Application of reagent for inhibiting or detecting expression of exosome miR-3150a-5p as well as nasopharyngeal carcinoma metastasis treatment medicine and prognosis preparation

Abstract

The invention belongs to the technical field of tumor molecular biology, and discloses application of a reagent for inhibiting or detecting expression of exosome miR-3150a-5p as well as a nasopharyngeal carcinoma metastasis treatment medicine and a prognosis preparation. It is found that the expression level of the miR-3150a-5p in serum exosomes of nasopharyngeal carcinoma metastasis patients is remarkably higher than that of non-metastasis patients, the area under an AUC curve is 0.84, the diagnosis sensitivity can reach 78%, and the specificity can reach 83%. It is proved that the miR-3150a-5p has a good application prospect in prognosis of nasopharyngeal carcinoma patients. In addition, knock-down of the miR-3150a-5p can significantly inhibit expression quantity of the miR-3150a-5p in nasopharyngeal carcinoma cells and exosomes secreted by the nasopharyngeal carcinoma cells and can effectively inhibit malignant progression such as metastasis of the nasopharyngeal carcinoma cells. Therefore, the feasibility that the miR-3150a-5p is knocked down in a targeted manner by adopting the miRNA inhibitor to treat the nasopharynx cancer is prompted.

Description

Technical Field

[0001] The present invention belongs to the technical field of tumor molecular biology, and particularly relates to the application of reagents for inhibiting or detecting the expression of exosomal miR-3150a-5p, as well as drugs for treating nasopharyngeal carcinoma metastasis and prognostic agents. Background Art

[0002] Nasopharyngeal carcinoma (NPC) occurs in the nasopharyngeal mucosal epithelium and is the most common malignant tumor in the head and neck. The incidence factors of NPC involve multiple aspects such as genetics, environment, and lifestyle, including Epstein-Barr virus infection, smoking, alcohol consumption, genetic factors, eating habits, as well as certain chemicals and radiation.

[0003] The World Health Organization defines NPC as three types: keratinizing, non-keratinizing squamous cell carcinoma, and undifferentiated or poorly differentiated carcinoma. Among them, non-keratinizing subtype NPC accounts for more than 95% of tumors in endemic areas. Due to the lack of obvious symptoms in the early stage of the disease, and NPC having a high degree of invasiveness and high metastatic potential, more than 70% of patients are found to have lymph node metastasis at the first diagnosis, and about 20 - 30% of patients have distant metastases, mainly including the lungs, liver, bones, etc. Although radiotherapy combined with chemotherapy can effectively control local lesions, reduce mortality, and improve the 5-year overall survival rate, the treatment effect of patients with distant metastases is still not ideal, and distant metastasis is still the main cause of clinical treatment failure at present.

[0004] Exosomes are cup-shaped double-membrane vesicles secreted by almost all mammalian cells, which are transmitted in body fluids such as blood. They can be directly released into biological fluids by interacting with the extracellular matrix, and transfer their contents to recipient cells to affect their biological functions. Tumor exosomes carry biological information (proteins, DNA, microRNAs, etc.) derived from tumor cells, and the concentration of their contents is related to the invasive ability of tumor cells and the tumor microenvironment. By analyzing the surface markers or internal components of exosomes, basic information of cells can be directly obtained. Since exosomes are protected by a lipid membrane, their contents are not easily degraded or destroyed, making it possible to use both fresh and long-term preserved samples for analysis. miRNAs exist in the exosome contents and can be released from tumor cells into body fluids through the encapsulation of exosomes, without being degraded by ribosomal enzymes. More importantly, exosomes can be obtained from numerous body fluids (blood, urine, etc.), which makes exosome detection very promising in tumor diagnosis and treatment and becomes a relatively ideal "liquid biopsy" method.

