Subsequently, place the tubes (using blue-tack) in the middle of the glass Petri dish lid such that the adaxial side faces upward and the abaxial side faces downward, leaving sufficient space between the leaf and the Petri dish. Then inoculate each Petri dish with 25 whiteflies anesthetized with CO2 for 3 seconds.

[0054] After 24 to 48 hours, count the number of whiteflies on the adaxial or abaxial surface and the number of dead whiteflies. Each plant was tested twice, and the number of live whiteflies (feeding from the adaxial and abaxial parts of the leaf plus whiteflies still flying around in the Petri dish) and the number of dead whiteflies were used to calculate the percentage of dead whiteflies. Analysis of the correlation between specific acylsucroses and whitefly mortality revealed that different specific acylsucrose molecules play different roles in whitefly resistance / susceptibility.

[0055] As shown in Figure 2 for the whitefly (WF) mortality representing the content of specific acylsucroses present in the plant 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose) acylsugars showed a high impact on resistance. For example, no such significant association was observed in the acylsugar content of C 37 H 64 O 15 (S4:C25), C 32 H 56 O 14 (S3:C20), C 34 H 58 O 15 (S4:C22) in insect-susceptible and resistant plants.

[0056] Liquid Chromatograpy Mass Spectrometry (LC-MS) analysis of the acylsugar content in tomatoes

[0057] Chemical analysis of the leaf surface of a set of tomato plants was performed by LC-MS, said tomato plants including insect-resistant tomato plants, moderately resistant plants, and susceptible plants (all tomatoes) according to the present invention. The plants were grown to 10 lateral branches, and a leaflet punch was taken from the third leaf using a 15-ml tube (1.5 cm in diameter) by placing the cap and opening on both sides of the leaflet surface relative to the leaflet surface. The punch was then immersed in 2 ml of methanol plus sucrose octoacetate (10 mg / l) and shaken for 15 seconds. Next, the leaflet punch was removed and 600 μl was transferred to a 0.5-ml 96-well plate. The methanol was allowed to evaporate, and the sample was redissolved in 300 μL of methanol and analyzed using an Agilent 1290 Infinity II UHPLC coupled to an Agilent 6230 TOF mass spectrometer.

[0058] 1 μL of the extract was injected and separated on an Agilent ZORBAX RRHD Eclipse Plus C18 column at a mobile phase flow rate of 0.3 mL / minute at 50 °C. The mobile phase consisted of water + 0.1% formic acid (A) and acetonitrile + 0.1% formic acid (B), with the following A:B gradient: from 60:40 to 45:55 (in 6 minutes) to 10:90 (in 8 minutes) to 60:40 (in 3 minutes). The molecules were ionized at 325 eV (positive mode) and detected at 1 spectrum / second in the range of 50 to 1500 mu. The extract mainly contained acyl sugars, which were detected as sodium adducts in the mass spectrometer.

[0059] Individual acyl sugars were identified using MassHunter qualitative analysis software (Agilent) by calculating the molecular formula based on the sodium and potassium adducts that make up the chromatographic peaks. Here, the molecular formula was restricted as follows: allowing carbon, hydrogen, and oxygen atoms to form molecules paired with H + 、Na + and K + plus a double bond equivalent (DBE) in the range of 1 to 10. The combination of the exact mass of the adduct ion and the DBE allowed the inference of the basic structure of the acyl sugar molecule: the backbone portion, the number of acyl chains, and the total number of carbon atoms forming the acyl chains. The amount of acyl sugar was calculated by performing chromatographic peak integration using MassHunter quantitative analysis software (Agilent) and comparing the total peak area of the individual acyl sugars with the total peak area of the internal standard (sucrose octoacetate).

[0060] The corresponding results were obtained by LC-MS, just as those obtained by the separated leaf bioassay as described above, that is, specific acylsugars were involved in insect resistance. The previously designated S4-type acylsugar compounds were present at high concentrations in plants showing high resistance to whiteflies. In contrast, in plants showing susceptibility to whiteflies, these specific acylsugars were not detected or only detected at low concentrations by LC-MS. Based on the results of LCMS, it was concluded that plants with improved insect resistance were associated with high C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose) acylsugars. No significant changes were observed in the acylsugar content of C 37 H 64 O 15 (S4:C25), C 32 H 56 O 14 (S3:C20), C 34 H 58 O 15 (S4:C22) in insect-susceptible and resistant plants.

[0061] ASAT3 and AP2e genotype analysis, mapping.

[0062] The production of acylsugars in tomato plants is associated with a high level of insect resistance in the plants. It is important to know which type of acylsugar is required for insect resistance. Genotype data of a population of resistant tomato plants (tomato) were investigated by marker analysis, and markers M1 and M5 (Table 1) were used to identify QTLs significantly associated with the production of C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose) acylsucrose.

