SiRNA for inhibiting XDH as well as modifier and application of siRNA

By developing modified siRNAs used to inhibit XDH, the problem of elevated uric acid levels in gout patients has been solved, and the significant XDH inhibition effect is achieved and long-term maintenance at low doses is provided, providing a potential effective method for the treatment of gout.

CN120210189APending Publication Date: 2025-06-27SUZHOU GENEPHARMA
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311820273.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-27
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Due to the increased uric acid synthesis and reduced uric acid clearance rate in gout patients, hyperuricemia and arthritis is difficult to effectively inhibit XDH and thus reduce uric acid levels.

Method used

A modified siRNA for inhibiting XDH is developed, and is prepared by solid phase synthesis or liquid phase synthesis. The nucleotides can be independently modified or unmodified. Specific modifications include methoxy modification, fluoro modification, phosphorothioate linkage, etc., to ensure that the siRNA does not lose its function when inhibiting the expression of XDH gene.

Benefits of technology

Through a single dose after GalNAc coupling, XDH expression was significantly inhibited in mice, achieving an inhibitory rate of more than 70%, and the inhibitory effect was maintained for more than 10 days at low doses (3 mg/kg).

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004633784160000041
    Figure BDA0004633784160000041
  • Figure BDA0004633784160000051
    Figure BDA0004633784160000051
  • Figure BDA0004633784160000052
    Figure BDA0004633784160000052
Patent Text Reader

Abstract

The invention relates to siRNA for inhibiting XDH as well as a modifier and application thereof, and belongs to the technical field of biology. The invention provides siRNA (small interfering Ribonucleic Acid) for inhibiting XDH (X-Dehydrogenase). Experiments prove that the siRNA has high inhibitory activity on the XDH. The invention also provides the modified siRNA for inhibiting the XDH, and experiments prove that the modified siRNA has an outstanding inhibition effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to siRNA and its modified products for inhibiting XDH and their applications, and belongs to the field of biotechnology. Background Art

[0002] The reduced renal clearance of uric acid is the result of multiple factors, including defects in uric acid transporters such as SLC2A9, ABCG2, etc., reduced renal excretion due to kidney diseases, hypothyroidism, volume contraction and volume depletion, acidosis, lead poisoning, and familial kidney diseases caused by uromodulin deposition; and altered renal clearance due to hyperinsulinemia or insulin resistance in diabetes. Increased uric acid synthesis is associated with: hyperuricemia and hyperuricosuria; congenital metabolic defects such as Lesch-Nyhan / HPRT deficiency, overactivity of PRPP synthetase, and glucose-6-phosphate dehydrogenase deficiency (Von Gierke disease / glycogen storage disease type Ia); certain conditions with high cell turnover rates (such as tumor lysis syndrome); certain conditions with high ATP turnover rates (such as glycogen storage diseases, tissue ischemia). In addition, conditions such as chronic kidney disease, hypertension, metabolic syndrome, and high fructose intake may lead to both increased uric acid synthesis and reduced uric acid clearance.

[0003] Gout is a progressive inflammatory arthritis caused by hyperuricemia (elevated serum uric acid levels) and deposition of monosodium urate crystals in joints and tendons. It is estimated that gout affects 0.6% of the world's population, with much higher prevalence rates in certain geographical regions and ethnic groups. Gout patients who do not receive uric acid-lowering treatment will experience recurrent gout attacks (inflammatory reactions) and eventually develop advanced gout, which is characterized by chronic joint pain and limited mobility.

[0004] Xanthine dehydrogenase (XDH) is a molybdenum-containing hydroxylase that catalyzes the production of uric acid from xanthine. XDH is highly expressed in the liver and gastrointestinal tract. Hepatocyte-specific ablation of XDH or global inhibition of XDH activity can reverse the hyperuricemia phenotype in animal models.

[0005] Small interfering RNA (siRNA), usually a double-stranded RNA with a length of 20 to 25 nucleotides, mainly regulates gene expression in a specific manner through the RNA interference (RNAi) mechanism to achieve the purpose of treating diseases. Therefore, developing an siRNA to inhibit the production of XDH will be an effective way to treat gout and its various complications. Summary of the Invention

[0006] To solve the above problems, the present invention provides an siRNA for inhibiting XDH, the siRNA comprising a sense strand and an antisense strand, and at least a part of the sense strand and the antisense strand are reversely complementary to form a double-stranded region.

[0007] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.1, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.2, or,

[0008] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.3, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.4, or,

[0009] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.5, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.6, or,

[0010] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.8, or,

[0011] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.10, or,

[0012] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.11, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.12, or,

[0013] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.13, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.14, or,

[0014] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.15, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.16, or,

[0015] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.17, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.18, or,

[0016] Wherein, the sense strand comprises the nucleotide sequence shown in SEQ ID NO.19, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO.20, or,

[0017] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 21, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 22, or,

[0018] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 23, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 24, or,

[0019] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 25, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 26, or,

[0020] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 27, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 28, or,

[0021] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 29, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 30, or,

[0022] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 31, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 32, or,

[0023] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 33, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 34, or,

[0024] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 35, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 36, or,

[0025] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 37, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 38, or,

[0026] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 39, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 40, or,

[0027] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 41, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 42, or,

[0028] Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 43, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 44.

[0029] In one embodiment of the present invention, taking the sense strand and antisense strand shown in SEQ ID NO. 1 and SEQ ID NO. 2 as examples, the sense strand contains: the nucleotide sequence shown in SEQ ID NO. 1 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO. 1 and retaining the biological function of the sequence from which it is derived, and the antisense strand contains: the nucleotide sequence shown in SEQ ID NO. 2 or a nucleotide sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity with the nucleotide sequence shown in SEQ ID NO. 2 and retaining the biological function of the sequence from which it is derived. The nucleotide sequences of the remaining sense strand and antisense strand are nucleotide sequences having at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% identity and retaining the biological function of the sequences from which they are derived.

[0030] In one embodiment of the present invention, the siRNA is prepared by solid-phase synthesis or liquid-phase synthesis.

[0031] In one embodiment of the present invention, the nucleotides in the siRNA are each independently modified or unmodified nucleotides.

[0032] In one embodiment of the present invention, each nucleotide in the siRNA is an unmodified nucleotide.

[0033] In one embodiment of the present invention, some or all of the nucleotides in the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not cause a significant weakening or loss of the function of the disclosed siRNA to inhibit XDH gene expression.

[0034] In one embodiment of the present invention, at least one nucleotide in the sense strand or antisense strand of the siRNA is a modified nucleotide.

[0035] In one embodiment of the present invention, at least one phosphate group in the sense strand or antisense strand of the siRNA is a phosphate group with a modifying group.

