DNA nano sponge system and application thereof in targeted therapy of ovarian cancer

Abstract

The invention discloses a DNA nano-sponge system and application in targeted therapy of ovarian cancer, the DNA nano-sponge system loads zinc oxide nanoparticles containing oxygen vacancies and doxorubicin through DNA nano-sponge, the DNA nano-sponge comprises a DOX drug-loading area, an MUC1 aptamer and HIF-1aDNAzyme, the DNA nano-sponge is a DNA nano-sponge drug-loading area, the DNA nano-sponge drug-loading area is a DNA nano-sponge drug-loading area, and the DNA nano-sponge drug-loading area is a DNA nano-sponge drug-loading area. Targeted delivery, metabolism reprogramming and ferroptosis induction can be realized through the DNA nano sponge system, so that ovarian cancer chemotherapy sensitization is realized, and the curative effect of targeted treatment of ovarian cancer is improved.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, specifically to a DNA nanosponge system and its application in targeted therapy of ovarian cancer. Background Art

[0002] Chemotherapy for ovarian cancer faces two core problems: insufficient targeting and multidrug resistance (MDR). In the existing technology, traditional chemotherapy drugs lack specific targeting, resulting in damage to normal tissues and serious side effects (such as myocardial damage, liver and kidney toxicity). In addition, the hypoxic characteristics of the tumor microenvironment (TME) exacerbate chemotherapy resistance by inducing glycolysis (Warburg effect), upregulating the HIF-1a signaling pathway, and expressing drug efflux proteins (such as ABCB-1). Although nanomaterials based on metal nanoparticles (such as ZnO) and metal-organic frameworks (MOF) can generate reactive oxygen species (ROS) through the Fenton reaction to improve hypoxia, their synthesis steps are complex, ROS generation depends on external stimuli (such as ultrasound or light), and their targeting is insufficient, making it easy to produce toxicity to normal cells. Existing nucleic acid therapies (such as siRNA, DNAzyme) can regulate gene expression, but single-stranded nucleic acids are easily degraded and rely on carrier delivery, with high costs.

[0003] Therefore, there is an urgent need for a new type of chemotherapy sensitization system with strong targeting, high stability, and the ability to multi-dimensionally regulate TME and metabolic signals. Summary of the Invention

[0004] The present invention provides a DNA nanosponge system, which realizes chemotherapy sensitization for ovarian cancer through targeted delivery, metabolic reprogramming, and ferroptosis induction, and improves the efficacy in targeted therapy of ovarian cancer.

[0005] In view of this, the solution of the present invention is as follows:

[0006] In the first aspect of the present invention, there is provided a DNA nanosponge system, which is obtained by rolling circle amplification of a circular DNA substrate and loading doxorubicin and zinc oxide nanoparticles with oxygen vacancies; the circular DNA substrate is amplified using single-stranded DNA as a template, and the single-stranded DNA contains a drug-loading region, and nucleotide sequences of a targeting MUC1 aptamer region and a DNAzyme region targeting HIF-1a.

[0007] Further, the nucleotide sequence of the circular DNA substrate after rolling circle amplification is as shown in SEQ ID NO: 3.

[0008] Further, the nucleotide sequence of the single-stranded DNA contains a drug-loading region of polyT, the nucleotide sequence of the DNAzyme region targeting HIF-1a is as shown in SEQ ID NO: 4, and the nucleotide sequence of the MUC1 aptamer region is as shown in SEQ ID NO: 5.

[0009] Furthermore, the nucleotide sequence of the single-stranded DNA is as shown in SEQ ID NO: 1.

[0010] Furthermore, the nucleotide sequence of the amplification primer for the single-stranded DNA and / or the primer for rolling circle amplification is as shown in SEQ ID NO: 2.

[0011] Furthermore, in the DOX loading process, double-stranded DNA rich in GC sequences and containing a polyA region is used, which is complementary paired with the drug-loading region of polyT of the single-stranded DNA.

[0012] Preferably, the double-stranded DNA is constructed based on the nucleotide sequence as shown in SEQ ID NO: 6.

[0013] Furthermore, the zinc oxide nanoparticles with oxygen vacancies are obtained by calcining two-dimensional zinc metal-organic framework materials to obtain zinc oxide, and then reacting with thiourea at 300 - 500 °C for 1 - 3 h and cooling.

