A kind of plant lactobacillus and its application in milk powder fermentation

Through the fermentation of Plantago Lactobacillus ZWK2406-01 milk powder, its high glutamate decarboxylase activity and lactic acid synergistic effect was solved, and the problems of low GABA yield and poor stability in traditional milk fermentation were achieved, achieving efficient and stable GABA production and sleep aid effects.

CN120210080BActive Publication Date: 2025-08-15XIANGTAN ZHONGWEIKE BIOLOGICAL ENG CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510697664.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-08-15
Estimated Expiration
2045-05-28

AI Technical Summary

Technical Problem

In the existing milk fermentation technology, GABA yield is low and the stability is poor, and stabilizers are required. In addition, the traditional method has the risk of chemical residues, making it difficult to achieve efficient and stable GABA enrichment.

Method used

The P. planta ZWK2406-01 is used to use the liquid fermentation skim milk powder system, and its high glutamate decarboxylase activity and lactic acid synergistically form an antibacterial environment with pH 4.8-5.2, achieving efficient conversion and stable storage of GABA, and avoiding additional stabilization agents.

Benefits of technology

Efficient and stable GABA production has been achieved, with GABA production reaching 4.2-4.5 g/L, and the retention rate during storage period reaches 90-95%. There is no need to add antioxidants, which has significant sleep aid effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210080B_ABST
    Figure CN120210080B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of microbial technology and specifically relates to a Lactobacillus plantarum and its application in milk powder fermentation. Compared with traditional Lactobacillus plantarum, the Lactobacillus plantarum ZWK2406-01 fermentation extract obtained by using Lactobacillus plantarum ZWK2406-01 liquid fermentation milk powder in the present invention performs better in terms of sleep-inducing effect, has a higher GABA content and significantly improves sleep function, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Lactobacillus plantarum and application thereof in milk powder fermentation. Background Art

[0002] Gamma-aminobutyric acid (GABA) is an important inhibitory neurotransmitter widely used in functional foods, health supplements, and pharmaceuticals. With aging and changes in the social environment, GABA secretion gradually decreases. Furthermore, deficiencies in certain trace elements (vitamins, zinc), excessive caffeine, niacinamide, or food additives can inhibit GABA binding to GABA receptors, necessitating exogenous GABA intake to meet the body's daily needs. Studies have shown that GABA can be taken daily as a functional ingredient, and consumers are increasingly choosing natural foods that offer both medicinal and edible benefits, rather than exogenous GABA supplements. Therefore, obtaining GABA from natural sources has become increasingly important. Microorganisms naturally produce GABA in chemical-free culture media, free of unwanted compounds and side effects, making it widely accepted in the food and pharmaceutical industries. As people increasingly prioritize health and well-being, they hope to improve their health or prevent disease through food intake. Research has shown that GABA has high practical value and can be used as a functional food ingredient for daily consumption. Consequently, the development of GABA-rich functional foods has become a hot topic of research.

[0003] Currently, milk fermentation is considered the main way to efficiently produce GABA. Traditional GABA production mainly relies on chemical synthesis or genetically modified strains, but there are risks of residual solvents or regulatory restrictions. Although milk fermentation is a safe method, existing strains generally face the following bottlenecks: (1) Low conversion efficiency: Most lactic acid bacteria produce insufficient glutamate decarboxylase activity, resulting in limited GABA production; (2) Poor product stability: pH fluctuations in the fermentation system can easily trigger GABA degradation, and the retention rate during storage is often less than 70%; (3) Stabilizers (such as trehalose) or antioxidants need to be added to maintain the shelf life of the product.

[0004] Therefore, finding new fermentation strains and their suitable directional fermentation processes, breaking through the above technical barriers, and achieving additive-free, high-conversion, and highly stable GABA enrichment has become a new research direction. Summary of the Invention

[0005] In view of the deficiencies in the prior art, the present invention provides a Lactobacillus plantarum and application thereof in milk powder fermentation.

[0006] In a first aspect, the present invention provides a strain of Lactobacillus plantarum, designated Lactobacillus plantarum ZWK2406-01, which was deposited with the China General Microbiological Culture Collection on October 22, 2024, under the accession number CGMCCNO: 7.568 at the Institute of Microbiology, Chinese Academy of Sciences. Lactobacillus plantarum ZWK2406-01 selectively enriches γ-aminobutyric acid (GABA) through liquid fermentation of skim milk powder. Its glutamate decarboxylase activity reaches 528.16 U / g, and it efficiently converts sodium L-glutamate into GABA within a 24-hour fermentation cycle. The GABA concentration in the final product is 4.2-4.5 g / L, and it exhibits significant sleep-inducing activity. Furthermore, the γ-aminobutyric acid (GABA) produced by the strain's metabolism works synergistically with lactic acid to create an antibacterial environment with a pH of 4.8-5.2 within the liquid fermentation system. This stabilizes the fatty acid value of the fermented milk base below 0.8 mgKOH / g after 30 days of accelerated storage at 40°C, with a GABA retention rate of 90-95%. The fermentation end product maintains a peroxide value of less than 0.5 meq / kg for 12 months without the need for additional stabilizers, and exhibits no lipid oxidative rancidity.

