Recombinant adeno-associated virus capsid protein and application thereof

By inserting specific amino acid fragments at specific locations of the AAV9 capsid protein, the formation of recombinant adeno-associated viral capsid protein is solved, and the transduction efficiency of AAV in pancreatic tissue is achieved, which achieves higher viral yield and transduction efficiency, meeting the needs of clinical trials of gene therapy.

CN120209092APending Publication Date: 2025-06-27OBIO TECH (SHANGHAI) CORP LTD
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510369190.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Existing adeno-associated viruses (AAVs) are less efficient in transduction in pancreatic tissues, and the existing serotype AAV9 capsids cannot meet the needs of clinical trials of gene therapy.

Method used

The recombinant adeno-associated viral capsid protein is formed by inserting specific amino acid fragments at specific locations of the AAV9 capsid protein, which improves its transduction efficiency in the pancreas.

Benefits of technology

Compared with wild-type AAV9 and AAV8, recombinant adeno-associated viral capsid proteins show stronger expression ability in animal pancreas, significantly improving the yield and transduction efficiency of the virus.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120209092A_ABST
    Figure CN120209092A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biology, in particular to a recombinant adeno-associated virus capsid protein and application thereof. The recombinant adeno-associated virus capsid protein is inserted with an amino acid fragment shown as SEQ ID NO: 1 or SEQ ID NO: 2, and the insertion position is between the 588th amino acid and the 589th amino acid by taking a wild type AAV9 capsid protein with the total length of 736 amino acids as a reference.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present disclosure generally relates to the field of biotechnology, and more particularly, to a recombinant adeno-associated virus capsid protein and its applications. Background Art

[0002] Adeno-associated virus (AAV) is a class of minute, non-enveloped viruses with an icosahedral structure, and is also the simplest single-stranded DNA defective virus discovered so far. It requires a helper virus (usually adenovirus or herpesvirus) to complete virus packaging.

[0003] Recombinant adeno-associated virus vector (rAAV) has been widely used in basic research and clinical trials due to its advantages such as broad host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance and stable physical properties. It is regarded as one of the most promising gene transfer vectors and has been widely used in gene therapy and vaccine research worldwide.

[0004] The pancreas is a gland with both endocrine and exocrine functions, and its physiological functions and pathological changes are closely related to life. In vivo gene delivery to the pancreas particularly emphasizes gene transfer to specific cells to study and analyze the physiological and pathological roles of key genes in the development of pancreatic diseases. At the same time, AAV can be used to deliver insulin genes or other genes related to blood glucose regulation to pancreatic β cells for diabetes-related research. AAV can also deliver therapeutic drugs or RNA molecules to specific pancreatic cells to improve the therapeutic effect and reduce side effects. Currently, there are few related studies and treatments on the pancreas, and better delivery tools are still needed for related research and treatment.

[0005] Different serotypes of adeno-associated virus (AAV) have different capsid protein sequences and spatial conformations, resulting in different cell surface receptors they recognize and bind to. Therefore, there are significant differences in the infected cells, tissue types, and infection efficiency. The compactness of pancreatic tissue may affect the delivery efficiency of AAV. Native AAV8 has a better transduction efficiency in the pancreas than AAV1, AAV2, and AAV5 serotypes, and its transduction effect increases with the increase in dose. In addition, although AAV9 has a good overall infection ability for the pancreas, its transduction efficiency for pancreatic endocrine cells is relatively low. Pancreatic duct injection is one of the most effective pancreatic transduction methods at present. Compared with systemic administration, it has a higher transduction efficiency and stronger specificity. However, the operation of duct injection is difficult and highly traumatic, which requires relatively high skills for most experimental personnel. Currently, intraperitoneal injection is widely used. There are literature reports that optimized AAV8 capsids (such as Y447F+Y733F) can also significantly improve the pancreatic transduction efficiency through intraperitoneal injection. However, the current production efficiency of adeno-associated virus and its transduction efficiency in pancreatic tissue need to be improved. Therefore, in order to increase the virus yield and transduction efficiency, the existing capsid proteins are usually modified. However, the existing serotype (such as AAV9) capsids still cannot meet the requirements of gene therapy clinical trials. Summary of the Invention

[0006] The present disclosure encompasses the following technical solutions:

[0007] One aspect of the present disclosure relates to a recombinant adeno-associated virus capsid protein into which an amino acid fragment shown in SEQ ID NO:1 or SEQ ID NO:2 is inserted. The insertion position is between the 588th and 589th amino acids with reference to the wild-type AAV9 capsid protein with a full length of 736 amino acids.

[0008] According to another aspect of the present disclosure, it relates to an isolated polynucleotide encoding the recombinant adeno-associated virus capsid protein as described above.

[0009] According to still another aspect of the present disclosure, it relates to a vector containing the polynucleotide as described above.

[0010] According to yet another aspect of the present disclosure, it relates to a host cell containing the polynucleotide as described above or the vector as described above.

[0011] According to yet another aspect of the present disclosure, it relates to a method for producing a recombinant adeno-associated virus capsid protein, which includes culturing the host cell as described above under conditions for expressing the polynucleotide as described above and producing the capsid protein.

[0012] According to yet another aspect of the present disclosure, it relates to a combination product of recombinant adeno-associated virus packaging vectors, which includes:

[0013] A first nucleotide that encodes one or more AAV Rep proteins;

[0014] A second nucleotide that encodes a capsid protein and comprises the polynucleotide according to claim 2;

[0015] A third nucleotide that comprises a recombinant adeno-associated virus genome;

[0016] Wherein the packaging vector combination product is operable in a cell to encapsulate the recombinant adeno-associated virus genome in a capsid to form a recombinant adeno-associated virus.

[0017] According to yet another aspect of the present disclosure, there is provided a kit comprising the vector as described above, or the packaging vector combination product as described above.

[0018] According to yet another aspect of the present disclosure, there is provided a recombinant adeno-associated virus comprising: (a) a capsid comprising the recombinant adeno-associated virus capsid protein as described above; and (b) a recombinant adeno-associated virus genome.