[0014] Preferably, during the loading process of the zinc oxide nanoparticles with oxygen vacancies, the concentration of the zinc oxide nanoparticles with oxygen vacancies is 50 - 400 μg / ml.

[0015] Furthermore, the time for rolling circle amplification is 1 - 10 h.

[0016] The second aspect of the present invention is to provide a pharmaceutical composition, comprising the DNA nanosponge system described in the first aspect and a pharmaceutically acceptable carrier.

[0017] The third aspect of the present invention is to provide the application of the DNA nanosponge system described in the first aspect in the preparation of drugs for treating ovarian cancer.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The DNA nanosponge system provided by the present invention loads zinc oxide nanoparticles with oxygen vacancies nan (ZnOov) and doxorubicin (DOX) through the DNA nanosponge. The DNA nanosponge includes a MUC1 aptamer, a HIF-1α DNAzyme, and a DOX drug-loading region; it has the following effects generated by the following mechanism:

[0020] Targeted delivery: It can specifically recognize ovarian cancer cells through the MUCl aptamer and improve the drug uptake efficiency;

[0021] Microenvironment regulation: By means of ZnOov catalyzing H2O2 to produce O2, the hypoxia of the TME is alleviated; Zn 2+Release the activated DNAzyme, inhibit the HIF-1a signaling pathway, and reduce the expression of VEGF and ABCB-1;

[0022] Metabolic reprogramming and ferroptosis: Block the Warburg effect, enhance mitochondrial respiration, and increase the ROS level; Combine with the catalytic effect of ZnOov to disrupt the redox balance, induce lipid peroxidation and ferroptosis;

[0023] Drug controlled release: In the acidic environment of lysosomes, the DNA nanosponge disintegrates and releases doxorubicin and DNAzyme, achieving synergistic enhancement of chemotherapy and gene regulation. Brief Description of the Drawings

[0024] Figure 1 Schematic diagram of the construction and synthesis process of the DNA nanosponge system described in the present invention.

[0025] Figure 2 Schematic diagram of the synthesis process of ZnOov described in the present invention.

[0026] Figure 3 SEM image of ZnOov prepared in Example 1 of the present invention.

[0027] Figure 4 X-ray diffraction analysis pattern of ZnOov prepared in Example 1 of the present invention.

[0028] Figure 5 Results of electron paramagnetic resonance and X-ray photoelectron spectroscopy analysis of ZnOov prepared in Example 1 of the present invention.

[0029] Figure 6 Results of system concentration parameter optimization in Example 2 of the present invention.

[0030] Figure 7 Analysis results of the response of SKOV3 and A2780 to DOX after system intervention in Example 3 of the present invention.

[0031] Figure 8 Analysis results of the relative mRNA expression levels of cellular HIF-1a (a), VEGF (b), and ABCB-1 (c) after intervention with the system and its precursor in Example 3 of the present invention.

[0032] Figure 9 Results of the decrease in the expression levels of multiple genes after system intervention in Example 3 of the present invention.

[0033] Figure 10 Comparison results of metabolite levels before and after cell intervention in Example 3 of the present invention.

[0034] Figure 11 Comparison results of metabolite levels before and after cell intervention in Example 3 of the present invention.

[0035] Figure 12 This shows the changes in the intracellular reactive oxygen species levels after the system and its intermediate products in Example 3 of the present invention intervened in cells. Detailed implementation manners

[0036] The technical solutions of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without any creative work belong to the scope of protection of the present invention.

[0037] In one embodiment, a multifunctional DNA nanosponge system (ZnOov@DS-DOX) is proposed to achieve chemotherapy sensitization for ovarian cancer through targeted delivery, metabolic reprogramming, and ferroptosis induction. The DNA nanosponge system is obtained by rolling circle amplification of a circular DNA substrate and loading DOX and zinc oxide nanoparticles with oxygen vacancies; the circular DNA substrate is amplified using single-stranded DNA as a template, and the single-stranded DNA contains a nucleotide sequence targeting MUC1 and a DNAzyme region targeting HIF-1a. The specific technical solutions are as follows:

[0038] 1. Structure design:

[0039] Zinc oxide nanoparticles with oxygen vacancies (ZnOov): Novel synthesis of 2D-shaped zinc oxide nanoparticles loaded with oxygen vacancies. Small-sized ZnO nanoparticles with oxygen vacancy defects are synthesized by treating 2D Zn-MOF with thiourea, which can catalyze H2O2 in the tumor microenvironment to produce O2, relieve hypoxia, and release Zn 2+ to activate DNAzyme.