[0005] Therefore, there is an urgent need to develop new reliable non-invasive early metastasis diagnostic and prognostic markers to facilitate the early precise intervention and treatment of nasopharyngeal carcinoma and prolong the survival of nasopharyngeal carcinoma patients. Patent application CN118086492A discloses that the expression level of miR-376a-5p in the blood of nasopharyngeal carcinoma patients is significantly higher than that of healthy people, and it can be used as a miRNA marker for the diagnosis of nasopharyngeal carcinoma and a therapeutic target. The present invention not only develops a new diagnostic and prognostic marker for nasopharyngeal carcinoma, miR-3150a-5p, but also its source is exosomes, which is different from the blood-derived marker in this patent application. Summary of the Invention

[0006] Aiming at the problems existing in the prior art, the present invention provides the application of reagents for inhibiting or detecting the expression of exosomal miR-3150a-5p, as well as drugs for the treatment of nasopharyngeal carcinoma metastasis and prognostic agents. The present invention uses exosomal miR-3150a-5p as a marker for predicting the metastasis risk of nasopharyngeal carcinoma, and the auxiliary prognostic detection of nasopharyngeal carcinoma can be quickly achieved by analyzing its expression level. Moreover, miR-3150a-5p can be used as a therapeutic target, and targeting and inhibiting its expression can achieve the treatment of nasopharyngeal carcinoma patients, with broad application prospects.

[0007] The nucleotide sequence of miR-3150a-5p described in the present invention is CAACCUCGACGAUCUCCUCAGC.

[0008] One object of the present invention is to provide the application of reagents for inhibiting the expression of exosomal miR-3150a-5p for the preparation of drugs for the treatment of nasopharyngeal carcinoma.

[0009] Furthermore,

[0010] The reagent for inhibiting the expression of exosomal miR-3150a-5p includes miR-3150a-5p inhibitor.

[0011] Even further,

[0012] The sequence of miR-3150a-5p inhibitor is GCUGAGGAGAUCGUCGAGGUUG.

[0013] Another object of the present invention is to provide a drug for the treatment of nasopharyngeal carcinoma metastasis, comprising a reagent for inhibiting the expression of exosomal miR-3150a-5p.

[0014] Furthermore,

[0015] The reagent for inhibiting the expression of exosomal miR-3150a-5p includes miR-3150a-5p inhibitor.

[0016] Even further,

[0017] The miR-3150a-5p inhibitor sequence is GCUGAGGAGAUCGUCGAGGUUG.

[0018] The third object of the present invention is to provide the application of a reagent for detecting the expression of exosomal miR-3150a-5p, which is used for preparing a preparation for predicting the metastasis prognosis of nasopharyngeal carcinoma. By detecting the expression level of exosomal miR-3150a-5p in patients with nasopharyngeal carcinoma, it can assist in the diagnosis and / or evaluation of the early metastasis risk of nasopharyngeal carcinoma.

[0019] Furthermore,

[0020] The reagent for detecting the expression of exosomal miR-3150a-5p includes a PCR detection reagent.

[0021] Even further,

[0022] The amplification primer sequences in the PCR detection reagent: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

[0023] Preferably, the detection sample is serum exosomes.

[0024] The fourth object of the present invention is to provide a preparation for predicting the metastasis prognosis of nasopharyngeal carcinoma, which includes a reagent for detecting the expression of exosomal miR-3150a-5p.

[0025] The reagent for detecting the expression of exosomal miR-3150a-5p includes a PCR detection reagent.

[0026] Even further,

[0027] The amplification primer sequences in the PCR detection reagent: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

[0028] Preferably, the detection sample is serum exosomes.

[0029] Through clinical serum exosomal miRNA sequencing and TCGA database analysis, the present invention found that the expression of miR-3150a-5p in patients with metastatic nasopharyngeal carcinoma was significantly higher than that in non-metastatic patients, and it can be used as a reliable marker for predicting the metastasis risk and poor prognosis of nasopharyngeal carcinoma.