[0019] According to yet another aspect of the present disclosure, there is provided a method of delivering a transgene to a cell, the method comprising contacting the cell with the recombinant adeno-associated virus as described above under conditions that transduce the cell and express the transgene.

[0020] According to yet another aspect of the present disclosure, there is provided a pharmaceutical composition comprising the recombinant adeno-associated virus as described above.

[0021] The recombinant adeno-associated virus capsid protein of the present disclosure or the recombinant adeno-associated virus packaged by the recombinant adeno-associated virus capsid protein exhibits stronger expression in the animal pancreas compared to wild-type AAV9 and AAV8 (such as Y447F + Y733F). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the specific embodiments of the present disclosure or the technical solutions in the prior art, the following will briefly introduce the drawings required for the description of the specific embodiments or the prior art. Obviously, the drawings in the following description are some embodiments of the present disclosure. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.

[0023] Figure 1 : Flow chart for screening and verification of AAV9 capsid mutants;

[0024] Figure 2 : Skeleton plasmid of the mutant library;

[0025] Figure 3 : Map of plasmid pAAV-CBh-EGFP-WPRE;

[0026] Figure 4 : Plasmid AAV-PAN-05 map;

[0027] Figure 5 : Plasmid AAV-PAN-08 map;

[0028] Figure 6 : Fluorescence photograph of mouse pancreatic tissue section;

[0029] Figure 7 : Statistical chart of average fluorescence brightness of mouse pancreatic tissue section. Detailed implementation manners

[0030] Reference will now be provided in detail to embodiments of the present disclosure, one or more examples of which are described below. Each example is provided by way of explanation and not limitation of the present disclosure. In fact, it will be apparent to those skilled in the art that various modifications and variations can be made to the present disclosure without departing from the scope or spirit of the present disclosure. For example, features illustrated or described as part of one embodiment can be used in another embodiment to yield a still further embodiment.

[0031] Unless otherwise specified, the meanings of all terms (including technical and scientific terms) used to disclose the present disclosure are the same as those commonly understood by one of ordinary skill in the art to which the present disclosure pertains. Through further guidance, the following definitions are used to better understand the teachings of the present disclosure. The terms used in the specification of the present disclosure herein are for the purpose of describing specific embodiments only and are not intended to limit the present disclosure.

[0032] In the present disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Also, the protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, immunology related terms and laboratory operation steps used herein are widely used terms and conventional steps in the respective fields. At the same time, to better understand the present disclosure, the definitions and explanations of related terms are provided below.

[0033] As used herein, the terms "and / or", "or / and", and "and / or" include any one of two or more related listed items, as well as any and all combinations of the related listed items. The said any and all combinations include combinations of any two related listed items, any more related listed items, or all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or", "or / and", and "and / or", it should be understood that in the present disclosure, this technical solution undoubtedly includes the technical solution connected by "logical AND", and undoubtedly also includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D (that is, the technical solution connected by "logical AND").

[0034] As used in the present disclosure, the terms "comprising", "containing", and "including" are synonyms, which are inclusive or open-ended and do not exclude additional, unrecited members, elements, or method steps.

[0035] The numerical ranges expressed by endpoints in the present disclosure include all the numerical values and fractions included within the range, as well as the recited endpoints.

[0036] In this application, in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc., the terms "first", "second", "third", "fourth", etc. are only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumerative description and should be understood not to constitute a closed limitation on quantity.

[0037] In the present disclosure, when it comes to concentration values, their meanings include fluctuations within a certain range. For example, it can fluctuate within the corresponding precision range. For example, for 2%, a fluctuation within the range of ±0.1% is allowed. For larger numerical values or those that do not require overly precise control, a greater fluctuation in their meanings is also allowed. For example, for 100 mM, fluctuations within the ranges of ±1%, ±2%, ±5%, etc. are allowed. When it comes to molecular weight, a fluctuation of ±10% in its meaning is allowed.

[0038] As used herein, unless otherwise indicated, the singular forms of the articles "a", "an", and "the" include plural referents.

[0039] In the present disclosure, descriptions such as "a plurality of" and "multiple types", unless otherwise specifically defined, refer to a quantity greater than or equal to 2.

[0040] In the present disclosure, among the technical features described in an open-ended manner, it includes a closed technical solution composed of the listed features, and also includes an open technical solution containing the listed features.

[0041] In the present disclosure, "preferred", "better", "more preferable", and "preferably" are only used to describe embodiments or examples with better effects. It should be understood that they do not constitute a limitation on the protection scope of the present disclosure. In the present disclosure, "optionally", "optional", and "optional" mean that it can be present or absent, that is, it refers to any one of the two parallel options of "present" or "absent". If "optional" appears multiple times in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction relationship, each "optional" is independent of each other.

[0042] All documents mentioned in the present disclosure are incorporated herein by reference as if each document was individually incorporated by reference. Unless it conflicts with the inventive purpose and / or technical solution of the present disclosure, the cited documents related to the present disclosure are incorporated in their entirety and for all purposes. When the present disclosure refers to a cited document, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited document are also incorporated by reference. When the present disclosure refers to a cited document, examples and preferred methods of the relevant technical features cited can also be incorporated into the present disclosure as references, but only to the extent that the present disclosure can be implemented. It should be understood that when the cited content conflicts with the description in the present disclosure, the present disclosure shall prevail or be amended adaptively according to the description of the present disclosure.

[0043] As used herein, the term "recombinant adeno-associated virus" or "rAAV" refers to an AAV containing a genome lacking functional rep and cap genes.

[0044] As used herein, the term "cap gene" refers to a nucleic acid sequence encoding a capsid protein. For AAV, the capsid protein can be VP1, VP2, or VP3. The VP1, VP2, and / or VP3 capsid proteins assemble into a capsid surrounding the rAAV genome.

[0045] As used herein, the term "rep gene" refers to a nucleic acid sequence encoding non-structural proteins (such as rep78, rep68, rep52, and rep40) required for the replication and production of AAV.