[0040] DNA nanosponge (DS): Constructed by rolling circle amplification (RCA) technology, and contains the following functional modules:

[0041] MUC1 aptamer: Specifically targets the ovarian cancer cell surface marker MUC1.

[0042] HIF-1a DNAzyme: Cleaves HIF-1a mRNA under the activation of Zn 2+ to inhibit the downstream key glycolytic enzymes (PKM2, LDHA) and the drug efflux protein ABCB-1.

[0043] DOX loading site: Binds to DOX through the GC sequence enrichment region to achieve precise drug release.

[0044] The ZnOov nanoparticles are combined with the DNA nanosponge to form ZnOov@DS-DOX.

[0045] The construction and synthesis process of the DNA nanosponge is as Figure 1 shown.

[0046] 2. Working principle:

[0047] Targeted delivery: Specific recognition of ovarian cancer cells through the MUC1 aptamer to improve the drug uptake efficiency (the intracellular uptake rate in cancer cells is 14.9 times higher than that in normal cells).

[0048] Microenvironment regulation: ZnOov catalyzes H2O2 to produce O2 to relieve hypoxia in the TME; Zn 2+ releases and activates DNAzyme, inhibits the HIF-1a signaling pathway, and reduces the expression of VEGF and ABCB-1.

[0049] Metabolic reprogramming and ferroptosis: Block the Warburg effect, enhance mitochondrial respiration, and increase the ROS level; combined with the catalytic effect of ZnOov, disrupt the redox balance, induce lipid peroxidation and ferroptosis

[0050] Drug controlled release: In the acidic environment of lysosomes, the DNA nanosponge disintegrates and releases DOX and DNAzyme, achieving synergistic enhancement of chemotherapy and gene regulation (the IC50 value is reduced by 72.7%).

[0051] In a preferred embodiment, the synthesis process of the ZnOov is as Figure 2 shown, specifically, the synthesis process of ZnOov is as follows:

[0052] 1) Dissolve zinc nitrate hexahydrate, pyridine, and polyvinylpyrrolidone (PVP) in a mixed solvent (the volume ratio of N,N-dimethylformamide (DMF) to absolute ethanol is 3:1), and then add a solution of tetrakis(4-carboxyphenyl)porphyrin (TCPP) to the above solution. Place the mixed solution at 80 °C for 24 hours. After the reaction, collect the product by centrifugation and dry it to obtain a two-dimensional zinc metal-organic framework material (2D-Zn MOF).

[0053] 2) Calcinate the obtained two-dimensional zinc metal-organic framework material at 350 °C for 2 hours, and collect the sample after natural cooling to obtain zinc oxide nanoparticles (ZnO);

[0054] 3) Thoroughly mix the zinc oxide nanoparticles obtained in step 2) with an equal amount of thiourea, heat and react in an argon atmosphere at 300 - 500 °C for 1 - 3 hours, and finally obtain zinc oxide nanoparticles with oxygen vacancies (ZnOov) after cooling.

[0055] Synthesis of ZnOov in Example 1

[0056] 1. The synthesis process of ZnOov is as Figure 2As shown, the specific steps include:

[0057] 1) Dissolve 9 mg of zinc nitrate hexahydrate, 2.4 mg of pyridine and 60 mg of polyvinylpyrrolidone (PVP) in a mixed solvent (the volume ratio of N,N-dimethylformamide to anhydrous ethanol is 3:1);

[0058] 2) Add 13.2 mg of tetrakis(4-carboxyphenyl)porphyrin (TCPP) to 12 ml of a mixed solvent (DMF: anhydrous ethanol = 3:1) to prepare a solution, add the solution to the solution obtained in step 1), stir with a magnetic stirrer for 30 min, and react at 80° C. for 24 hours;

[0059] 3) After the reaction is completed, the product is collected by centrifugation at 10000 r / min for 10 min and dried to obtain a two-dimensional zinc metal organic framework material (2D-Zn MOF).

[0060] 4) The obtained two-dimensional zinc metal organic framework material is placed in a muffle furnace, heated to 350°C at a heating rate of 2°C / min, and calcined for 2 hours. After natural cooling, the sample is collected to obtain (ZnO), which is fully mixed with an equal amount of thiourea, heated at 400°C for 2 hours in an argon atmosphere, and finally zinc oxide nanoparticles (ZnOov) containing oxygen vacancies are obtained after natural cooling.