[0030] The present invention realizes the rapid auxiliary diagnosis of early metastasis of nasopharyngeal carcinoma through the kit for specifically amplifying miR-3150a-5p and the detection of serum samples. After calculation and analysis, the area under the AUC curve reaches 0.84, the sensitivity is 78%, and the specificity is 83%.

[0031] The present invention designs an inhibitor sequence based on miR-3150a-5p (GCUGAGGAGAUCGUCGAGGUUG), and finds that targeted knockdown of this miRNA can significantly inhibit the proliferation, migration and invasion abilities of nasopharyngeal carcinoma cells, indicating its potential for development as a drug for treating nasopharyngeal carcinoma.

[0032] Detecting the expression level of miR-3150a-5p in serum exosomes is used for the auxiliary diagnosis and risk prediction of nasopharyngeal carcinoma metastasis. Primer design, kit development based on this miRNA and its specific applications in clinical diagnosis. Inhibiting the expression of miR-3150a-5p through its specific inhibitor sequence to treat nasopharyngeal carcinoma. Drug development and therapeutic applications including the use of miRNA inhibitor or other vectors (such as nucleic acid drugs, bioactive fragments).

[0033] Possible directions for design changes or deformation schemes of the present invention:

[0034] (I) Combined detection of multiple miRNAs

[0035] It may replace the diagnostic function of a single miRNA with a combination of miR-3150a-5p and other miRNAs (such as combined detection of multiple markers) to improve sensitivity and specificity.

[0036] (II) Improvement of sample sources

[0037] Based on the detection of serum exosome samples, possible deformations include using other biological samples such as saliva, urine, tissue biopsy, plasma as detection sources to achieve non-invasive or diversified diagnostic schemes.

[0038] (III) Design of alternative inhibitors

[0039] The present invention uses the miR-3150a-5p inhibitor sequence to inhibit this miRNA, and may also design other forms of miRNA inhibitors such as small molecule compounds, antisense oligonucleotides (ASO), siRNA, etc.

[0040] Advantages of the present invention

[0041] The advantages of the present invention are as follows: The present invention discovers that the expression level of miR-3150a-5p in serum exosomes of nasopharyngeal carcinoma patients with metastasis is significantly higher than that of patients without metastasis. After calculation and analysis, the area under the AUC curve is 0.84. The diagnostic sensitivity of miR-3150a-5p can reach 78%, and the specificity can reach 83%. It is confirmed that the miR-3150a-5p gene has good application prospects in the diagnosis and prognosis of nasopharyngeal carcinoma patients. In addition, it is found that knocking down miR-3150a-5p significantly inhibits the expression level of miR-3150a-5p in nasopharyngeal carcinoma cells and their secreted exosomes and can effectively inhibit the malignant progression such as the metastasis of nasopharyngeal carcinoma cells. The above findings demonstrate the importance of miR-3150a-5p in nasopharyngeal carcinoma and suggest the feasibility of using miRNA inhibitor to target and knock down miR-3150a-5p for the treatment of nasopharyngeal carcinoma. Brief Description of the Drawings

[0042] Figure 1 : miRNA sequencing analysis diagram of serum exosomes from 5 nasopharyngeal carcinoma patients with high metastasis risk and 5 nasopharyngeal carcinoma patients with low metastasis risk;

[0043] Figure 1 A: Scatter diagram of miRNA sequencing in serum exosomes of nasopharyngeal carcinoma patients; Figure 1 B: Heat map of the expression levels of the 8 most obvious up-regulated and 4 down-regulated miRNAs in miRNA sequencing of serum exosomes of nasopharyngeal carcinoma patients;

[0044] Figure 2 : Overall survival analysis of the expression of three candidate exosomal miRNAs in head and neck tumors (HNSC) in the TCGA database; Figure 2 A: Overall survival analysis of the expression of candidate exosomal miR-205-5p in head and neck tumors (HNSC) in the TCGA database; Figure 2 B: Overall survival analysis of the expression of candidate exosomal miR-885-5p in head and neck tumors (HNSC) in the TCGA database; Figure 2 C: Overall survival analysis of the expression of candidate exosomal miR-3150a-5p in head and neck tumors (HNSC) in the TCGA database;