[0046] As used herein, the term "rAAV genome" refers to a nucleic acid molecule (e.g., DNA and / or RNA) that contains the genomic sequence of rAAV. One of ordinary skill in the art will understand that in the case where the rAAV genome contains a transgene (e.g., a heavy or light chain coding sequence of an antibody operably linked to a transcriptional regulatory element), the rAAV genome can be in a sense or antisense orientation relative to the transcriptional direction of the transgene.

[0047] As used herein, an "isolated polynucleotide" refers to a polynucleotide that has been isolated from one or more nucleic acid molecules present in its natural source.

[0048] As used herein, a "vector" refers to a nucleic acid molecule that serves as a vehicle for introducing a nucleic acid molecule (e.g., a polynucleotide disclosed herein) into a cell.

[0049] As used herein, an "expression vector" refers to a vector (e.g., a polynucleotide disclosed herein) that contains a transcriptional regulatory element operably linked to a gene of interest, which promotes the expression of the gene of interest in a cell and / or a cell-free expression system.

[0050] As used herein, the term "transgene" refers to a non-AAV nucleic acid sequence that encodes a polypeptide (e.g., a protein, an antibody, or an scFv) or a non-coding RNA (e.g., miRNA, shRNA, siRNA, antisense RNA, gRNA, antagomir, miRNA sponge, RNA aptazyme, RNA ribozyme, or RNA aptamer).

[0051] As used herein, "nucleic acid" has the meaning well known in the art and is also referred to as "polynucleotide", which is a molecule formed by multiple nucleotide monomers.

[0052] As used herein, unless otherwise specified, "protein" has the same meaning as "protein", both corresponding to "Protein" and can be used interchangeably. "Protein", "multi-amino acid", "peptide" and "polypeptide" have the same meaning and can be used interchangeably, all including at least two amino acid units.

[0053] The first aspect of the present disclosure relates to a recombinant adeno-associated virus capsid protein into which an amino acid fragment having a sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 is inserted, and the insertion position is between the 588th and 589th amino acids with reference to the wild-type AAV9 capsid protein having a full length of 736 amino acids.

[0054] The NCBI number of the wild-type AAV9 capsid protein (Cap) referred to in the present invention is: AY530579. It should be noted that the reference sequence of the above wild-type AAV9 capsid protein does not limit the mutant AAV9 capsid protein mentioned in the present invention. Except for SEQ ID NO:1 or SEQ ID NO:2, other amino acid sequences of the mutant AAV9 capsid protein can be functional variants with partial differences. For example, other amino acid sequences are amino acid sequences having at least about 85% (e.g., at least about 90%, at least about 92%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.5%, or 100%) amino acid sequence identity with the reference sequence. Compared with the reference wild-type AAV9 capsid protein sequence, the mutations of the functional variant are preferably amino acid substitutions, deletions or additions or any combination thereof; preferably, the mutations are conservative substitutions. "Conservative substitution" means the substitution of an amino acid in a protein by another amino acid having similar characteristics (such as charge, side chain size, hydrophobicity / hydrophilicity, backbone conformation and rigidity, etc.), so that changes can be frequently made without changing the biological activity of the protein. Substitutions that are generally regarded as conservative substitutions are the substitutions of each other among the aliphatic amino acids Ala, Val, Leu and Ile, the interchange of the hydroxyl residues Ser and Thr, the exchange of the acidic residues Asp and Glu, the substitution between the amide residues Asn and Gln, the exchange of the basic residues Lys and Arg, and the substitution between the aromatic residues Phe and Tyr, etc. Those skilled in the art know that generally, a single amino acid substitution in a non-essential region of a polypeptide basically does not change the biological activity (see, for example, Watson et al. (1987) Molecular Biology of the Gene, The Benjamin / Cummings Pub. Co., page 224, (4th edition)). In addition, the substitution of amino acids with similar structures or functions is unlikely to destroy the biological activity.

[0055] It is easy to understand that the recombinant adeno-associated virus capsid protein can assemble to form an infectious recombinant adeno-associated virus. Further, the virus packaged thereby has at least about 10% or more enhanced infectivity for pancreatic cells (the infectivity is typically evaluated by the method used in Example 2 of the present invention) compared with the wild-type recombinant adeno-associated virus (especially AAV9), preferably enhanced by about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 100%, about 110% or about 120% or more.

[0056] The second aspect of the present disclosure relates to an isolated polynucleotide encoding the recombinant adeno-associated virus capsid protein as described above.

[0057] The isolated nucleic acid includes RNA genomic sequences, DNA (gDNA and cDNA), or RNA sequences transcribed from DNA. Moreover, unless otherwise specified, the polypeptides also include natural polynucleotides, sugars, or analogs with base alterations.

[0058] The isolated polynucleotide includes a nucleotide sequence encoding the amino acid sequence of the recombinant adeno-associated virus capsid protein, and also includes a nucleotide sequence complementary thereto. The complementary sequence includes a completely complementary sequence and a substantially complementary sequence, which refers to a sequence that can hybridize with the nucleotide sequence encoding the amino acid sequence of the protein complex under stringent conditions known in the art.

[0059] In addition, the codons of the nucleic acid corresponding to the capsid protein can be optimized according to the species of the host cell.

[0060] The third aspect of the present disclosure relates to a vector comprising the polynucleotide as described above;

[0061] In some embodiments, the vector is a plasmid or a viral vector.

[0062] In some embodiments, the vector is an expression vector.

[0063] The vector (e.g., an expression vector) can be introduced into cells (using any technique known in the art) for the propagation of the vector and / or for the expression of the AAV capsid protein encoded by the vector. Thus, in the fourth aspect of the present disclosure, a host cell is provided that contains the polynucleotide as described above or the vector as described above (e.g., an expression vector). And further, in the fifth aspect of the present disclosure, a method for producing a recombinant adeno-associated virus capsid protein is provided, the method comprising culturing the host cell as described above under conditions that express the polynucleotide as described above and produce the capsid protein.