[0036] In one embodiment of the present invention, at least a part of the phosphate ester group and / or ribose group in the phospho-sugar backbone of at least one single strand of the sense strand and the antisense strand of the siRNA is a phosphate ester group with a modifying group and / or a ribose group with a modifying group.

[0037] In one embodiment of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides, and these modifications on the nucleotide groups do not significantly weaken or lose the function of the siRNA disclosed herein to inhibit XDH gene expression.

[0038] In one embodiment of the present invention, each nucleotide in the sense strand and antisense strand of the siRNA is independently a fluorinated modified nucleotide or a non-fluorinated modified nucleotide.

[0039] In one embodiment of the present invention, the modification is a chemical modification, and the chemical modification is selected from one or more of methoxy modification, fluorine modification or phosphorothioate linkage.

[0040] In one embodiment of the present invention, a "fluorinated modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with fluorine, and it has the structure shown in the following formula (1). The non-fluorinated modified nucleotide is independently selected from a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of the nucleotide with a non-fluorine group or a nucleotide analogue.

[0041] In one embodiment of the present invention, the nucleotides formed by substituting the hydroxyl group at the 2'-position of the ribose group with a non-fluorine group are well-known to those skilled in the art, and these nucleotides can be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, 2'-deoxynucleotides.

[0042] In one embodiment of the present invention, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide, as shown in formula (2); the 2'-substituted alkoxy modified nucleotide, for example, can be a 2'-O-methoxyethyl (2'-MOE) modified nucleotide, as shown in formula (3), the 2'-amino (2'-NH2) modified nucleotide as shown in formula (4), and the 2'-deoxynucleotide (DNA) as shown in formula (5):

[0043]

[0044] In one embodiment of the present invention, the fluorine-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorine-modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides.

[0045] In one embodiment of the present invention, the fluorine-modified nucleotides are located in the sense strand and the antisense strand. The number of fluorine-modified nucleotides in the sense strand is no more than 5. And, in the direction from the 5'-end to the 3'-end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorine-modified nucleotides. The number of fluorine-modified nucleotides in the antisense strand is no more than 7. And, at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides.

[0046] In one embodiment of the present invention, in the sense strand, in the direction from the 5'-end to the 3'-end, the 7th, 8th, and 9th nucleotides of the sense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are non-fluorine-modified nucleotides. In the antisense strand, the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides, and the nucleotides at the remaining positions in the antisense strand are non-fluorine-modified nucleotides.

[0047] In one embodiment of the present invention, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, 23rd nucleotides of the antisense strand are methoxy-modified nucleotides.

[0048] In one embodiment of the present invention, the methoxy-modified nucleotides are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, at least the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st nucleotides of the antisense strand are methoxy-modified nucleotides.

[0049] In one embodiment of the present invention, the nucleotide modified with methoxyethyl is located in the sense strand of the nucleotide sequence, and, in the direction from the 5'-end to the 3'-end, the nucleotide at least at the 1st position of the sense strand is a nucleotide modified with methoxyethyl.

[0050] In one embodiment of the present invention, the nucleotide analogue refers to a group that can replace nucleotides in nucleic acids but has a structure different from that of adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide or thymidine deoxyribonucleotide.

[0051] In one embodiment of the present invention, the nucleotide analogue can be a non-natural nucleotide, a bridged nucleotide or an acyclic nucleotide.

[0052] In one embodiment of the present invention, the bridged nucleotide (bridged nucleic acid, abbreviated as BNA) refers to a constrained or inaccessible nucleotide. BNA can contain a bridged structure with a "fixed" C3'-endo sugar puckering of a five-membered ring, a six-membered ring, or a seven-membered ring, and this bridge is usually incorporated at the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide.

[0053] In one embodiment of the present invention, the BNA can be LNA, ENA, cET BNA, etc. Among them, LNA is shown in Formula (6), ENA is shown in Formula (7), and cET BNA is shown in Formula (8):

[0054]

[0055] In one embodiment of the present invention, at least a part of the phosphate ester groups in the phospho-sugar backbone of at least one single strand among the sense strand and the antisense strand of the siRNA is a phosphate ester group with a modifying group.

[0056] In one embodiment of the present invention, the phosphate ester group with a modifying group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom.

[0057] In one embodiment of the present invention, the phosphate ester group with a modifying group is a phosphorothioate group having a structure shown in Formula (9):

[0058]

[0059] In one embodiment of the present invention, the phosphorothioate linkage is present at least at one position selected from the group consisting of: between the first and second nucleotides at either end of the sense strand or the antisense strand; between the second and third nucleotides at either end of the sense strand or the antisense strand; or any combination of the above.

[0060] In one embodiment of the present invention, the phosphorothioate linkage is present at all of the above positions except at the 5'-end of the sense strand.

[0061] In one embodiment of the present invention, the phosphorothioate linkage is present at all of the above positions except at the 3'-end of the sense strand.

[0062] In one embodiment of the present invention, the phosphorothioate linkage is present at least at one of the following positions:

[0063] between the first and second nucleotides at the 5'-end of the sense strand;

[0064] between the second and third nucleotides at the 5'-end of the sense strand;

[0065] between the first and second nucleotides at the 3'-end of the sense strand;

[0066] between the second and third nucleotides at the 3'-end of the sense strand;

[0067] between the first and second nucleotides at the 5'-end of the antisense strand;

[0068] between the second and third nucleotides at the 5'-end of the antisense strand;

[0069] between the first and second nucleotides at the 3'-end of the antisense strand; and

[0070] between the second and third nucleotides at the 3'-end of the antisense strand.

[0071] In one embodiment of the present invention, the nucleotides with phosphorothioate linkages are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, at least the first and second positions, and the second and third positions of the sense strand are nucleotides linked by a phosphorothioate group; in the direction from the 5'-end to the 3'-end, at least the first and second positions, the second and third positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are nucleotides linked by a phosphorothioate group.

[0072] In one embodiment of the present invention, the siRNA is introduced by using nucleotide monomers with corresponding modifications to introduce modified nucleotides.

[0073] The present invention also provides a product for inhibiting XDH, which product comprises an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient is the above siRNA or the above modified siRNA.

[0074] In one embodiment of the present invention, the product is a pharmaceutical composition or a kit.

[0075] In one embodiment of the present invention, the product is a pharmaceutical composition, and the pharmaceutically acceptable carrier may be a carrier commonly used in the field of siRNA administration, such as but not limited to magnetic nanoparticles (such as nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethyleneimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA) and one or more of their derivatives.

[0076] In one embodiment of the present invention, there is no particular requirement for the contents of the siRNA and the pharmaceutically acceptable carrier, and they may be the conventional contents of the respective components.

[0077] In one embodiment of the present invention, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1 - 500).