[0045] Figure 3 : Analysis of the expression difference of miR-3150a-5p in normal tissues and HNSC tissues in the TCGA database;

[0046] Figure 4 : Receiver operating characteristic (ROC curve) of exosomal miR-3150a-5p for differentiating metastatic nasopharyngeal carcinoma patients from non-metastatic nasopharyngeal carcinoma patients;

[0047] Figure 5 : Expression of miR-3150a-5p gene in nasopharyngeal carcinoma cell line 5-8F before and after treatment with miR-3150a-5p inhibitor;

[0048] Figure 6 : Analysis of the proliferation ability of nasopharyngeal carcinoma cell line 5-8F before and after treatment with miR-3150a-5p inhibitor;

[0049] Figure 7 : Analysis of the migration and invasion abilities of nasopharyngeal carcinoma cell line 5-8F before and after treatment with miR-3150a-5p inhibitor. Specific implementation methods

[0050] Reagents, reagent kits, raw materials, and equipment used in the following examples can be obtained through commercial channels without special instructions. The experimental or detection methods involved in the present invention are conventional experimental or detection methods in the art or are carried out with reference to the corresponding reagent kits or product specifications without special instructions.

[0051] Example 1: Screening of characteristic miRNAs in metastatic nasopharyngeal carcinoma based on miRNA sequencing of clinical patient serum exosomes:

[0052] Collection and sequencing of clinical serum samples:

[0053] Collect the initial diagnosis serum specimens of 5 nasopharyngeal carcinoma patients with high metastasis risk (no metastasis at initial diagnosis, but distant metastasis occurred after radical treatment) and 5 nasopharyngeal carcinoma patients with low metastasis risk (no metastasis at initial diagnosis, and no metastasis or recurrence was found during follow-up after radical treatment), and store them in 1.5 mL EP tubes at -80°C. Nasopharyngeal carcinoma patients meet the following inclusion criteria: mainly nasopharyngeal carcinoma diagnosed by pathology; grouped according to the presence or absence of distant metastasis, where the metastasis group needs to have clear evidence of distant metastasis (such as imaging or histological diagnosis), and the non-metastasis group needs to have no distant metastasis; the basic information of all cases is complete; the sera of all nasopharyngeal carcinoma patients are collected when the patients are diagnosed with nasopharyngeal carcinoma but have not received any radiotherapy, chemotherapy, or surgical treatment. After dry ice transportation to RiboBiotechnology (Guangzhou, China) for EV extraction and miRNA isolation, miRNA sequencing is performed using an Illumina HiSeqTM2500 genome sequencer.

[0054] Taking |log2(Fold Change)|≥2 as the threshold and P<0.05 to draw a volcano plot to show the miRNA expression differences. Red dots represent miRNAs upregulated in the sera of metastatic NPC patients, blue dots represent miRNAs downregulated in the sera of metastatic NPC patients, and gray dots represent no statistical significance ( Figure 1A); Twelve miRNAs with P < 0.001 were selected for heatmap analysis, and it was found that the expressions of three miRNA molecules, miR-205-5p, miR-885-5p, and miR-3150a-5p, in the NPC group with metastasis were significantly higher than those in the NPC group without metastasis ( Figure 1 B). The clinical sample information is shown in Table 1.

[0055]

[0056] Example 2 Analysis of the correlation between candidate exosomal miRNAs and patient prognosis based on the TCGA database:

[0057] The TCGA (The Cancer Genome Atlas) database was used to mine and analyze the patient samples of head and neck squamous cell carcinoma (HNSC) to study the relationship between the expression levels of miR-205-5p, miR-885-5p, and miR-3150a-5p and patient prognosis. The clinical data and miRNA expression data of HNSC patients were downloaded from the TCGA database. After data processing, the overall survival time and miRNA expression level were selected as the analysis indicators. Grouping was performed according to the miRNA expression level (high-expression group and low-expression group), and the median was used as the boundary for high and low expression levels. The Kaplan-Meier survival analysis method was used to evaluate the overall survival time of patients, and the survival curve was drawn by GraphPad Prism 9.5 software.