[0007] In a second aspect, the present invention further provides an application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation, comprising the following steps:

[0008] (1) Mixing milk powder and water to form a uniform emulsion with a milk powder concentration of 10-15 wt% to obtain a fermentation liquid;

[0009] (2) inoculating 2 wt%-4 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 37-39°C, adjusting the pH with lactic acid, and adjusting the final pH value to 4.8-5.2; fermenting for 24-36 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 1-5%;

[0010] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation conditions are 4000-6000 r / min for 5-15 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0011] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 1×10 7 CFU / mL-2×10 7 CFU / mL.

[0012] Beneficial effects of the present invention:

[0013] Compared with traditional Lactobacillus plantarum, the Lactobacillus plantarum ZWK2406-01 fermentation extract obtained by using Lactobacillus plantarum ZWK2406-01 liquid fermentation milk powder in the present invention performs better in the sleep-aiding effect, has a higher GABA content and significantly improves sleep function, and has broad application prospects. The Lactobacillus plantarum ZWK2406-01 strain of the present invention achieves efficient, stable, and low-cost industrial production of GABA through the following technical synergistic effects: first, compared with traditional strains, it has higher glutamate decarboxylase activity, achieving a GABA yield of 4.48 g / L without exogenous inducers; simultaneously, it uses lactic acid and GABA to synergistically construct a self-stabilizing system, forming a natural antibacterial environment with a pH of 4.8-5.2, which ensures that the peroxide value of the final product is stable during the 12-month storage period without the addition of antioxidants; secondly, the strain has the ability to metabolize a broad spectrum of carbon sources and can efficiently utilize complex milk-derived oligosaccharides such as raffinose and melibiose, thereby increasing the density of the fermentation cell; finally, the strain relies on endogenous proteases to autonomously hydrolyze milk powder protein to produce L-glutamate substrate, eliminating the need for exogenous sodium glutamate, reducing raw material costs, and breaking through the technical bottleneck of traditional processes that rely on chemical additives. The above characteristics form a closed-loop technology system with the industrial advantages of efficient conversion, stable quality, and controllable costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 :MS / MS spectra of characteristic peptides of Lactobacillus plantarum ZWK2406-01: (1) DNTTIVEGAGSKDAISER; (2) NQIGETTSDFDKEKLQER; (3) VGAATETELKER; the characteristic peptides are from Lactobacillus plantarum ZWK2406-01, Chaperonin GroEL OS=Lactiplantibacillus plantarum (strain ATCC BAA-793 / NCIMB 8826 / WCFS1) OX=220668 GN=groEL PE=3 SV=1; molecular weight is 57.4 kDa; amino acid sequence is as follows:

[0015] . DETAILED DESCRIPTION

[0016] The embodiment of the present invention provides a plant lactobacillus, named plant lactobacillus ZWK2406-01, which has been deposited in the China General Microbiological Culture Collection Center on October 22, 2024, with a deposit number of CGMCCNO: 7.568, and the deposit address is the Institute of Microbiology, Chinese Academy of Sciences.

[0017] Isolation of Lactobacillus plantarum ZWK2406-01: Take 1 g of fresh feces from healthy infants and young children. The feces should be processed within 2 hours after collection. Mix with 9 mL of sterile saline containing 0.1 wt% Tween 80 and prepare 10 -1 -10 -6 Gradient dilution; take 10 -3 -10 -6 100 μL of each dilution was spread on a modified MRS-Probio medium containing 15 wt% skim milk powder, 0.05 wt% L-cysteine, 0.3 wt% bile salts, and the balance was water, with a pH of 7.4, and cultured anaerobically at 38°C for 24 h.