[0064] A variety of host cells and expression vector systems can be used to express the capsid proteins described herein. In these expression systems, the coding sequences of interest can be produced and subsequently purified. These expression systems also represent cells that can express the capsid proteins described herein in situ when transformed or transfected with the appropriate nucleotide coding sequences. These include, but are not limited to, microorganisms such as bacteria (e.g., Escherichia coli and Bacillus subtilis) transformed with recombinant phage DNA, plasmid DNA, or cosmid DNA expression vectors containing the capsid protein coding sequence; yeast (e.g., Saccharomyces Pichia) transformed with recombinant yeast expression vectors such as those containing the capsid protein coding sequence; insect cell systems infected with recombinant viral expression vectors such as baculovirus; plant cell systems (e.g., green algae such as Chlamydomonas reinhardtii) infected with recombinant viral expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors such as Ti plasmids containing the capsid protein coding sequence; or mammalian cell systems (e.g., COS (e.g., COS1 or COS), CHO, BHK, MDCK, HEK 293, NS0, PER.C6, VERO, CRL7O3O, HsS78Bst, HeLa, NIH 3T3, HEK-293T, HepG2, SP210, R1.1, B-W, L-M, BSC1, BSC40, YB / 20, and BMT10 cells) containing a recombinant expression construct that contains a promoter derived from the genome of a mammalian cell (e.g., the metallothionein promoter) or a promoter derived from a mammalian virus (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). In an embodiment, the cells used to express the capsid proteins described herein are human cells, such as a human cell line. In an embodiment, the mammalian expression vector is pOptiVEC TM or pcDNA3.3. In an embodiment, bacterial cells (such as E. coli) or eukaryotic cells (e.g., mammalian cells) are used for the expression of the capsid protein. For example, mammalian cells (such as CHO or HEK293 cells) in combination with a vector (such as the major immediate early gene promoter element from human cytomegalovirus) are an effective expression system for the capsid proteins disclosed herein. In an embodiment, insect cells (e.g., Sf9 cells) are used for the expression of the capsid protein.

[0065] For example, in an insect system, Autographa californica multiple nucleopolyhedrovirus (AcNPV) can be used as a vector for expressing foreign genes. This virus grows in Spodoptera frugiperda cells. The capsid protein coding sequence can be cloned separately into a non-essential region of the virus (such as the polyhedrin gene) and placed under the control of an AcNPV promoter (such as the polyhedrin promoter).

[0066] In mammalian host cells, many virus-based expression systems can be utilized. In the case of using adenovirus as an expression vector, the capsid protein coding sequence of interest can be ligated to an adenovirus transcriptional / translational control complex, such as, for example, a late promoter and tripartite leader sequence. The chimeric gene can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the virus genome (such as, for example, the E1 region or E3 region) will generate a recombinant virus that is viable and capable of expressing the capsid protein molecule in the infected host (see, for example, Logan J & Shenk T (1984) PNAS 81(12):3655-9, which is incorporated herein by reference in its entirety). Efficient translation of the inserted capsid protein coding sequence may also require specific initiation signals. These signals include the ATG start codon and adjacent sequences. In addition, the start codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These foreign translational control signals and start codons can have multiple sources, including natural and synthetic. Expression efficiency can be enhanced by including appropriate transcriptional enhancer elements, transcriptional terminators, etc. (see, for example, Bitter G et al., (1987) Methods Enzymol. 153:516-544, which is incorporated herein by reference in its entirety). Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, Hela, MDCK, HEK 293, NIH 3T3, W138, BT483, Hs578T, HTB2, BT2O, T-47D, NS0, CRL7O3O, COS (such as, for example, COS1 or COS), PER.C6, VERO, HsS78Bst, HEK-293T, HepG2, SP210, R1.1, B-W, L-M, BSC1, BSC40, YB / 20, BMT10, and HsS78Bst cells.

[0067] For long-term, high-yield production of recombinant proteins, stable expression cells can be generated. For example, cell lines that stably express the capsid proteins described herein can be engineered.

[0068] In an embodiment, instead of using an expression vector containing a viral replication origin, a host cell can be transformed with a polynucleotide (e.g., DNA or RNA) controlled by appropriate transcriptional regulatory elements (e.g., promoter, enhancer, sequence, transcription terminator, polyadenylation site, etc.) and a selectable marker.

[0069] In a preferred embodiment, the promoter is a pancreas-specific promoter, such as Insulin promoter (INS), Glucagon promoter, Elastase promoter, Ptf1a promoter, pxd1 promoter, Ins2 promoter, and GCG promoter.

[0070] The sixth aspect of the present disclosure relates to a recombinant adeno-associated virus packaging vector combination product, which comprises:

[0071] A first nucleotide encoding one or more AAV Rep proteins;

[0072] A second nucleotide encoding a capsid protein and containing the polynucleotide as described above;

[0073] A third nucleotide containing a recombinant adeno-associated virus genome;

[0074] Wherein the packaging vector combination product is operable in a cell to encapsulate the recombinant adeno-associated virus genome in a capsid to form a recombinant adeno-associated virus.

[0075] In some embodiments, the combination product comprises a first vector and a second vector;

[0076] The first vector contains the first nucleotide and the second nucleotide, and the second vector contains the third nucleotide.

[0077] In some embodiments, the combination product comprises a fourth nucleotide, which comprises one or more helper virus genes. In embodiments of the combination product, the helper virus is selected from the group consisting of adenovirus, herpes virus (including herpes simplex virus (HSV), except herpes simplex virus type 1), poxvirus (such as vaccinia virus, cowpox virus), cytomegalovirus (CMV), and baculovirus. In embodiments where the helper virus is adenovirus, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E1, E2, E4, and VA. In embodiments, the adenovirus genome comprises one or more adenovirus RNA genes selected from the group consisting of E2, E4, and VA. In embodiments where the helper virus is HSV, the HSV genome comprises one or more HSV genes selected from the group consisting of UL5 / 8 / 52, ICP0, ICP4, ICP22, and UL30 / UL42.