[0058] Further survival analysis showed that patients with high expression of miR-205-5p and miR-885-5p had a longer overall survival time, indicating that their high expression was positively correlated with a better prognosis; while patients with high expression of miR-3150a-5p had a significantly shorter overall survival time, showing a negative correlation ( Figure 2 ) Based on this result, miR-3150a-5p was selected as the research object in this example. Further miR-3150a-5p expression analysis was performed through the TCGA database, and it was found that the expression of miR-3150a-5p in head and neck squamous cell carcinoma tissues was higher than that in normal tissues (P < 0.05) ( Figure 3 )

[0059] Example 3 Analysis of the diagnostic value of the miR-3150a-5p gene in a large number of nasopharyngeal carcinoma patients:

[0060] (I) Collection of clinical serum samples

[0061] Another 59 serum specimens from nasopharyngeal carcinoma patients with high metastasis risk (no metastasis at initial diagnosis, but distant metastasis occurred after radical treatment) and 60 serum specimens from patients with low metastasis risk (no metastasis at initial diagnosis, and no metastasis or recurrence occurred during follow-up after radical treatment) were collected and stored at -80°C in 1.5 mL EP tubes. The clinical sample information is shown in Table 2.

[0062]

[0063] (2) Exosome extraction

[0064] Take out the serum from the refrigerator, thaw it on ice, add 1 / 3 volume of RiboTM serum exosome extraction reagent, and vortex to mix well; after standing at 4°C for 60 min, centrifuge at 12,000g for 20 min at 4°C. There should be visible yellowish-white precipitate at the bottom of the tube. Carefully aspirate all the supernatant; add an appropriate amount of PBS solution to the centrifuge tube and mix well to obtain a solution rich in exosomes.

[0065] (3) RNA isolation and extraction

[0066] Total RNA was extracted using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). The internal reference cel-miR-39-3p was added to the collected exosome precipitate. In a laminar flow hood, 1 mL of the total RNA extraction reagent TRnaZol Reagent in the kit was added, and the mixture was allowed to stand for 2 min. After pipetting evenly, it was transferred to a new 1.5 mL EP tube, and the subsequent steps were the same. 1 / 5 of the RNA Extraction Buffer was added to the above solution, and it was vigorously shaken for 15 s. The liquid showed a uniform pink color. It was allowed to stand at room temperature for 5 min and then centrifuged at 12,000 g at 4°C for 20 min. It was observed that the bottom layer was a pink organic phase, the middle layer was a white substance, and the top layer was a colorless aqueous phase. As much as possible of the upper aqueous phase was transferred to a new 1.5 mL RNase-free EP tube. In the EP tube containing the obtained colorless aqueous phase, an equal volume of isopropanol was added, and it was mixed by inverting up and down. It was allowed to stand at room temperature for 15 min and then centrifuged at 12,000 g at 4°C for 15 min. The supernatant was carefully aspirated, and a translucent precipitate, i.e., the extracted RNA, could be observed at the bottom of the tube. The precipitate was washed with 75% ethanol prepared with DEPC-treated sterile ddH2O. 75% ethanol equal in volume to the TRnaZol Reagent used was added, and it was centrifuged at 8,000 g at 4°C for 5 min. The supernatant was aspirated, and the precipitate was air-dried at room temperature for 10 min. 20 - 50 μL of RNase-Free Water was added to fully dissolve the RNA. After measuring the concentration, the sample was stored in an -80°C refrigerator or directly used for reverse transcription.