[0078] In one embodiment of the present invention, in the pharmaceutical composition, the weight ratio of the active ingredient to the pharmaceutically acceptable carrier is 1:(1 - 50).

[0079] In one embodiment of the present invention, the pharmaceutical composition may further comprise other pharmaceutically acceptable excipients, which may be one or more of various preparations or compounds conventionally used in the art.

[0080] In one embodiment of the present invention, the other pharmaceutically acceptable excipients may include at least one of a pH buffer, a protecting agent, and an osmotic pressure regulator.

[0081] In one embodiment of the present invention, the pH buffer may be a tris(hydroxymethyl)aminomethane hydrochloride buffer with a pH value of 7.5 to 8.5 and / or a phosphate buffer with a pH value of 5.5 to 8.5.

[0082] In one embodiment of the present invention, the protecting agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose.

[0083] In one embodiment of the present invention, based on the total weight of the pharmaceutical composition, the content of the protecting agent may be 0.01 to 30% by weight.

[0084] In one embodiment of the present invention, the osmotic pressure regulator may be sodium chloride and / or potassium chloride.

[0085] In one embodiment of the present invention, the content of the osmotic pressure regulator makes the osmotic pressure of the pharmaceutical composition 200 to 700 milliosmoles per liter (mOSM / L). Those skilled in the art can easily determine the content of the osmotic pressure regulator according to the required osmotic pressure.

[0086] In one embodiment of the present invention, the pharmaceutical composition may be a liquid preparation, such as an injection; or it may be a freeze-dried powder injection, which is mixed with a liquid excipient during administration to prepare a liquid preparation.

[0087] In one embodiment of the present invention, the liquid preparation may be used for subcutaneous, intramuscular, or intravenous injection administration, and may also be used for administration to the lungs by spraying or for administration to other organ tissues (such as the liver) through the lungs by spraying.

[0088] In one embodiment of the present invention, the pharmaceutical composition is used for intravenous injection administration.

[0089] In one embodiment of the present invention, the pharmaceutical composition may be in the form of a liposomal preparation.

[0090] In one embodiment of the present invention, the pharmaceutically acceptable carrier used in the liposomal preparation comprises an amine-containing transfection compound (hereinafter also referred to as an organic amine), a co-lipid, and / or a polyethylene glycolylated lipid.

[0091] In one embodiment of the present invention, the organic amine, the co-lipid, and the polyethylene glycolated lipid can be respectively selected from one or more of the amine-containing transfection compounds or pharmaceutically acceptable salts or derivatives, co-lipids, and polyethylene glycolated lipids described in CN108220295B (which is incorporated herein by reference in its entirety).

[0092] In one embodiment of the present invention, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine (GalNAc). N-acetylgalactosamine is a ligand that binds to the asialoglycoprotein receptor (ASGPR) on the liver surface. The asialoglycoprotein receptor is an endocytic receptor specifically expressed in hepatocytes. N-acetylgalactosamine is used as a targeting molecule to deliver small RNAs to the liver.

[0093] In one embodiment of the present invention, the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. The monovalent, divalent, trivalent, and tetravalent respectively refer to the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule containing the targeting group in the siRNA conjugate formed by the coupling group being 1:1, 1:2, 1:3, or 1:4.

[0094] In one embodiment of the present invention, when the siRNA is conjugated to the coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent.

[0095] In one embodiment of the present invention, when the siRNA is conjugated to the coupling group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0096] In one embodiment of the present invention, the targeting group can be connected to the siRNA molecule via a suitable linker. Those skilled in the art can select a suitable linker according to the specific type of the targeting group.

[0097] In one embodiment of the present invention, for the types of the linker, the targeting group, and the connection mode with the siRNA, reference can be made to the disclosure of WO2015006740A2, and its entire content is incorporated herein by reference.

[0098] In one embodiment of the present invention, the siRNA conjugate formed by GalNAc and the siRNA molecule has the following structure shown in formula (10):

[0099]

[0100] In one embodiment of the present invention, the kit further comprises a pharmaceutically acceptable carrier and / or excipient.

[0101] In one embodiment of the present invention, the siRNA, pharmaceutically acceptable carrier and / or excipient in the kit may exist alone, in the form of a mixture of two or more of them, or in the form of a final pharmaceutical composition.

[0102] In one embodiment of the present invention, in the kit, the pharmaceutically acceptable carrier is an amine-containing compound, a helper lipid and a polyethylene glycolylated lipid.

[0103] In one embodiment of the present invention, in the kit, the pharmaceutically acceptable carrier exists as a mixture or independently.

[0104] In one embodiment of the present invention, the siRNA, pharmaceutically acceptable carrier and / or excipient in the kit are provided in liquid form, dry form or lyophilized form.

[0105] In one embodiment of the present invention, the siRNA, pharmaceutically acceptable carrier and / or excipient in the kit are substantially pure and / or sterile.

[0106] In one embodiment of the present invention, in the kit, it comprises a container for providing siRNA, one or more containers for providing an amine-containing compound, a helper lipid and a polyethylene glycolylated lipid, and optionally, a container for providing excipients.

[0107] In one embodiment of the present invention, the kit further comprises one or more components necessary or beneficial for a specific application, and the components are selected from:

[0108] One or more components for achieving the desired cell transfection;

[0109] One or more components for achieving the diagnosis, treatment or prevention of a specific disease or physical disorder;

[0110] One or more buffers;

[0111] Positive or negative control samples;

[0112] Excipients, stabilizers or preservatives.

[0113] In one embodiment of the present invention, the one or more components for achieving the diagnosis, treatment or prevention of a specific disease or physical disorder are one or more additional therapeutic compounds or compositions, one or more diagnostic reagents.

[0114] In one embodiment of the present invention, the kit further comprises one or more of sterile water, physiological saline and PBS.

[0115] The present invention also provides the use of the above siRNA or the above product in the preparation of a product for preventing, diagnosing and / or treating a pathological condition or disease caused by XDH.

[0116] In one embodiment of the present invention, the disease related to XDH is gout.

[0117] The technical solution of the present invention has the following advantages:

[0118] The present invention provides a modified siRNA for inhibiting XDH, and the modification includes methoxy modification, fluoro modification, phosphorothioate linkage, LNA modification and methoxyethyl modification. A detection plasmid is constructed using the psiCHECKTM-2 plasmid and it is determined that the sequences of the sense strand shown in SEQ ID NO.1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23 and the antisense strand shown in SEQ ID NO.2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24 have a good inhibitory effect at a concentration of 10 nM.