[0078] In some embodiments, the combination product comprises a third vector, which comprises the fourth nucleotide. The third vector can be an independent third vector, integrated with the first vector, or integrated with the second vector.

[0079] In some embodiments, the third nucleotide comprises a transgene.

[0080] In some embodiments, the transgene encodes a polypeptide or non-coding RNA.

[0081] The encoded product of the transgene can be arranged as needed. For example, in some embodiments, the transgene encodes a therapeutic protein. In some embodiments, the transgene encodes an antibody or a fragment thereof (e.g., Fab or full-length antibody).

[0082] In some embodiments, the transgene encodes a scFv, nanobody, or VHH.

[0083] In some embodiments, the transgene is the SPINK1 gene, which can treat chronic pancreatitis.

[0084] In some embodiments, the transgene encodes a Cas nuclease and / or a CRISPR sgRNA.

[0085] In embodiments of the combination product, the first vector, the second vector, and / or the third vector are contained within one or more plasmids. In embodiments, the first vector and the third vector are contained within the first plasmid. In embodiments, the second vector and the third vector are contained within the second plasmid.

[0086] In embodiments of the packaged vector combination product, the first vector, the second vector, and / or the third vector are included within one or more recombinant helper viruses. In embodiments, the first vector and the third vector are included within a recombinant helper virus. In embodiments, the second vector and the third vector are included within a recombinant helper virus.

[0087] The seventh aspect of the present disclosure relates to a kit comprising the vector as described above, or the packaged vector combination product as described above.

[0088] The term "kit" in the present disclosure may refer to any article (e.g., a package or container) comprising at least one device that includes a detection agent as described in the present disclosure. The kit may further include instructions for use, supplementary reagents, and / or components or assemblies used in the methods or steps described in the present disclosure.

[0089] The components within the reagent or kit may be packaged in the form of a solution or a solid. In some preferred embodiments, at least one component of the reagent or kit is a solid, and the solid includes at least one of lyophilized microspheres, lyophilized cakes, lyophilized powders, and spots that depend on the presence of a solid medium.

[0090] The eighth aspect of the present disclosure relates to a recombinant adeno-associated virus comprising: (a) a capsid that includes the recombinant adeno-associated virus capsid protein as described above; and (b) a recombinant adeno-associated virus genome.

[0091] The rAAV genome can be of any type capable of being packaged within the AAV capsids disclosed herein. For example, in embodiments, the rAAV genome is a single-stranded DNA genome. In embodiments, the rAAV genome is a self-complementary genome as described, for example, in US7790154, which is hereby incorporated by reference in its entirety.

[0092] In some embodiments, a transgene is included within the recombinant adeno-associated virus genome.

[0093] The transgene can be defined according to the description of the sixth aspect of the present disclosure.

[0094] The ninth aspect of the present disclosure relates to a method of delivering a transgene to a cell, the method comprising contacting the cell with the recombinant adeno-associated virus as described above under conditions for transducing the cell and expressing the transgene.

[0095] In some embodiments, the cell is a pancreatic cell.

[0096] The pancreatic cell can be a healthy cell or a diseased cell, and the diseased cell is, for example, a pancreatic cancer cell. The pancreatic cell can be an islet cell, such as an islet A cell, B cell, D cell, or PP cell.

[0097] The tenth aspect of the present disclosure relates to a pharmaceutical composition comprising the recombinant adeno-associated virus as described above. The pharmaceutical composition comprises the rAAV disclosed herein and a pharmaceutically acceptable excipient, adjuvant, diluent, carrier or vehicle, or a combination thereof. "Pharmaceutically acceptable carrier" includes any material that, when combined with the active ingredient of the composition, allows the ingredient to retain its biological activity and does not cause a destructive physiological reaction (such as an unexpected immune response). Pharmaceutically acceptable carriers include water, phosphate buffered saline, emulsions (such as oil / water emulsions), and wetting agents.

[0098] The pharmaceutical composition may be contained in a container, package or dispenser, such as a syringe, together with instructions for administration.

[0099] In other aspects of the present disclosure, there is provided a method for preventing or treating a disease or condition in a subject in need thereof, the method comprising administering a therapeutically effective amount of the rAAV virus or pharmaceutical composition of the present application to the subject.

[0100] The rAAV described in the present disclosure can be administered to a subject by any suitable method known in the art. For example, the rAAV suspended in a physiologically compatible carrier (e.g., in a composition) is preferably administered to a subject, i.e., a host animal, such as a human, mouse, rat, cat, dog, sheep, rabbit, horse, cow, goat, pig, guinea pig, hamster, chicken, turkey, or non-human primate (e.g., macaque). In some embodiments, the host animal does not include humans. In some embodiments, the subject is human.

[0101] "Therapeutically effective amount" refers to an amount that is effective at the dosage and for the time required to achieve the desired therapeutic effect. The therapeutically effective amount of the rAAV virus or pharmaceutical composition may vary depending on factors such as the disease state, age, sex, and weight of the subject to be treated, and the ability of the rAAV virus or pharmaceutical composition to elicit the desired response in the subject. The dosing regimen can be adjusted to provide the optimal therapeutic response. A therapeutically effective amount is generally also an amount in which any toxic or harmful effects of the rAAV virus or pharmaceutical composition are outweighed by the therapeutic beneficial effects. "Prophylactically effective amount" refers to an amount that is effective at the dosage and for the time required to achieve the desired prophylactic effect, such as preventing or inhibiting various conditions. Prophylactic doses can be used in subjects prior to or at an early stage of disease onset. In some cases, the prophylactically effective amount may be greater than or less than the therapeutically effective amount. The dosage administered depends to a large extent on the condition and size of the subject being treated, as well as the therapeutic formulation, frequency of treatment, and route of administration. The regimen for continuous treatment, including dosage, formulation, and frequency, can be guided by the initial response and clinical judgment.

[0102] In some embodiments, the rAAV virus or pharmaceutical composition is administered to a subject once a day, once a week, once every two weeks, once a month, once every two months, once every three months, once every six months, once a year or once every two years, once every five years, once in a lifetime.