[0018] Screening: Pick milky white colonies with smooth edges and a diameter of 2-4 mm; observe under a microscope and select spore-free, rod-shaped, Gram-positive colonies;

[0019] Identification: The strain was sent to Changsha Zhongweike Bioengineering Co., Ltd. for genetic identification, and the gene sequence of Lactobacillus plantarum ZWK2406-01 was obtained as follows:

[0020] 6SrRNA gene sequence determination results:

[0021]

[0022] phes gene sequence determination results:

[0023] ATTTTTTTCTGCTCATGCAGACATTTCTACACGTGGGGGGTGAACCATGCCGGCACCCAGTACTTCGATCCAACCCGTTTGCTTACAGATTGCACAGCCCTTGCCATTGCAATTAAAGCAAGTTACATCAGCTTCTACGGATGGTTCCGTGAATGGAAAGAAGCTTGGCCGTAGCCGAACATCGAATTGATCGCCAAACAAAGTCTTGGCAACCAGAATTAAGGTGCCC TTCAAATCAGCCATCGTAATATGCTTGTCCACGACTAACCCTTCAATTTGATGAAATTGATGGGAATGGGTTGCATCATCCGTATCACGCCGATAAACGCGGCCAGGTGACAAGACCTTCAGCGGTCCTTTAGAAAAATCGTGATTTTCAAGTGACCGCGGCTGATCAGCAGACGTCTGCGTGCGTAGTAGCACGTCTTTGGTAATATAGAACGTGTCTTGCATAT.

[0024] Example 1

[0025] An application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation comprises the following steps:

[0026] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 15 wt %; and obtaining a fermentation liquid;

[0027] (2) inoculating 3 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 5.0; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0028] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0029] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 2×10 7 CFU / mL.

[0030] Example 2

[0031] An application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation comprises the following steps:

[0032] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 10 wt %; and obtaining a fermentation liquid;

[0033] (2) inoculating 3 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 5.0; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0034] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0035] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 2×10 7 CFU / mL.

[0036] Example 3

[0037] An application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation comprises the following steps:

[0038] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 20 wt %; and obtaining a fermentation liquid;

[0039] (2) inoculating 3 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 5.0; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0040] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0041] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 2×10 7 CFU / mL.

[0042] Example 4

[0043] An application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation comprises the following steps:

[0044] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 15 wt %; and obtaining a fermentation liquid;

[0045] (2) inoculating 3 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 5.5; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0046] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0047] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 2×10 7 CFU / mL.

[0048] Example 5

[0049] An application of Lactobacillus plantarum ZWK2406-01 in milk powder fermentation comprises the following steps:

[0050] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 15 wt %; and obtaining a fermentation liquid;

[0051] (2) inoculating 3 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 4.5; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0052] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

[0053] The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 2×10 7 CFU / mL.

[0054] Comparative Example 1

[0055] An application of Lactobacillus plantarum in milk powder fermentation comprises the following steps:

[0056] (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 15 wt %; and obtaining a fermentation liquid;

[0057] (2) inoculating 3 wt% of Lactobacillus plantarum culture into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 38°C, adjusting the pH with lactic acid, and adjusting the final pH value to 5.0; fermenting for 24 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 4%;

[0058] (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation condition is 6000 r / min for 10 min to obtain the Lactobacillus plantarum fermentation extract.

[0059] The cell concentration of the Lactobacillus plantarum bacterial solution in step (2) is 2×10 7 CFU / mL.

[0060] The Lactobacillus plantarum, with a collection number of CGMCC 7.568, was purchased from the China General Microbiological Culture Collection Center.

[0061] Test Example 1:

[0062] The GABA content in the Lactobacillus plantarum ZWK2406-01 fermentation extract prepared in the example and the Lactobacillus plantarum fermentation extract prepared in the comparative example was determined using a high performance liquid chromatograph. The results are shown in Table 1.

[0063] Table 1: GABA content

[0064]

[0065] Test Example 2

[0066] Sleep aid effect experiment

[0067] Thirty mice, weighing 18-22 g, were randomly divided into three groups: Example 1, Comparative Example 1, and a control group. Each group consisted of 10 mice, half male and half female. The mice were gavage-administered with 10 g / kg of the plant lactobacillus ZWK2406-01 fermented extract obtained in Example 1 and the plant lactobacillus fermented extract obtained in Comparative Example 1. The control group received an equal amount of normal saline. The dose was administered once daily for one week. After one week, surveillance cameras were used to observe and record the sleep rate of each group of mice 30 minutes after gavage; and the sleep time of each group of mice within 12 hours after gavage was continuously recorded for one week, and the average value was taken. The results are shown in Table 2.

[0068] Table 2: Sleep aid effect test results

[0069]

[0070] Test Example 3

[0071] The strain was sent to Changsha Zhongweike Bioengineering Co., Ltd. for cell morphology and physicochemical tests. The results are shown in Table 3.