[0119] The modified siRNA obtained after chemical modification is further experimented to obtain the targeting relationship between the modified siRNA and the target gene fragment, and there is still a good inhibitory effect on XDH at a concentration of 0.1 nM; after conjugation with GalNAc, it is verified in mice by single-dose administration. At a dose of 9 mg / kg, the modified siRNA obtained by chemically modifying the sense strand shown in SEQ ID NO.15 and the antisense strand shown in SEQ ID NO.16 and the modified siRNA obtained by chemically modifying the sense strand shown in SEQ ID NO.17 and the antisense strand shown in SEQ ID NO.18 have a very prominent inhibitory effect (inhibition rate greater than 70%); at a dose of 3 mg / kg, the modified siRNA obtained by newly chemically modifying the sense strand shown in SEQ ID NO.15 or 17 and the antisense strand shown in SEQ ID NO.16 or 18 still has a very prominent inhibitory effect (10-day inhibition rate greater than 70%). BRIEF DESCRIPTION OF THE DRAWINGS

[0120] Figure 1 : On-target activity of unmodified sequences (XDH001UM-XDH022UM) for inhibiting XDH.

[0121] Figure 2: qPCR test results of single-dose tests (9 mg / kg) in mice of modified siRNA conjugates (RD34XDH007G, RD34XDH008G, RD34XDH009G, and RD34XDH022G) for inhibiting XDH.

[0122] Figure 3 : qPCR test results of single-dose tests (3 mg / kg) in mice of modified siRNA conjugates (RD34XDH008G, RD34XDH009G, RD34XDH008-1G, RD34XDH008-2G, RD34XDH009-1G, and RD34XDH009-2G) for inhibiting XDH. Detailed implementation mode

[0123] The following embodiments are provided to better further understand the present invention. They are not limited to the described optimal implementation mode, and do not limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with those of other existing technologies falls within the protection scope of the present invention.

[0124] In the following embodiments, XDH mRNA refers to the mRNA with the sequences shown in GeneBank accession numbers NM_011723.3, NM_000379.4, and XM_005576183.3. Further, unless otherwise specified, the term "target gene" used in this disclosure refers to the gene that transcribes the above XDH mRNA, and the term "target mRNA" refers to the above XDH mRNA.

[0125] For those not specifying specific experimental steps or conditions in the following embodiments, the operations or conditions of the conventional experimental steps described in the literature in this field can be followed. For reagents or instruments without indicating the manufacturer, they are all conventional reagent products that can be obtained through commercial purchase.

[0126] In the following embodiments, the capital letters C, G, U, and A represent ribonucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a nucleotide modified with a methoxy group; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a nucleotide modified with a fluorine group; the lowercase letter s indicates that there is a phosphorothioate modification between the two nucleotides adjacent to the left and right of the letter s.

[0127] In the following embodiments, the "modified nucleotide" refers to a nucleotide or nucleotide analogue formed by substituting the hydroxyl group at the 2'-position of the ribose group of a nucleotide with another group, or a nucleotide in which the base on the nucleotide is a modified base. The "fluorine-modified nucleotide" refers to a nucleotide formed by substituting the hydroxyl group at the 2'-position of the ribose group of a nucleotide with fluorine, and the "non-fluorine-modified nucleotide" refers to a nucleotide or nucleotide analogue formed by substituting the hydroxyl group at the 2'-position of the ribose group of a nucleotide with a non-fluorine group. The "nucleotide analogue" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from that of adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide or thymidine deoxyribonucleotide. Such as a nucleotide analogue, a bridged nucleic acid (BNA) or an acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide formed by substituting the 2'-hydroxyl group of the ribose group with a methoxy group.

[0128] In the following embodiments, the terms "complementary" or "reverse complementary" can be used interchangeably and have the meanings well-known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other, and the sequence of one strand can be deduced from the sequence of its complementary strand.

[0129] In the following embodiments, especially when describing the preparation methods of the siRNAs, pharmaceutical compositions or siRNA conjugates of the present disclosure, unless otherwise specified, the nucleoside monomer refers to the modified or unmodified RNA phosphoramidite monomers (sometimes RNA phosphoramidites are also called Nucleoside phosphoramidites) used in the phosphoramidite solid-phase synthesis according to the types and sequences of nucleotides in the siRNA or siRNA conjugate to be prepared. The phosphoramidite solid-phase synthesis is a method well-known to those skilled in the art for RNA synthesis. The nucleoside monomers used in the present disclosure are all commercially available.

[0130] In the following embodiments, "coupling" means that two or more chemical moieties each having a specific function are connected to each other in a covalent linkage; correspondingly, "conjugate" means a compound formed by covalent connection between these respective chemical moieties. Further, "siRNA conjugate" means a compound formed by covalently connecting one or more chemical moieties having specific functions to siRNA. The siRNA conjugate should be understood, depending on the context, as the general term for multiple siRNA conjugates or the siRNA conjugate represented by a certain chemical formula. In the context of the present disclosure, "coupling molecule" should be understood as a specific compound that can be coupled to siRNA through a reaction to ultimately form the siRNA conjugate of the present disclosure.

[0131] In the following embodiments, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and the description includes the case where the event or condition occurs and the case where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitutions or substitution patterns that are spatially impracticable, synthetically infeasible, and / or inherently unstable.

[0132] In the following embodiments, "treat", "alleviate", or "ameliorate" may be used interchangeably herein. These terms refer to methods of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or ameliorating the underlying disorder being treated. In addition, a therapeutic benefit is obtained by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, such that an improvement is observed in the subject, even though the subject may still be afflicted with the underlying disorder.

[0133] In the following embodiments, "prevent" and "prophylaxis" may be used interchangeably. These terms refer to methods of obtaining a beneficial or desired result, including but not limited to a prophylactic benefit. To obtain a "prophylactic benefit", a composition may be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more pathological symptoms of a disease, even if a diagnosis of the disease may not have been made.

[0134] Unless otherwise specified, the reagents and culture media used in the following embodiments are all commercially available products, and operations such as nucleic acid electrophoresis and real-time PCR are carried out with reference to the methods described in "Molecular Biology (Fourth Edition)" (edited by Alexander McLennan et al., 2019).

[0135] The experimental cells involved in the following embodiments are 293T, A549, Hela, Hep3B, SK-BR3, which are purchased from Frontier Biopharma Co., Ltd. (Nanjing).

[0136] The siRNA involved in the following examples is the siRNA sequence synthesized by phosphoramidite solid-phase synthesis.