[0103] Exemplary routes of administration and delivery include intravenous (I.V.), intra-articular, intraperitoneal (I.P.), intra-arterial, intramuscular, parenteral, subcutaneous, intrapleural, dermal, transdermal, parenteral, e.g., transmucosal, intracranial, intraspinal, oral (enteral), mucosal, respiratory, intranasal, intubation, intralung, intralung instillation, buccal, sublingual, intravascular, intrathecal, intracavitary, iontophoresis, intraocular, intra-glandular, intra-organ, intra-oviduct.

[0104] In some embodiments, delivery of rAAV to a mammalian subject can be by, for example, intramuscular injection into the mammalian subject.

[0105] In some embodiments, delivery of rAAV to a mammalian subject can be by, for example, intravenous injection into the mammalian subject.

[0106] In some embodiments, delivery of rAAV to a mammalian subject can be by, for example, intra-articular injection into the mammalian subject. "Intra-articular injection" is defined herein as injection or infusion into a joint. Intra-articular injection is commonly used to administer drugs to joints affected by inflammation.

[0107] In some embodiments, delivery of rAAV to a mammalian subject can be by, for example, infusion via the bile duct (e.g., retrograde catheterization through the cystic duct into the common bile duct) into the mammalian subject.

[0108] In some embodiments, delivery of rAAV to a mammalian subject can be by, for example, intraperitoneal injection into the mammalian subject.

[0109] The effect of administering the rAAV or pharmaceutical composition described in the present application can be to prevent the development of a disease condition, stop the progression of the disease condition, reverse the progression of the disease condition, etc. The disease or disorder is related to the target gene loaded by the rAAV and the gene product expressed.

[0110] Exemplary diseases or disorders include: chronic pancreatitis.

[0111] The embodiments of the present disclosure will be described in detail below in conjunction with examples. It should be understood that these examples are only for illustrating the present disclosure and not for limiting the scope of the present disclosure. For the experimental methods without specific conditions noted in the following examples, reference is preferentially made to the guidance given in the present disclosure, and it is also possible to follow the experimental manuals or conventional conditions in the art, or refer to other experimental methods known in the art, or follow the conditions recommended by the manufacturer.

[0112] In the following specific embodiments, regarding the measurement parameters of raw material components, without special instructions, there may be slight deviations within the weighing accuracy range. Regarding temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operation accuracy are allowed.

[0113] Example 1 Construction of a random peptide mutant library of AAV9

[0114] First, construct a random peptide mutant library of AAV9, and insert a new AAV9 mutant library with 7 amino acids between amino acids 588 and 589 of the AAV capsid protein - VP1 protein. The mutant library is used for AAV virus packaging, and candidate new AAV9 serotype mutants are obtained through screening and verification in mice. The candidate mutants are then verified in mice, and two AAV mutant capsids AAV - PAN - 05 and AAV - PAN - 08 with high transduction efficiency in pancreatic tissue are obtained. The screening and verification process of AAV9 capsid mutants is as Figure 1 shown.

[0115] 1. Preparation of mutant library

[0116] 1.1 Chemically synthesize the following two fragments of AAV9 7mer NNS:

[0117] 5'CCACCAGAGTGCCCAANNSNNSNNSNNSNNSNNSNNSGCACAGGCGCAG 3';

[0118] 5'CGGTCTGCGCCTGTGCSNNSNNSNNSNNSNNSNNSNNTTGGGCACTCTG3';

[0119] where NNS represents a random coding sequence.

[0120] 1.2 Fragment annealing

[0121] Add 10 μL each of the synthesized AAV9 - 7mer - NNS forward and reverse primers (the final concentration of the primers is 10 mM) and use annealing to obtain the AAV9 - 7mer - NNS template. The annealing program is: 95°C, 5 min; 95°C, 1 min; 92°C, 1 min; 4°C, 60 min. Among them, for the second and third steps, the temperature is decreased by 3°C for each cycle, and there are a total of 25 cycles.

[0122] 1.3 Restriction enzyme digestion of the mutant library backbone plasmid

[0123] Digest the plasmid pAAV - short UBC - mScarlet - polyA - P40 - AAV9 - Cap - FLEX - SV40polyA (its structure and insertion site are as Figure 2Digest with BsmBI as shown, and the digestion system (50 μL) is shown in Table 1.

[0124] Table 1

[0125]

[0126] After digesting at 55 °C for 4 h, perform 1% agarose gel electrophoresis, and cut and recover the large fragment under ultraviolet light with a blade.

[0127] 1.4 Ligation

[0128] Ligate the purified digestion product obtained in step 1.3 and the AAV9-7mer-NNS nucleotide sequence obtained in step 1.2 using T4 DNA ligase. The ligation uses Takara's T4 DNA ligase, and the 10 μL reaction system is shown in Table 2. Incubate overnight at 4 °C.

[0129] Table 2

[0130]

[0131] 1.5 Electroporation

[0132] Add 10 μL of the ligation product to 50 μL of electrocompetent cells dedicated to the library (purchased from Lucigen), mix well and transfer to a pre-cooled electrode cup after standing, and perform electroporation using a Bio-Rad electroporator. After electroporation, add 1 mL of SOC liquid medium preheated at 37 °C, then recover at 37 °C for 1 hour and then centrifuge and spread.

[0133] 1.6 Repeat steps 1.4 - 1.5 until the number of clones reaches 5×10 11 .

[0134] Use the QIAGEN large extraction kit (QIAGEN Plasmid Plus Midi Kit (25), catalog number 12943) to extract and obtain the plasmid of the new capsid library for packaging.