[0072] Table 3: Cell morphology and physicochemical test results

[0073]

[0074] As shown in Table 1, Example 1 achieved a GABA yield of 4.48 g / L, significantly higher than that of Comparative Example 1, demonstrating that the glutamate decarboxylase activity of Lactobacillus plantarum ZWK2406-01 far exceeds that of conventional strains. Increasing the milk powder concentration in Example 3, however, resulted in a decrease in GABA production to 3.82 g / L, suggesting that the high substrate concentration inhibited bacterial activity due to osmotic pressure. However, decreasing the milk powder concentration in Example 2 maintained a GABA yield of 4.35 g / L, demonstrating that ZWK2406-01 maintains efficient conversion even at low substrate concentrations. Increasing the fermentation pH in Example 4 and decreasing it in Example 5 resulted in GABA yields decreasing to 3.15 g / L and 2.60 g / L, respectively, indicating that the optimal fermentation pH is 4.8-5.2 (Example 1), consistent with the strain's optimal glutamate decarboxylase pH of 5.0-5.5. Enzyme activity significantly decreases outside this range.

[0075] As shown in Table 2, the sleep rate and sleep duration of the Example 1 group were significantly higher than those of the Comparative Example 1 group, and the difference from the control group (normal saline) was extremely significant, demonstrating that the GABA in the fermentation product of Lactobacillus plantarum ZWK2406-01 possesses functional sleep-inducing activity. Comparative Example 1, fermented using a traditional strain, had limited sleep-inducing effects due to the low GABA content (1.92 g / L) and lack of co-metabolites (such as lactic acid). The present invention proposes that the GABA produced by Lactobacillus plantarum ZWK2406-01 metabolism and lactic acid synergistically regulate neurotransmitter homeostasis. GABA modulates neuronal activity through neurotransmission of inhibitory signals. Furthermore, lactic acid, as a metabolic intermediate, promotes astrocyte-neuron metabolic coupling, accelerating the biosynthesis of the precursor tryptophan into 5-hydroxytryptamine, thus exerting a dual sleep-inducing effect.

[0076] Table 3 shows that the cell morphology and physicochemical test results showed that lactose metabolism was positive, indicating that it can efficiently utilize lactose to produce lactic acid, which cooperates with GABA to stabilize the pH environment; trehalose metabolism was positive, which is conducive to the synthesis of stress protectors and improves the storage stability of GABA; gluconate was negative, indicating that there are no oxidative metabolic byproducts, avoiding GABA degradation.

[0077] Attachment Figure 1Three characteristic peptides of the GroEL protein (DNTTIVEGAGSKDAISER, NQIGETTSDFDKEKLQER, and VGAATETELKER) were identified by secondary mass spectrometry. Their sequences were consistent with those of the reference strain of Lactobacillus plantarum (ATCC BAA-793), but the combined features were strain-specific and could serve as molecular markers for ZWK2406-01. Together with the results of 6SrRNA gene sequencing and phes gene sequencing, these peptides verified the genetic uniqueness of this strain and its functional advantages in the fermentation system.

Claims

1. A plant lactobacillus ( Lactiplantibacillus plantarum ), characterized in that, Named as Lactobacillus plantarum ZWK2406-01, the Lactobacillus plantarum ZWK2406-01 was deposited in the China General Microbiological Culture Collection Center on October 22, 2024, with the deposit number CGMCCNO: 7.568, deposited at the Institute of Microbiology, Chinese Academy of Sciences.

2. The application of plant lactobacillus in milk powder fermentation as claimed in claim 1, wherein The Lactobacillus plantarum can be used for liquid fermentation of milk powder to produce gamma-aminobutyric acid.

3. The application of plant lactobacillus in milk powder fermentation as claimed in claim 2, characterized in that, The following steps are involved: (1) Mixing milk powder and water to form a uniform emulsion, wherein the milk powder concentration is 10-15 wt%; obtaining a fermentation liquid; (2) inoculating 2 wt%-4 wt% of Lactobacillus plantarum ZWK2406-01 bacterial solution into the fermentation liquid obtained in step (1), controlling the fermentation temperature at 37-39°C, adjusting the pH with lactic acid, and adjusting the final pH value to 4.8-5.2; fermenting for 24-36 h in a sealed fermentation tank, and controlling the dissolved oxygen content to 1-5%; (3) After fermentation is completed, solid-liquid separation is performed by centrifuge to remove the precipitate. The centrifugation conditions are 4000-6000 r / min for 5-15 min to obtain the fermentation extract of Lactobacillus plantarum ZWK2406-01.

4. The application of plant lactobacillus in milk powder fermentation as claimed in claim 3, characterized in that, The bacterial concentration of the Lactobacillus plantarum ZWK2406-01 bacterial solution in step (2) is 1×10 7 CFU / mL-2×10 7 CFU / mL.