[0137] The insertion sequence involved in the following examples is the DNA sequence custom-synthesized by Suzhou GenePharma Co., Ltd., specifically:

[0138] 5'-TTGAGATGAAGTTCAAGAATATGGAGCTTTGTTGCAAAAATGTTGG AGGAGAATTGTTGGAAAAAGAGACACAGAACATGGATCTATTAAAGAAGCATAACCTTGAATCTATACTACCTTGAATCTATACTCAAATTTATCTTCTTTGCCATCAAAGATGCCACCCTCAGCTTCTTCTTCAATTGCACAGTGATGCTCTCCAACAGCTTCTTCTTCAAGTTCTATGGCATTGAGATGAAGTTCAATTGAGATGAAGTTCAAGAATACCGGATTGTGGTTCGAGTGAAGGGCTACAGCTTTGAGACTAAGTGGCTTGCTCTGAAGTAGAAAAGCATAACCTTGAATCTATAAACCTTGAATCTATACTCAAATGAGGATGCTATAAAGAACAATATCTTCTTTGCCATCAAAGATGGTCAGTCTGAGGAGGACATGGTGGATGCTATAAAGAACAACTCCTTGGAGAGAAGATGACATTGCCAAG-3'(SEQ ID NO: 45).

[0139] When the siRNA, siRNA conjugate targeting the XDH gene or the siRNA, siRNA conjugate as a negative control involved in the following examples is transfected into cells, Lipofectamine 2000 (purchased from Invitrogen) is used as the transfection reagent, and the specific operation refers to the instruction manual provided by the manufacturer. When performing qPCR detection, HiScript III RT SuperMix for qPCR (purchased from Vazyme) is used as the reverse transcription reagent, and the specific operation refers to the instruction manual provided by the manufacturer.

[0140] Unless otherwise specified, the reagent ratios provided below are calculated by volume ratio (v / v).

[0141] Example 1: An siRNA for inhibiting XDH

[0142] This embodiment provides an siRNA for inhibiting XDH. The nucleotide sequence of the siRNA is designed based on the target mRNA, as shown in Table 1. The siRNA molecule with the following sequence was synthesized by Suzhou GenePharma Co., Ltd.

[0143] Table 1. Nucleotide sequences of siRNAs for inhibiting XDH

[0144]

[0145]

[0146] Experimental Example 1: Detection of on-target activity of unmodified siRNA for inhibiting XDH

[0147] This experimental example provides an experiment for detecting the on-target activity of unmodified siRNA for inhibiting XDH. A plasmid vector was constructed using the psiCHECK2 vector for detection. The psiCHECK2 vector is a plasmid vector that can monitor changes in the expression of a target gene fused to a reporter gene. This vector uses Renilla luciferase as the main reporter gene. The target fragment was cloned into the multiple cloning site downstream of the translation stop codon of Renilla luciferase. The RNAi process against the target gene induced by the synthesized siRNA results in the cleavage and subsequent degradation of the fusion mRNA. The targeting relationship between the siRNA and the target gene fragment can be determined by detecting changes in Renilla luciferase activity. The experimental procedure is as follows:

[0148] Step 1: Construction of the detection plasmid XDH-psiCHECK2

[0149] Using psiCHECK TM -2 (Promega TM ) plasmid to construct the detection plasmid. The detection plasmid contains an insertion sequence as shown in SEQ ID NO: 45, which was spliced from the target sequence that is completely complementary to all the nucleotide sequences of the antisense strand of the siRNA shown in Table 1. The spliced sequence was cloned as a single copy into the Xho I / Not I sites of the psiCHECK TM -2 plasmid to obtain the detection plasmid XDH-psiCHECK2;

[0150] Step 2: Cell culture and transfection

[0151] Add siRNA to each well of a 96-well plate at an addition amount of 5 μL per well, add Opti-MEM containing 20 ng of XDH-psiCHECK2 detection plasmid to each well at an addition amount of 12.5 μL per well, add Opti-MEM (Gibco) to each well at an addition amount of 32.5 μL per well, and then add Lipofectamine 2000 (purchased from Invitrogen, catalog number 11668-019) to each well at an addition amount of 0.3 μL, and incubate at room temperature (22 °C) for 15 minutes to obtain a mixture. Add DMEM complete medium containing 1×10 4 293T cells (purchased from Transgen Biotech, catalog number FI101-01) to the above mixture at an addition amount of 50 μL per well and culture at 37 °C for 24 h for subsequent dual-luciferase detection assays. The single-dose experiment was conducted at a final siRNA concentration of 10 nM.

[0152] Step 3: Dual-luciferase detection

[0153] Dilute the 5× lysis buffer in the dual-luciferase detection kit (purchased from Promega, catalog number E2940) with water to 1× lysis buffer. Take the cells cultured in Step 2, discard the supernatant, dilute and wash twice with PBS buffer (purchased from Hyclone, catalog number SH30256.01) per well, and then add 1× lysis buffer to each well of the cell plate at an addition amount of 50 μL per well, and lyse at room temperature (22 °C) for 20 min to obtain a lysed cell plate; Pipette 30 μL / well of the lysate from the lysed cell plate into an opaque 96-well detection plate, take the dual-luciferase detection kit, prepare substrate 1 and substrate 2 according to the instructions, and add substrate 1 and substrate 2 to the opaque 96-well detection plate at an addition amount of 30 μL per well respectively, and perform detection with a multifunctional microplate reader each time after adding the substrate to obtain the numerical results of Firefly luciferase and Renilla luciferase respectively.

[0154] Calculate the luminescence ratio of each well of the microplate = Renilla / Firefly, and the luminescence ratio of each test group or control group is the average of the luminescence ratios of three culture wells; Based on the luminescence ratio of the control group, normalize the luminescence ratios of each test group to obtain the ratio R of luminescence ratio (test) / luminescence ratio (control), which represents the expression level of the Renilla reporter gene, that is, the relative residual activity. The inhibition rate of siRNA is (1 - R) × 100%.

[0155] The on-target activity results of 22 siRNAs are as Figure 1As shown, it can be seen that all 22 siRNAs have high inhibitory activity. Except for XDH004UM, XDH014UM, and XDH020UM, the inhibition rate is > 80%.

[0156] Example 2: A modified siRNA for inhibiting XDH

[0157] This example provides a modified siRNA for inhibiting XDH. Based on the results of Experimental Example 1, XDH001UM - XDH003UM, XDH005UM - XDH012UM, and XDH015UM - XDH022UM in Example 1 were modified, and the allosteric modification of the sequences corresponded to the modified siRNAs: RD34XDH001 - RD34XDH003, RD34XDH005 - RD34XDH012, and RD34XDH015 - RD34XDH022.

[0158] The sense strands of RD34XDH001 - RD34XDH003 and RD34XDH005 - RD34XDH007 were respectively obtained by chemically modifying the sequences selected from SEQ ID NO.1, SEQ ID NO.3, SEQ ID NO.5, SEQ ID NO.9, SEQ ID NO.11, and SEQ ID NO.13. In the direction from the 5'-end to the 3'-end, the 1st to 19th sequences were retained, and the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions were linked by phosphorothioate groups. The nucleotides at the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions were nucleotides modified with methoxy groups, and the nucleotides at the 7th, 8th, and 9th positions were nucleotides modified with fluorine. The antisense strands of RD34XDH001 - RD34XDH003 and RD34XDH005 - RD34XDH007 were respectively obtained by chemically modifying the sequences selected from SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.10, SEQ ID NO.12, and SEQ ID NO.14. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions were linked by phosphorothioate groups. The nucleotides at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 21st positions were nucleotides modified with methoxy groups, and the nucleotides at the 2nd, 6th, 14th, and 16th positions were nucleotides modified with fluorine.