[0063] Briefly, based on the reference genome SL2.40, genomic regions associated with the amount of acylsugars produced by type IV trichomes have been mapped on chromosome 6. The region involved in acylsugar production associated with insect resistance was determined to be located between positions 43250794 bp and 43259933 bp. Marker M5 is 100% correlated with the amount of acylsugars produced. Based on the reference genome SL2.40 and in silico prediction analysis (ITAG 2.3), a gene Solyc06g075510.2 is located in the fine-mapped region encoding the APETALA2 ethylene-responsive transcription factor (AP2e).

[0064] In addition, the type of acylsugars is crucial for providing whitefly resistance in tomato plants. It was observed that plants containing the AP2e gene and producing acylsugars were not always resistant to whiteflies. By comparing the acylsugar profiles of susceptible and resistant plants, it was concluded that plants with improved insect resistance were associated with high levels of tetra-acyl (S4) sucrose C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose). In contrast, susceptible plants were unable to produce the S4 glycome or they only produced tri-acyl sucrose (S3). Marker M1 is 100% correlated with the type of acylsugars, and a specific sequence was mapped on chromosome 11 that encodes a member of the BAHD family of acyltransferases, more particularly an acetyl-CoA-dependent acyltransferase ASAT3, which is capable of acylsucrose acetylation and is associated with the production of C 39 H 66 O 15 (S4:dC27 acylsucrose), C 39 H 68 O 15 (S4:C27 acylsucrose), C 38 H 66 O 15 (S4:C26 acylsucrose) and C 40 H 70 O 15 (S4:C28 acylsucrose).

[0065] The functional ASAT3 gene was sequenced to generate a genomic sequence including the promoter region. Plants containing a combination of SEQ ID No. 1 (i.e., functional ASAT3) and AP2e have increased acyl sugar content and are more resistant to whiteflies than plants without SEQ ID No. 1. SEQ ID No. 1 shows the coding sequence of ASAT3 in the plants of the present invention, which encodes the ASAT3 protein of SEQ ID No. 2. SEQ ID No. 3 shows the coding sequence of AP2e in the plants of the present invention, which encodes the AP2e protein of SEQ ID No. 4.

[0066] Table 1. Marker sequences used for QTL mapping

[0067] Marker Sequence SEQ ID No. M5_F GCGAGGCATTTGTTGAAGTTGCTAATGC 7 M5_R GGTTGATACAAACAGCCCATTG 8 M1_F GCCTTCTTCTACCCTAAAATAC 9 M1_R CAGCTAAGGGATAATAAAAGGAC 10

[0068] The results showed that the combination of ASAT3 and AP2e genes specifically promoted and regulated the production of the following specific S4-type acylsugars: 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 The combination of AP2e (marker M5) + ASAT3 (marker M1) increased the level of specific S4 acylsugars required for whitefly resistance. Using the M5 and M1 markers, several tomato plants were selected for the presence of the AP2e gene and the presence / absence, homozygosity / heterozygosity of the ASAT3 gene. The total acylsugar content (μg / gram plant fresh weight (gFW)) and the specific acylsugar C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 The presence of ASAT3 and resistance to whitefly. 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66O 15 and C 40 H 70 O 15 The production of acylsucrose is co-segregating and is associated with the whitefly resistance level, see Table 2.

[0069] Table 2. Presence of AP2e, ASAT3 in plants and their effects on acyl sugars and whitefly resistance.

[0070]

[0071] In addition, in additional experiments and to confirm the above results, the whitefly toxicity level and C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 average amount of acyl sugars were determined in plants containing the homozygous (+ / +) or heterozygous (+ / −) ASAT3 gene or in plants in the absence of the ASAT3 gene (− / −) as shown above. Figure 3 A shows that the relative whitefly (WF) toxicity in plants containing the ASAT3 gene is superior to that in plants without ASAT3, with homozygous plants providing the best WF-resistant plants. Figure 3 B shows C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 average sum of acyl sugars (expressed as S4-type acyl sugars) is directly related to the presence or absence of the ASAT3 gene, with homozygous plants producing the highest average amount of the specific sugar. As long as there is a combination of the ASAT3 gene and the AP2e gene, the plants are more resistant to whiteflies and also show in C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H70 O 15 The yield of acylsugars is higher.