[0061] 2. Characterization of ZnOov

[0062] 1) Observe the SEM images of ZnOov and its precursor by electron microscopy, such as Figure 3 As shown, Figure 3 In the figure, (a) 2D-Zn MOF electron microscopy photo; (b) ZnO electron microscopy photo of the corresponding oxidation product formed at high temperature of Zn MOF; (c) ZnOov electron microscopy photo.

[0063] 2) Analyze ZnOov by X-ray diffraction, and the analysis spectrum is as follows Figure 4 As shown, the standard peak spectrum number corresponding to peak II and peak III is 99-0111, indicating that the main component of ZnOov is zinc oxide.

[0064] 3) Through electron paramagnetic resonance and X-ray photoelectron spectroscopy analysis, the results are as follows Figure 5 shown. Figure 5 In the figure, (a) electron paramagnetic resonance g-factor analysis, g-factor 2.004; (b) X-ray photoelectron spectroscopy spectrum, the characteristic peaks of S, C, N, O, and Zn elements were analyzed by Avantage software; (c) XPS O 1s peak analysis of oxygen vacancies. The analysis results show that the prepared ZnOov produces oxygen vacancies.

[0065] Synthesis of DNA nanosponge in Example 2

[0066] 1) Synthesis of circular DNA substrate

[0067] The circular DNA substrate is synthesized using phosphorylated single-stranded DNA (ssDNA) as the raw material. Primers are added and ligation is catalyzed by T4 DNA ligase to obtain the product.

[0068] The ssDNA sequence is: AAAAAAAAAAGCTCAACTACGTTACCTAACAGGTAAC GCTTCAACAGAGAGAGAGAGAGACCAGGGTATCCAAAGGATCAACTGC AAAAAAAAAAACTTCTTCGACCGGCTCGGAATTCTTTAC (SEQ ID NO: 1), with a phosphate group labeled at the 5' end.

[0069] The primer sequence is: AACGTAGTTGAGCTTTTTTTTTGTAAAGAATTCCGAGC CGGT (SEQ ID NO: 2). The ratio of the primer to the ssDNA template is 2:1. The two are mixed in T4 DNA ligase buffer, heated to 85°C, annealed at 45°C, and then left standing at 37°C for 2 h. Subsequently, T4 ligase is added and the reaction is carried out overnight to form the circular DNA substrate.

[0070] 2) Subsequently, using this circular DNA substrate as a template, primers, dNTPs, and Phi29 DNA polymerase are added, and a rolling circle amplification (RCA) reaction is carried out at 30°C for 6 - 10 h to finally prepare the DNA nanosponge.

[0071] The corresponding sequence after RCA amplification of the circular DNA substrate template is:

[0072] GTAAAGAATTCCGAGCCGGTCGAAGAAGTTTTTTTTTTTGCAGTTG ATCCTTTGGATACCCTGGTCTCTCTCTCTCTCTGTTGAAGCGTTACCTGTT AGGTAACGTAGTTGAGCTTTTTTTTT (SEQ ID NO: 3). Among them, the polyT region binds to the polyA region of the drug-loaded scaffold. The GTAAAGAATTCCGAGCCGGTCGAAGAAGTTTTT (SEQ ID NO: 4) region is the DNAzyme region targeting HIF-1a. GCAGTTGATCCTTTGGATACCCTGG (SEQ ID NO: 5) is the MUC1 aptamer region.

[0073] 3) Load DOX with DNA duplexes rich in GC sequences. The sequence of the DNA duplex scaffold is as follows: AAAAAAAAAGCGCGCGCGCGCGCGC (SEQ ID NO: 6). The GC partial sequence belongs to a palindromic structure and can bind to each other to form double-stranded DNA. The polyA part can be complementary paired with polyT in the DNA nanosponge to achieve the effective loading of DOX into the DNA nanosponge. After annealing the Scaffold sequence by heating, it is placed at 37 °C and left standing. Subsequently, the DOX solution is added, and it is incubated overnight on a shaker at 4 °C.

[0074] Synthesis of ZnOov@DS-DOX by RCA in Example 3

[0075] In this example, ZnOov was loaded by rolling circle amplification. The preferred ZnOov concentration process: Set a series of concentration gradients from low to high (0 - 400 μg / ml), evaluate the change in cell viability as the concentration increases, and select the lowest concentration that can reduce cell viability, which is 400 μg / ml ( Figure 6 a).