[0067] (IV) Real-time quantitative PCR

[0068] The exosomal RNA extracted from serum was reverse-transcribed into cDNA using the Mir-X miRNA First-Strand Synthesis Kit (638315, TaKaRa), and the reaction conditions were 1) 1 hour at 37 °C and 2) 5 minutes at 85 °C. Then, qRT-PCR was performed using SYBRGreen PCR Master Mix (B21203, Bimake). The total volume of each reaction was 20 μL, containing 5 μL of cDNA (10 ng / μL), and it was carried out on a CFX96 Real Time System (Bio-Rad) real-time quantitative PCR platform according to the manufacturer's instructions. First, pre-denaturation was performed at 95 °C for 10 minutes, followed by cycle reactions with the conditions of 1) 2 seconds at 95 °C, 2) 20 seconds at 60 °C, and 3) 10 seconds at 70 °C for 45 cycles. Then, melting curve analysis was performed to evaluate the PCR specificity. cel-miR-39-3p was used as an exogenous control. Triplicate measurements were set for the reaction. The expression level of the candidate miRNA was calculated using the 2- ΔΔCt method, and the area under the AUC curve was calculated to determine its sensitivity and specificity. The primer sequences are shown in Table 3.

[0069]

[0070] In this example, all the subjects participating in the experiment were randomly grouped, and all the subjects were divided into a training cohort and a validation cohort at a ratio of 7:3. And the area under the AUC curve was calculated to determine its sensitivity and specificity. The results are as Figure 4 shown. The expression level of the miR-3150a-5p gene was generally higher in nasopharyngeal carcinoma patients. After calculation and analysis, the area under the AUC curve was 0.84, its diagnostic sensitivity could reach 78%, and the specificity reached 83%. Further confirmation through the analysis of this experimental data shows that miR-3150a-5p has good application prospects in the early metastasis diagnosis of nasopharyngeal carcinoma patients.

[0071] Example 4 Analysis of the improvement of nasopharyngeal carcinoma by inhibiting the expression level of miR-3150a-5p:

[0072] (I) Preparation of experimental materials:

[0073] Human nasopharyngeal carcinoma cells with high metastatic potential 5-8F were activated in RPMI-1640 culture medium containing 10% FBS and passaged at 37 °C under 5% CO2 conditions for standby.

[0074] (II) Test method

[0075] (1) Design of miR-3150a-5p inhibitor fragment: The siRNA sequence was synthesized by Guangzhou Ribobio Co., Ltd. The inhibitor sequence was GCUGAGGAGAUCGUCGAGGUUG; the negative control sequence was CAGUACUUUUGUGUAGUACAAA.

[0076] (2) Cell transfection: Experimental group: miR-3150a-5p inhibitor was transfected into 5-8F cells, and negative inhibitor was transfected into the control group. The transfection was carried out according to the operation instructions of the transfection reagent Lipo 3000; 48 hours after transfection, the cells and cell culture supernatant were collected.

[0077] (3) Verification of inhibition efficiency: 1) At the cell level: The total RNA of cells was extracted using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). The specific analysis method can be referred to the kit instruction manual. 2) At the exosome level: Extraction of cell exosomes: The culture supernatant of cells in the logarithmic growth phase was collected and centrifuged at 2000 g for 15 min at 4 °C. The supernatant was transferred to a new centrifuge tube, and 1 / 4 of the exosome extraction reagent (EXOTC10A-1, SBI) was added and vortexed evenly. After standing at 4 °C for 4 h, it was centrifuged at 13000 rpm for 60 min at 4 °C to remove the supernatant, and the precipitate was collected as exosomes. The total RNA of exosomes was extracted using the NcmSpin Cell / Tissue Total RNA Kit (M5101, NCM Biotech). The specific analysis method can be referred to the kit instruction manual. The RNA of exosomes in cells and cell culture supernatant was extracted according to the above steps respectively, and then the expression level of miR-3150a-5p in exosomes in cells and cell culture supernatant was detected by the real-time quantitative PCR method in Example 3.