[0072] AP2e and ASAT3 gene expression levels in tomato and WF resistance

[0073] The expression levels of AP2e and ASAT3 genes were determined in whitefly-resistant and susceptible tomato plants. Three types of plants were included; plant A was homozygous for the AP2e gene (+ / +) and heterozygous for the ASAT3 gene (+ / -), plant B was heterozygous for both AP2e and ASAT3, and plant C was absent of AP2e (- / -) and heterozygous for ASAT3. In addition, the expression of specific S4 acylsugars C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 The acylsugar content of each plant was determined as described above and whitefly resistance was determined as described above. The summary results for each plant are shown in Table 3. Plants homozygous for AP2e and heterozygous for ASAT3 produced the highest amount of the acylsugar C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 And therefore they are more toxic to WF. On the other hand, plants heterozygous for both genes produce less C 39 H 66 O 15 , C 39 H 68 O 15 , C 38 H 66 O 15 and C 40 H 70 O 15 acylsugars and for this reason they exhibit lower WF toxicity.

[0074] Table 3. AP2e and ASAT3 provide insect resistance in tomato.

[0075]

[0076] Extract RNA from the plants. Briefly, several stem fragments from each plant were placed in 50 ml tubes and then frozen in liquid nitrogen. Next, the tubes were vortexed, trichomes were removed from the samples, and the trichomes were then placed at the bottom of the tubes. Then, the tubes were put back into liquid nitrogen. RNA extraction was performed using the RNeasy Plant Mini Kit from Quiagen following the manufacturer's instructions. The RNA quantity was measured using a nanodrop from Quiagen.

[0077] Next, 1 μg of the RNA was treated with DNase I from Thermo Scientific following the manufacturer's instructions. Reverse transcription of the RNA was performed using the High Capacity cDNA Reverse Transcription Kit from Applied Biosystems following the manufacturer's instructions. For the reverse transcription reaction, the total RNA was divided into two independent reactions. 500 ng was used for the reaction containing reverse transcriptase and another 500 ng was used for the reaction without the enzyme as a negative control. 40 μl of nuclease-free water was added to dilute the resulting cDNA 3×.

[0078] 1 μl of the cDNA, 0.4 μl of each 10 μM primer (Table 4) were loaded in a qPCR reaction with 10 μl of Go-Taq qPCR Master Mix from Promega and filled to a final volume of 20 μl with nuclease-free water. For each primer pair, a relative standard curve was also made by performing 2× serial dilutions starting from the original 3× diluted cDNA. Expression analysis was performed using the ΔΔCt method using β-actin as an endogenous control. The expression values of each gene were normalized relative to the endogenous β-actin gene ( Figure 4 ).

[0079] Table 4. RT-qPCR primer sequences

[0080] Primer name Primer sequence SEQ ID No. AP2e Fw GCGGATAATACAACAGCAAC 11 AP2e Rev CTGTGAACTTCTTGACCTTG 12 β-actin Fw AAAAGTGCGAGTGTCCTGTCT 13 β-actin Rev TCAAAAAAACAAATTGACTGG 14 ASAT3 Fw GTGAACCTGTAAGAGTAACC 15 ASAT3 Rev TGATAAGTACATTTAGCCCATC 16

[0081]

Claims

1. A tomato plant having improved whitefly resistance, wherein said plant comprises a combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) and an APETALA2e ethylene-responsive transcription factor gene (AP2e), wherein the acetyl-CoA-dependent acyltransferase gene (ASAT3) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 3, and wherein the combination of the genes results in an increase in the acylsugar content of one or more sugars selected from C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 、C 40 H 70 O 15 , preferably an increase in the acylsugar content of all of said sugars.

2. The tomato plant according to claim 1, wherein the ASAT3 gene encodes a protein sequence shown in SEQ ID No. 2, and wherein the AP2e gene encodes a protein sequence shown in SEQ ID No.

4.

3. The tomato plant according to claim 1 or 2, wherein the total acylsugar content of 39 C 66 H 15 O 39 C 68 H 15 O 38 C 66 H 15 O 40 C 70 H 15 O is at least 200 μg / g of fresh weight (FW) of the plant leaves, preferably at least 250 μg / g of fresh weight (FW) of the plant leaves, more preferably at least 300 μg / g of fresh weight (FW) of the plant leaves.

4. The tomato plant according to any one of claims 1 to 3, wherein the acylsugar content of 39 C 66 H 15 O is at least 1 μg / g of plant leaf FW, preferably at least 1.5 μg / g of plant leaf FW, more preferably at least 2 μg / g of plant leaf FW.

5. The tomato plant according to any one of claims 1 to 4, wherein the acyl sugar content of 39 C 68 H 15 is at least 200 μg / g of plant leaf FW, preferably at least 250 μg / g of plant leaf FW, more preferably at least 300 μg / g of plant leaf FW.

6. The tomato plant according to any one of claims 1 to 5, wherein the acylsugar content of 38 C 66 H 15 is at least 5 μg / g of plant leaf FW, preferably at least 10 μg / g of plant leaf FW, more preferably at least 15 μg / g of plant leaf FW.