[0135] 2. Preparation of the virus mutant library

[0136] Using 1.0×10 7Inoculate 293 AAV packaging cells in a 10-cm dish. After 18 - 24 hours of inoculation, when the cells have adhered to the dish, AAV packaging plasmid transfection can be started. Use polyetherimide (PEI, Polyetherimide) transfection reagent to transfect the AAV library plasmid, packaging Rep plasmid, and pHelper helper plasmid into the 293 AAV packaging cells that have been inoculated. After 72 hours of transfection, observe the packaging efficiency under a fluorescence microscope, and use a pipette to blow down the packaging cells to completely detach all cells from the culture dish, and collect the cell pellet samples.

[0137] Perform repeated freezing and thawing of the collected cell pellet samples at -80 °C and 37 °C, centrifuge, collect the cell supernatant, and remove cell debris through a 0.45-μm PVDF filter. Subsequently, use an AAV purification kit for purification to harvest the recombinant AAV virus library.

[0138] Take 20 μL of the concentrated virus solution, add 1 μL of RNase-free DNase, vortex, incubate at 37 °C for 30 min. After incubation, centrifuge at 10,000 rpm for 10 min. Add the centrifuged concentrated virus solution to 80 μL of Buffer for dilution, perform a 10-min metal bath at 100 °C, cool to room temperature, add 3 μL of proteinase K, incubate at 37 °C for 60 min, then perform a 10-min metal bath reaction at 100 °C. Subsequently, cool the sample to room temperature, and the diluted sample is used for titer detection by real-time quantitative PCR (Real-time Quantitative Polymerase Chain Reaction, qPCR). The detection uses a Taqman detection kit (TaqMan TM Fast Advanced Premix, catalog number: 4444963; brand: Applied Biosystems TM ) for the qPCR reaction conditions are: 95 °C, 10 min; 95 °C, 30 s; 60 °C, 30 s, for 35 cycles.

[0139] After packaging the AAV mutant library virus, store it at -80 °C for later use.

[0140] 2.1 High-throughput sequencing (Next Generation Sequencing, NGS) of the AAV9 capsid mutant library virus

[0141] Perform PCR amplification of the purified AAV9 capsid mutant library virus, construct a sequencing library for the PCR product, and perform high-throughput sequencing based on the Illumina platform MiSeq sequencer PE150 platform.

[0142] Use the fastp software to perform quality control and filtering on the original sequencing data from high-throughput sequencing, remove low-quality reads, adapter-contaminated sequences, and merge paired-end sequencing data; use third-party open-source Python packages such as Biopython, pysam, and pandas to build self-written analysis scripts to classify the sequencing data tags and count the number of reads of different capsid mutants.

[0143] PCR amplification primers:

[0144] AAV9-F: ctaacccggtagcaacggag (forward primer on the vector)

[0145] AAV9-R: ggttttgaacccagccgg (reverse primer on the vector)

[0146] The expected sequencing sequence to be obtained is:

[0147] ctaacccggtagcaacggagtcctatggacaagtggccacaaaccacgNNSNNSNNSNNSNNSNNSNNSaccggctgggttcaaaacc

[0148] 3. Screening AAV capsid protein mutants

[0149] 3.1 Intravenous injection into mouse tail vein

[0150] Select 6-8-week-old, 18-20g male SPF-grade C57 mice (purchased from: Vital River), and inject the stock solution of the randomly generated 7-peptide virus mutant library constructed above into C57 mice by intraperitoneal injection at a dose of 200 μl in volume. After raising the mice in an SPF-grade environment for 3 weeks, perform animal dissection and sample collection from various organs. Immediately after sample collection, freeze the samples in liquid nitrogen and use them for subsequent DNA extraction and other experiments respectively.

[0151] 3.2 Extraction of mouse tissue genome and NGS sequencing

[0152] Extract mouse tissue genomic DNA using a tissue DNA extraction kit (product number DP304, brand Tiangen), design corresponding primers for PCR amplification, and perform high-throughput sequencing on the PCR products.

[0153] AAV9-F: ctaacccggtagcaacggag (forward primer on the vector)

[0154] AAV9-R: ggttttgaacccagccgg (reverse primer on the vector)

[0155] The expected sequencing sequence to be obtained is:

[0156] ctaacccggtagcaacggagtcctatggacaagtggccacaaaccacgNNSNNSNNSNNSNNSNNSNNSaccggctgggttcaaaacc

[0157] The bioinformatics analysis process of the sequencing results refers to the above 2.1

[0158] 3.3 Result analysis

[0159] Analyze the high-throughput sequencing results, and name the mutants with high frequencies in pancreatic tissues as AAV-PAN-xx respectively; for example, the 01st peptide segment is: AAV-PAN-01. Combining the virus and mouse NGS data, a total of 20 peptide segments were screened and named AAV-PAN-01 to AAV-PAN-20 for downstream verification experiments.

[0160] Example 2 Construction of AAV capsid protein mutants

[0161] 1. Construction of candidate mutant serotype vectors:

[0162] Using the natural serotype AAV9 as a vector, replace the wild-type AAV9 in the Cap sequence region with candidate mutant fragments such as AAV-PAN-xx to obtain new serotype vectors such as AAV-PAN-xx. According to the results of high-throughput sequencing, 20 mutants were constructed. The names are AAV-PAN-01 to AAV-PAN-20.

[0163] 2. AAV virus packaging of candidate mutants

[0164] Use the AAV shuttle vector pAAV-CBh-EGFP-WPRE (the plasmid maps are shown in Figure 3 ), and use AAV-PAN-xx, etc. as serotype vectors to package various candidate serotype AAV viruses respectively. The packaging and purification methods refer to step 2 of Example 1 above. Use the WPRE primer pair to measure the virus titer of the above finished viruses, and determine the volume of the virus stock solution for intraperitoneal injection of mice according to the titer detection results.

[0165] Among them, taking AAV-PAN-05 as an example to illustrate the detailed packaging and AAV virus titer measurement process:

[0166] AAV-PAN-05: It is a serotype plasmid. The construction method is to replace the Cap9 sequence in the original serotype plasmid AAV9 with the sequence of PAN-05 (which is the Cap sequence), and then obtain the AAV-PAN-05 serotype plasmid. The map is as Figure 4 shown.