[0159] The sense strands of RD34XDH008 to RD34XDH012 and RD34XDH015 to RD34XDH018 are respectively obtained by chemically modifying the sequences selected from SEQ ID NO.15, SEQ ID NO.17, SEQ ID NO.19, SEQ ID NO.21, SEQ ID NO.23, SEQ ID NO.29, SEQ ID NO.31, SEQ ID NO.33, SEQ ID NO.35. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions are linked by phosphorothioate groups. The nucleotides at the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions are nucleotides modified with methoxy groups, and the nucleotides at the 7th, 8th, and 9th positions are nucleotides modified with fluoro groups. The antisense strands of RD34XDH008 to RD34XDH012 and RD34XDH015 to RD34XDH018 are respectively obtained by chemically modifying the sequences selected from SEQ ID NO.16, SEQ ID NO.18, SEQ ID NO.20, SEQ ID NO.22, SEQ ID NO.24, SEQ ID NO.30, SEQ ID NO.32, SEQ ID NO.34, SEQ ID NO.36. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions are linked by phosphorothioate groups. The nucleotides at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 21st positions are nucleotides modified with methoxy groups, and the nucleotides at the 2nd, 6th, 14th, and 16th positions are nucleotides modified with fluoro groups.

[0160] The sense strands of RD34XDH019 to RD34XDH022 are respectively obtained by chemically modifying the sequences shown in SEQ ID NO.37, SEQ ID NO.39, SEQ ID NO.41, SEQ ID NO.43. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions are nucleotides linked by phosphorothioate groups. The nucleotides at the 1st, 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st positions are nucleotides modified with methoxy groups. The nucleotides at the 9th, 10th, and 11th positions are nucleotides modified with fluoro groups. The antisense strands of RD34XDH019 to RD34XDH022 are obtained by chemically modifying the sequences shown in SEQ ID NO.38, SEQ ID NO.40, SEQ ID NO.42, SEQ ID NO.44. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 21st and 22nd positions, and the 22nd and 23rd positions are nucleotides linked by phosphorothioate groups. The nucleotides at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd positions are nucleotides modified with methoxy groups. The nucleotides at the 2nd, 6th, 14th, and 16th positions are nucleotides modified with fluoro groups.

[0161] Experimental Example 2: Detection of on-target activity of modified siRNA for inhibiting XDH

[0162] This experimental example provides an experiment for detecting the on-target activity of modified siRNA for inhibiting FGL1. On the basis of Experimental Example 1, Steps 1 to 3 are retained, the 22 siRNAs described in Example 1 in Step 2 are replaced with the 18 modified siRNAs described in Example 2, and the final siRNA concentration in the single-dose experiment is carried out at 10 nM, 1 nM, and 0.1 nM.

[0163] As shown in Table 2 of the remaining activity results of 18 siRNAs in the cell Hep3B, it can be seen that the modified siRNAs all have a high inhibitory effect. The siRNAs shown by RD34XDH001, RD34XDH002, RD34XDH005, RD34XDH006, RD34XDH007, RD34XDH008, RD34XDH009, RD34XDH010, RD34XDH011, RD34XDH012, RD34XDH015, RD34XDH016, RD34XDH017, and RD34XDH022 have a good inhibitory effect at a concentration of 0.1 nM.

[0164] Table 2. On-Target Activity of Modified siRNAs

[0165]

[0166]

[0167] Experimental Example 3: Single-Dose Test of Modified siRNA in Mice (9 mg / kg)

[0168] This experimental example provides a single-dose test of modified siRNA in mice at a dose level of 9 mg / kg. The experimental procedure is as follows:

[0169] Alnylam Pharmaceuticals, Inc. first reported that siRNA based on GalNAc conjugation technology exhibits interfering activity in mice (Nair et al., J. Am. Chem. Soc., 2014, 136, 16958 - 16961). The literature reported that siRNA conjugated to three clusters of GalNAc showed good delivery activity in both in vivo and in vitro experiments. Referring to the preparation method in the above literature and according to the results of Experimental Example 2, GalNAc-conjugated RD34XDH007, RD34XDH008, RD34XDH009, and RD34XDH022 shown in Example 2 of GalNac conjugation were used to obtain GalNAc-conjugated siRNAs: RD34XDH007G, RD34XDH008G, RD34XDH009G, and RD34XDH022G. A single dose of 9 mg / kg of GalNAc-conjugated siRNA or saline control was administered subcutaneously to 4 C57BL / 6J female mice (6 - 8 weeks old) in each group. The administration requirements are shown in Table 3.

[0170] Table 3. Administration Requirements for 9 mg / kg Single-Dose Test

[0171] Experimental subjects Number of animals (pcs) Target gene Dosing dose Dosing frequency Normal saline 4 1 RD34XDH007G 4 XDH 9mg / kg 1 RD34XDH008G 4 XDH 9mg / kg 1 RD34XDH009G 4 XDH 9mg / kg 1 RD34XDH022G 4 XDH 9mg / kg 1

[0172] On the 7th day after administration, the mice were sacrificed, liver samples were collected and snap-frozen in liquid nitrogen, and liver mRNA was extracted and analyzed by RT-qPCR. The detection steps of RT-qPCR are as follows:

[0173] Step 1: RNA Extraction:

[0174] 1) Take 20 mg of mouse liver tissue, add 1 mL of Trizol Lysis Buffer (purchased from Life technology, catalog number 410701), and then grind and lyse the tissue. Transfer the completely dissolved mixture to a 1.5 mL RNase-free centrifuge tube; vigorously shake for about 15 s to fully lyse the tissue cells, and let it stand at room temperature (25 °C) for 5 min;

[0175] 2) Carefully open the tube cap, add 200 μL of chloroform (purchased from Shanghai Lingfeng Chemical Reagent Co., Ltd., catalog number 20140925); vigorously shake for 20 s, and let it stand at room temperature (25 °C) for 3 min; centrifuge at 4 °C, 12000×g for 20 min;

[0176] 3) After centrifugation, carefully take out the centrifuge tube and place it on the centrifuge tube rack. Pipette the upper aqueous phase into a new 2.0 mL centrifuge tube, and add 1.5 times the volume of anhydrous ethanol (purchased from Jiangsu Qiangsheng Functional Chemical Co., Ltd., catalog number 20210802) of the upper aqueous phase, and invert to mix well;