7. The tomato plant according to any one of claims 1 to 6, wherein the acylsugar content of C 40 H 70 O 15 is at least 5 μg / g of plant leaf FW, preferably at least 10 μg / g of plant leaf FW, more preferably at least 15 μg / g of plant leaf FW.

8. The tomato plant according to any one of claims 1 to 7, wherein the plant is obtainable from deposit NCIMB 44054.

9. The tomato plant according to any one of claims 1 to 8, wherein the plant is also resistant to mites, preferably Tetranychus urticae.

10. The tomato plant according to any one of claims 1 to 9, wherein the ASAT3 gene is present in the genome of the plant at least heterozygously, preferably homozygously.

11. The tomato plant according to any one of claims 1 to 10, wherein the AP2e gene is present in the genome of the plant at least heterozygously, preferably homozygously.

12. The tomato plant according to any one of claims 1 to 11, wherein the plant is Solanum lycopersicum var. cerasiforme.

13. The tomato plant according to any one of claims 1 to 12, wherein the plant does not contain the SlAT2 gene encoding the cDNA sequence having SEQ ID No. 5 in its genome.

14. The tomato plant according to any one of claims 1 to 13, wherein the combination of genes further results in an increase in the acylsugar content of C 32 H 54 O 15 as compared to a tomato plant that does not contain the combination of the ASAT3 and AP2e genes.

15. Seeds, fruits or plant parts of the tomato plant according to any one of claims 1 to 14.

16. A method for providing a tomato plant having improved whitefly resistance according to any one of claims 1 to 14, the method comprising the step of providing a whitefly-susceptible tomato plant and mutating its genome, the step comprising; - Provide a combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) and an APETALA2e ethylene-responsive transcription factor gene (AP2e), wherein the acetyl-CoA-dependent acyltransferase gene (ASAT3) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 3, and wherein the combination of the genes results in an increase in the acylsugar content of one or more of C 39 H 66 O 15 、C 39 H 68 O 15 、C 38 H 66 O 15 、C 40 H 70 O 15 compared to tomato plants that do not contain the combination of the ASAT3 and Ap2e genes.

17. A method for selecting a tomato plant having improved whitefly resistance, wherein the method comprises the following steps; a) Crossing a tomato plant susceptible to whiteflies with a tomato plant according to any one of claims 1 to 14, b) Selecting a tomato (S. lycopersicum) plant having improved insect resistance, the plant comprising the AP2e gene and the ASAT3 gene.

18. The method according to claim 17, wherein the presence of the AP2e gene in the tomato plant having improved insect resistance is determined by using markers SEQ ID No. 7 and SEQ ID No. 8, and wherein the presence of the ASAT3 gene is determined by using markers SEQ ID No. 9 and SEQ ID No.

10.

19. The method according to claim 17 or 18, wherein the selection of tomato plants with improved insect resistance is carried out by determining the C 39 H 66 O 15 -, C 39 H 68 O 15 -, C 38 H 66 O 15 - and / or C 40 H 70 O 15 acylsugar content, wherein the total of the acylsugar contents of C 39 H 66 O 15 -, C 39 H 68 O 15 -, C 38 H 66 O 15 - and C 40 H 70 O 15 is at least 200 μg / g plant leaf fresh weight (FW), and / or the acylsugar content of C 39 H 66 O 15 is at least 1 μg / g plant leaf FW, and / or the acylsugar content of C 39 H 68 O 15 is at least 200 μg / g plant leaf FW, and / or the acylsugar content of C 38 H 66 O 15 is at least 5 μg / g plant leaf FW.

20. A method for providing a tomato plant having improved whitefly resistance, wherein the method comprises the following steps: a) Providing a tomato plant according to any one of claims 1 to 14, which comprises the AP2e and ASAT3 genes, b) Crossing the tomato plant of step a) with a more whitefly-susceptible tomato plant that does not contain the AP2e and ASAT3 genes, c) Optionally, self-crossing the plant obtained in step b) at least once, d) Select plants with improved whitefly resistance.

21. A combination of an acetyl-CoA-dependent acyltransferase gene (ASAT3) and an APETALA2e ethylene-responsive transcription factor gene (AP2e) for providing insect resistance in tomato plants, wherein the acetyl-CoA-dependent acyltransferase gene (ASAT3) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No. 1, and the APETALA2e ethylene-responsive transcription factor gene (AP2e) encodes a cDNA sequence having at least 95% sequence identity with SEQ ID No.

3.

22. Use of the combination of the ASAT3 gene and the AP2e gene according to claim 21 for providing whitefly-resistant tomato plants in tomato plants.