[0167] At 1.0×107 Inoculate 293AAV packaging cells in a 10-cm dish. After 18 - 24 hours of inoculation, when the cells adhere to the wall, AAV packaging plasmid transfection can be started. Use polyetherimide (PEI) transfection reagent to transfect the AAV shuttle plasmid, packaging serotype plasmid (AAV-AAV-PAN-05), and pHelper helper plasmid into the 293AAV packaging cells that have been inoculated at a ratio of 1:1:1. After 72 hours of transfection, observe the packaging efficiency through a fluorescence microscope, and use a pipette to blow down the packaging cells to completely detach all cells from the culture dish, and collect the cell pellet samples.

[0168] Perform repeated freezing and thawing of the collected cell pellet samples at -80 °C and 37 °C, centrifuge, collect the cell supernatant, and remove cell debris through a 0.45-μm PVDF filter. Subsequently, use an AAV purification kit for purification to harvest AAV virus.

[0169] 3. Verification of AAV virus of candidate mutants in mice

[0170] 3.1 Intraperitoneal injection of mice

[0171] Select 6 - 8-week-old, 18 - 20 g male SPF-grade C57 mice. Use rAAV9 and AAV8 with optimized capsid (such as Y447F + Y733F) viruses as the control group, and the AAV capsid protein mutants described in this article as the experimental group. There are at least 3 mice in each group. Intraperitoneally inject C57BL / 6 mice (source: Vital River) with a virus dose of 1E+11 VG / mouse. After 3 weeks, collect mouse pancreas samples.

[0172] 3.2 Cryosection staining of mouse tissues

[0173] Put the fresh pancreas tissue into 4% paraformaldehyde fixative (Sangon Biotech), and fix it overnight at 4 °C. On the second day, replace the paraformaldehyde with sucrose solution for dehydration until the tissue sinks. Then embed the pancreas tissue with OCT (Opti-mum cutting temperature compound, product number: 4583, brand: Sakura), use a Leica microtome for sectioning, and perform nuclear staining (DAPI, product number: 62247, brand: ThermoFisher) after sectioning. Finally, use an inverted fluorescence microscope (OLYMPUS) for observation and photography.

[0174] 3.3 Fluorescence results of cryosections

[0175] AAV9, AAV8 (such as Y447F+Y733F), AAV9-PAN-01, AAV9-PAN-05 (inserting the peptide segment shown in SEQ ID NO: 1 between AAV9 588 and 589), AAV9-PAN-06, and AAV9-PAN-08 (inserting the peptide segment shown in SEQ ID NO: 2 between AAV9 588 and 589) viruses packaged with pAAV-CBh-EGFP-WPRE plasmid were injected into mice via the tail vein, and pancreatic tissue sections were taken and photographed three weeks later ( Figure 6 ). The average fluorescence intensity ratio of AAV capsid protein mutants PAN-05 and PAN-08 was higher than that of AAV9 and AAV8 (Y447F+Y733F) ( Figure 7 ).

[0176] The above-described embodiments merely represent several implementation manners of the present disclosure. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present disclosure, several modifications and improvements can still be made, and these all belong to the protection scope of the present disclosure. Therefore, the protection scope of the present disclosure patent shall be subject to the appended claims, and the description and drawings can be used to explain the content of the claims.

Claims

1. A recombinant adeno-associated virus capsid protein, wherein an amino acid fragment having a sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 is inserted, and the insertion position is between amino acids 588 and 589, with reference to the wild-type AAV9 capsid protein with a full length of 736 amino acids.

2. An isolated polynucleotide encoding the recombinant adeno-associated virus capsid protein according to claim 1.

3. A vector comprising the polynucleotide according to claim 2; Optionally, the vector is a plasmid or a viral vector; Optionally, the vector is an expression vector. A host cell comprising the polynucleotide of claim 2 or the vector of claim 3.

5. A method for producing a recombinant adeno-associated virus capsid protein, comprising: The host cell of claim 4 is cultured under conditions where the polynucleotide of claim 2 is expressed and capsid protein is produced.

6. A recombinant adeno-associated virus packaging vector combination product, comprising: a first nucleotide encoding one or more AAV Rep proteins; A second nucleotide, which encodes a capsid protein and comprises the polynucleotide of claim 2; a third nucleotide comprising a recombinant adeno-associated virus genome; The packaging vector combination product is operably used in cells to encapsulate the recombinant adeno-associated virus genome in a capsid to form a recombinant adeno-associated virus.

7. The combination product according to claim 6, comprising a first carrier and a second carrier; The first vector comprises the first nucleotide and the second nucleotide, and the second vector comprises the third nucleotide; Optionally, the combination product comprises a fourth nucleotide, and the fourth nucleotide comprises one or more helper virus genes; further optionally, the combination product comprises a third vector, and the third vector comprises the fourth nucleotide; Optionally, the third nucleotide comprises a transgene, wherein preferably the transgene encodes a polypeptide or a non-coding RNA. Optionally, the third nucleic acid comprises a recombinant adeno-associated virus genome of a self-complementary AAV.

8. A kit comprising the vector according to claim 3, or the packaging vector combination product according to claim 6 or 7.

9. A recombinant adeno-associated virus, comprising: (a) a capsid, wherein the capsid comprises the recombinant adeno-associated virus capsid protein of claim 1; and (b) a recombinant adeno-associated virus genome.

10. The recombinant adeno-associated virus according to claim 9, wherein the recombinant adeno-associated virus genome comprises a transgene, wherein the transgene preferably encodes a polypeptide or a non-coding RNA; Optionally, the recombinant adeno-associated virus is a self-complementary AAV.

11. A method for delivering a transgene to a cell, the method comprising contacting the cell with the recombinant adeno-associated virus of claim 9 or 10 under conditions that transduce the cell and express the transgene.

12. The method according to claim 11, wherein the cells are pancreatic cells.

13. A pharmaceutical composition comprising the recombinant adeno-associated virus according to claim 9 or 10.

Citation Information

Patent Citations

  • Duplexed parvovirus vectors

    US7790154B2