[0078] (4) Analysis of cell proliferation ability: The cck8 cell proliferation kit (C0005, Targetmol) was used to analyze the proliferation ability of 5-8F before and after transfection with inhibitor. The specific analysis method can be referred to the kit instruction manual.

[0079] (5) Cell invasion and migration experiments: The experimental group and control group cells 48 hours after transfection with inhibitor were collected, resuspended in complete culture medium, and the cell count was performed. 200 μL of cell suspension (containing serum-free medium RMPI-1640 culture medium, about 5×10 per well) was added to the Transwell chambers without and pre-coated with Matrigel. 4Put the chamber (with cells) into a 24-well cell culture plate, add 600 μL of RPMI-1640 culture medium containing 20% FBS to the lower layer, and culture the cells at 37 °C, 5% CO2 concentration, and saturated humidity for 24 h. Take out the chamber, discard the culture medium in the 24-well plate, gently wipe the cells inside the chamber with a sterile cotton swab, add 1 mL of 4% paraformaldehyde to fix for 10 min, and then add 600 μL of 0.1% crystal violet staining solution and stain for 10 min. Take pictures and count using an inverted microscope.

[0080] Results Figure 5 It can be seen that the inhibitor fragment that inhibits the expression of miR-3150a-5p can significantly reduce the expression of miR-3150a-5p in human nasopharyngeal carcinoma cells 5-8F, and at the same time significantly reduce the expression of miR-3150a-5p in the exosomes of human nasopharyngeal carcinoma cells 5-8F, and the cell proliferation ability also decreases significantly ( Figure 6 ). In addition, after inhibiting the expression of miR-3150a-5p, the number of 5-8F cells that migrate and invade significantly decreases ( Figure 7 ), suggesting that inhibiting the expression of miR-3150a-5p can significantly inhibit the migration and invasion ability of nasopharyngeal carcinoma cells.

[0081] The above results indicate that the inhibitor targeting miR-3150a-5p provided by the present invention has a good inhibitory effect. After transfection, it can significantly inhibit the proliferation, invasion, and migration ability of nasopharyngeal carcinoma cells, and has a broad application prospect.

Claims

1. Use of a reagent for inhibiting the expression of exosomal miR-3150a-5p, characterized in that, For the preparation of drugs for the treatment of nasopharyngeal carcinoma.

2. The application according to claim 1, characterized in that, The reagent for inhibiting the expression of exosomal miR-3150a-5p includes miR-3150a-5p inhibitor.

3. The application according to claim 2, characterized in that, The sequence of miR-3150a-5p inhibitor is GCUGAGGAGAUCGUCGAGGUUG.

4. A drug for treating nasopharyngeal carcinoma metastasis, characterized in that, It includes a reagent for inhibiting the expression of exosomal miR-3150a-5p.

5. The drug for treating nasopharyngeal carcinoma metastasis according to claim 4, characterized in that, The reagent for inhibiting the expression of exosomal miR-3150a-5p includes miR-3150a-5p inhibitor.

6. The drug for treating nasopharyngeal carcinoma metastasis according to claim 5, wherein, The sequence of miR-3150a-5p inhibitor is GCUGAGGAGAUCGUCGAGGUUG.

7. Use of a reagent for detecting the expression of exosomal miR-3150a-5p, characterized in that, For the preparation of a preparation for the prognosis of nasopharyngeal carcinoma metastasis.

8. The application according to claim 7, wherein The reagent for detecting the expression of exosomal miR-3150a-5p includes a PCR detection reagent.

9. The application according to claim 8, wherein The amplification primer sequences in the PCR detection reagent: the upstream primer is CCAACCTCGACGATCTCCTCAGC, and the downstream primer is CAGTCTCAGGGTCCGAGGTATTC.

10. A preparation for the prognosis of nasopharyngeal carcinoma metastasis, characterized in that, It includes a reagent for detecting the expression of exosomal miR-3150a-5p.

Images