[0177] 4) Take a purification column with a collection tube (purchased from VWI, catalog number 11822AG0627), add 700 μL of the mixture from step 3) to it, and let it stand for 2 min; centrifuge at 4 °C, 10000×g for 1 min, and discard the filtrate; repeat the above steps for the remaining mixture;

[0178] 5) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 4 °C, 10000×g for 1 min, and discard the filtrate;

[0179] 6) Add 700 μL of 80% (v / v) ethanol to the purification column, centrifuge at 4 °C, 10000×g for 1 min, and discard the filtrate;

[0180] 7) Centrifuge the purification column at 4 °C, 10000×g for 2 min without sample;

[0181] 8) After centrifugation, carefully take out the purification column with a collection tube (if there is liquid in the collection tube, pay attention not to let the liquid splash onto the purification column), discard the collection tube, place the purification column in a new 1.5 mL centrifuge tube, add 100 μL of DEPC water to the purification column, and let it stand at room temperature (25 °C) for 2 min; centrifuge at 4 °C, 10000×g for 1 min;

[0182] 9) Collect the RNA solution from step 8) for subsequent experiments;

[0183] Step 2: RNA reverse transcription

[0184] The experimental procedure of using HiScript III RT SuperMix for qPCR (purchased from Novoprotein, product number R323-01) refers to the product instruction manual; prepare a 20 μL reverse transcription reaction system according to the reverse transcription operation steps in the kit instruction manual to perform reverse transcription on the total RNA of the cells; the conditions for reverse transcription are: incubate the reverse transcription reaction system at 37 °C for 15 min, then incubate at 85 °C for 5 s, add 80 μL of DEPC water to each reverse transcription reaction system to obtain a solution containing cDNA;

[0185] Step 3: Configuration of qPCR reaction system

[0186] For each reverse transcription reaction system, respectively take 4 μL of the above solution containing cDNA as a template, and use the reagents provided by the AceQ Universal SYBR qPCR Master Mix kit (purchased from Vazyme, product number Q511-02) to configure a 20 μL qPCR reaction system on an ice box. Among them, Primer1 and Primer2 are the PCR primer sequences for amplifying the target gene XDH and the internal reference gene GAPDH respectively (as shown in Table 5). Place each qPCR reaction system on an ABI StepOnePlus Real-Time PCR instrument and use the three-step method for amplification. The amplification program is pre-denaturation at 95 °C for 10 min, then denaturation at 95 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. Repeat the above denaturation, annealing, and extension processes 40 times in total to obtain a product W containing the amplified target gene XDH and internal reference gene GAPDH; the product W is then incubated at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s in sequence. The real-time fluorescence quantitative PCR instrument collects the melting curves of the target gene XDH and the internal reference gene GAPDH in the product W respectively to obtain the Ct values of the target gene XDH and the internal reference gene GAPDH.

[0187] Table 4. RNA amplification reaction system

[0188] Reagent name Volume per well (μL) 2×AceQ Universal SYBR qPCR Master Mix 10 Primer1 (10μM) 0.4 Primer2 (10μM) 0.4 Template DNA / cDNA 4 <![CDATA[ddH2O]]> 5.2 Total volume 20ul

[0189] Table 5. Primer information

[0190]

[0191] The comparative Ct (ΔΔCt) method is used to perform relative quantitative calculation on the target gene XDH in each test group. The calculation method is as follows:

[0192] ΔCt (test group) = Ct (test group target gene) – Ct (test group internal reference gene)

[0193] ΔCt (control group) = Ct (target gene in control group) – Ct (housekeeping gene in control group)

[0194] ΔΔCt (test group) = ΔCt (test group) - ΔCt (average of control group)

[0195] ΔΔCt (control group) = ΔCt (control group) - ΔCt (average of control group)

[0196] Wherein, ΔCt (average of control group) is the arithmetic mean of ΔCt (control group) for each of the 4 samples in the control group; thus, each sample in the test group and the control group corresponds to a ΔΔCt value.

[0197] Taking the control group as a reference, the expression level of XDH mRNA in the test group was normalized, and the expression level of XDH mRNA in the control group was defined as 100%.

[0198] Relative expression level of XDH mRNA in test group = 2 -ΔΔCt(测试组) × 100%

[0199] The XDH mRNA level was compared with the housekeeping gene GAPDH, and the value was normalized to the average of the saline control group. The data were expressed as a percentage relative to the saline control group and presented as the mean plus the standard deviation.

[0200] The results are shown in Figure 2 , verified in mice after single-dose administration. At a dose of 9 mg / kg, both RD34XDH008G and RD34XDH009G showed significant inhibitory effects.

[0201] Example 3: A modified siRNA for inhibiting XDH

[0202] This example provides a modified siRNA for inhibiting XDH, and the modified siRNA includes RD34XDH008-1G, RD34XDH008-2G, RD34XDH009-1G, and RD34XDH009-2G.

[0203] The sense strands of RD34XDH008-1G and RD34XDH009-1G are respectively obtained by chemically modifying the sequences shown in SEQ ID NO.15 and SEQ ID NO.17. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions are linked by phosphorothioate groups. The nucleotides at the 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions are nucleotides modified with methoxy groups. The nucleotides at the 7th, 8th, and 9th positions are nucleotides modified with fluoro groups. The nucleotide at the 1st position is a nucleotide modified with LNA. The antisense strands of RD34XDH008-1G and RD34XDH009-1G are respectively obtained by chemically modifying the sequences selected from SEQ ID NO.16 and SEQ ID NO.18. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions are linked by phosphorothioate groups. The nucleotides at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 21st positions are nucleotides modified with methoxy groups. The nucleotides at the 2nd, 6th, 14th, and 16th positions are nucleotides modified with fluoro groups.

[0204] The sense strands of RD34XDH008-2G and RD34XDH009-2G are respectively obtained by chemically modifying the sequences selected from SEQ ID NO.15 and SEQ ID NO.17. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, and the 2nd and 3rd positions are linked by phosphorothioate groups. The nucleotides at the 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, and 19th positions are nucleotides modified with methoxy groups. The nucleotides at the 7th, 8th, and 9th positions are nucleotides modified with fluoro groups. The nucleotide at the 1st position is a nucleotide modified with 2'-O-methoxyethyl (2'-MOE). The antisense strands of RD34XDH008-2G and RD34XDH009-2G are respectively obtained by chemically modifying the sequences selected from SEQ ID NO.16 and SEQ ID NO.18. In the direction from the 5'-end to the 3'-end, the nucleotides at the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions are linked by phosphorothioate groups. The nucleotides at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, and 21st positions are nucleotides modified with methoxy groups. The nucleotides at the 2nd, 6th, 14th, and 16th positions are nucleotides modified with fluoro groups.