[0076] The preferred RCA reaction time for DNA nanosponge synthesis: Set the RCA reaction time from short to long (0 / 4 / 6 / 8 / 10 h), evaluate the change in cell viability as the concentration increases. As Figure 6 shown in b, when the dilution factor is controlled at 20 times, the products of the RCA reaction with a duration of 0 - 8 h have no obvious effect on cell viability, while when the RCA reaction reaches 10 h, a preliminary decrease in cell viability appears, that is, the reaction duration of 10 h is the shortest effective duration.

[0077] Role of ZnOov@DS-DOX in the synergistic enhancement of chemotherapy and gene regulation in Example 4

[0078] 1) After system intervention, the IC50 value of ovarian cancer cells for DOX decreased

[0079] Set a series of concentration gradients of DOX, and compared the inhibitory effects of free DOX and DOX carried by the system we constructed on cell viability. As Figure 7 shown, in ovarian cancer cells SKOV3 and A2780 cells, after system intervention, the IC50 value decreased compared with the traditional free DOX group.

[0080] 2) After system intervention, the expression level of HIF-1a-related genes decreased

[0081] The RT-PCR method was used to evaluate the changes in the expression levels of HIF-1a and its downstream ABCB-1 and VEGF in ovarian cancer cells after system intervention. As Figure 8 shown, the expression of the above three genes decreased after system intervention, and the effect of the complete ZnOov@DS-DOX system was better than that of the intermediate.

[0082] 3) After the system intervention, the expression levels of glycolysis-related genes PKM2 and LDHA decreased, and the expression level of the gene GPX-4 involved in the cellular redox reaction decreased. Moreover, the inhibitory effect of the complete ZnOov@DS-DOX system was better than that of the intermediate Figure 9 ).

[0083] 4) After the system intervention, the level of glycolytic products in ovarian cancer cells decreased, while the level of tricarboxylic acid cycle products increased Figure 10 and Figure 11 ).

[0084] 5) After the system intervention, the level of reactive oxygen species in ovarian cancer cells increased significantly. As Figure 12 shown, the DCFH-DA probe was used to detect reactive oxygen species. It was found that after the intervention with the complete ZnOov@DS-DOX system, the level of cellular reactive oxygen species increased, and the degree of increase was better than that of other intermediate groups.

[0085] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A DNA nanosponge system, characterized in that: The method is obtained by rolling circle amplification of a circular DNA substrate and loading doxorubicin and zinc oxide nanoparticles containing oxygen vacancies; the circular DNA substrate is amplified using a single-stranded DNA as a template, and the single-stranded DNA contains nucleotide sequences of a drug-carrying region, a MUC1 aptamer region, and a DNAzyme region targeting HIF-1a.

2. The DNA nanosponge system according to claim 1, characterized in that The nucleotide sequence of the single-stranded DNA is shown in SEQ ID NO:

1.

3. The DNA nanosponge system according to claim 1, characterized in that The nucleotide sequence of the primer used for amplification of the single-stranded DNA and / or the primer used for rolling circle amplification is shown in SEQ ID NO:

2.

4. The DNA nanosponge system according to claim 1, characterized in that The DOX loading process uses double-stranded DNA rich in GC sequences.

5. The DNA nanosponge system according to claim 4, characterized in that The double-stranded DNA is constructed based on the nucleotide sequence shown in SEQ ID NO:

6.

6. The DNA nanosponge system according to claim 1, characterized in that The oxygen vacancy-containing zinc oxide nanoparticles are obtained by calcining a two-dimensional zinc metal organic framework material to obtain zinc oxide, mixing it with thiourea, reacting it at 300-500° C. for 1-3 hours, and cooling it.

7. The DNA nanosponge system according to claim 6, characterized in that During the loading process of the zinc oxide nanoparticles containing oxygen vacancies, the concentration of the zinc oxide nanoparticles containing oxygen vacancies is 50-400 ug / ml.

8. The DNA nanosponge system according to claim 1, characterized in that The rolling circle amplification time is 1-10 hours.

9. A pharmaceutical composition, characterized in that The invention comprises the DNA nanosponge system according to any one of claims 1 to 8, and a pharmaceutically acceptable carrier.

10. Use of the DNA nanosponge system according to any one of claims 1 to 8 in the preparation of drugs for treating ovarian cancer.

Images