[0205] Table 6 Sequence Information

[0206]

[0207] Experimental Example 4: Single-dose test of modified siRNA in mice (3 mg / kg)

[0208] This experimental example provides a single-dose test of modified siRNA in mice at a dose level of 3 mg / kg. The experimental procedure is as follows:

[0209] According to the results of Experimental Example 3, GalNAc-conjugated DRD34XDH008 and RD34XDH009 shown in Example 2 were used to obtain GalNAc-conjugated siRNAs: RD34XDH008G and RD34XDH009G. GalNAc-conjugated RD34XDH008-1G, RD34XDH008-2G, RD34XDH009-1G, and RD34XDH009-2G shown in Example 3 were used to obtain GalNAc-conjugated siRNAs: RD34XDH008-1G, RD34XDH008-2G, RD34XDH009-1G, and RD34XDH009-2G. A single dose of 3 mg / kg of GalNAc-conjugated siRNA or saline or the control groups of GRD342260 and GRD342217 was subcutaneously administered to each group of 3 C57BL / 6J mice (female, 6 - 8 weeks). The administration requirements are shown in Table 7. On the 10th day after administration, the mice were sacrificed, liver samples were collected and snap-frozen in liquid nitrogen, and liver mRNA was extracted and analyzed by RT-qPCR method.

[0210] Table 7 Administration requirements for 3 mg / kg single-dose test

[0211]

[0212] According to Figure 3 , it was verified in mice after single-dose administration that at a dose of 3 mg / kg, all sequences had good inhibitory effects, but XDH009G still had a very prominent inhibitory effect, with an inhibition rate greater than 75% at 10 days.

[0213] Example 4: A modified siRNA for inhibiting XDH

[0214] This example provides a modified siRNA for inhibiting XDH, and the modified siRNA includes XDH0908-3, XDH0908-4, and XDH0908-5.

[0215] Among them, the sense strand of XDH0908-3 is XDH-SS-3. XDH-SS-3 is the 3'-end of the sense strand of RD34XDH009 in Example 2 coupled with UUU, and the other side of UUU is connected to the 5'-end of the sense strand of RD34XDH008. The antisense strand of XDH0908-3 is the antisense strand of RD34XDH008 and the antisense strand of RD34XDH009 in Example 2.

[0216] The sense strand of XDH0908-4 is XDH-SS-4. XDH-SS-4 is the 3'-end of the sense strand of RD34XDH009 in Example 2 coupled with dTdTdT, and the other side of dTdTdT is connected to the 5'-end of the sense strand of RD34XDH008. The antisense strand of XDH0908-4 is the antisense strand of RD34XDH008 and the antisense strand of RD34XDH009 in Example 2.

[0217] The sense strand of XDH0908-5 is XDH-SS-5. XDH-SS-5 is the 3'-end of the sense strand of RD34XDH009 in Example 2 coupled with dTdTUUUdTdTdT, and the other side of dTdTUUUdTdTdT is connected to the 5'-end of the sense strand of RD34XDH008. The antisense strand of XDH0908-5 is the antisense strand of RD34XDH008 and the antisense strand of RD34XDH009 in Example 2.

[0218] The 3'-ends of the sense strands of the above siRNAs are all coupled with GalNAc. The sequences of XDH-SS-3, XDH-SS-4, and XDH-SS-5 are shown in Table 8.

[0219] Table 8. Sequence Information

[0220]

[0221] Experimental Example 5: Experiment of Modified siRNA in Mice

[0222] This experimental example conducts a single-dose test of the modified siRNA prepared in Example 4 in mice, and the dose level is 3 mg / kg. The experimental procedures refer to Experimental Example 2 and Experimental Example 4.

[0223] Subcutaneously administer a single dose of 3 mg / kg of GalNAc-conjugated siRNA or physiological saline or NC group control to three C57BL / 6J female mice (6 - 8 weeks old) in each group. On the 14th day after administration, sacrifice the mice, collect liver samples and quickly freeze them in liquid nitrogen, extract liver mRNA and analyze it by RT-qPCR method.

[0224] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. An siRNA for inhibiting XDH, characterized in that, The siRNA contains a sense strand and an antisense strand, and the sense strand can be at least partially reverse complementary to the antisense strand to form a double-stranded region. Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.1, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.2, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.3, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.4, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.6, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.7, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.8, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.9, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.10, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.11, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.12, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.13, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.14, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.15, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.16, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.17, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.18, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.19, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.20, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.21, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.22, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.23, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.24, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.25, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.26, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.27, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.28, or, Wherein, the sense strand contains the nucleotide sequence shown in SEQ ID NO.29, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO.30, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 31, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 32, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 33, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 34, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 35, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 36, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 37, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 38, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 39, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 40, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 41, the antisense strand contains the nucleotide sequence shown in SEQ ID NO. 42, or, Among them, the sense strand contains the nucleotide sequence shown in SEQ ID NO. 43, the antisense strand contains the nucleotide sequence shown in SEQ ID NO.

44.

2. The siRNA according to claim 1, wherein At least one nucleotide in the sense strand or antisense strand of the siRNA is a modified nucleotide.

3. The siRNA according to claim 2, wherein The modification is a chemical modification, and the chemical modification is selected from one or more of methoxy modification, fluoro modification, phosphorothioate modification, LNA modification, and methoxyethyl modification.

4. The siRNA according to any one of claims 2 to 3, characterized in that, The fluorine-modified nucleotides are located in the antisense strand and sense strand of the nucleotide sequence, and, in the direction from the 5'-end to the 3'-end, at least the 9th, 10th, and 11th nucleotides of the sense strand are fluorine-modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides; or, The fluorine-modified nucleotides are located in the antisense strand and sense strand of the nucleotide sequence, and, in the direction from the 5'-end to the 3'-end, at least the 7th, 8th, and 9th nucleotides of the sense strand are fluorine-modified nucleotides, and at least the 2nd, 6th, 14th, and 16th nucleotides of the antisense strand are fluorine-modified nucleotides.

5. The siRNA according to any one of claims 2 to 3, characterized in that, The methoxy-modified nucleotides are located in the antisense strand and sense strand of the nucleotide sequence, and, in the direction from the 5'-end to the 3'-end, at least the 2nd, 3rd, 4th, 5th, 6th, 7th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides of the sense strand are methoxy-modified nucleotides, and at least the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st, 22nd, and 23rd nucleotides of the antisense strand are methoxy-modified nucleotides; or, The nucleotides modified with methoxy groups are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides at least at the 1st, 2nd, 3rd, 4th, 5th, 6th, 10th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th positions of the sense strand are nucleotides modified with methoxy groups, and the nucleotides at least at the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 17th, 18th, 19th, 20th, 21st positions of the antisense strand are nucleotides modified with methoxy groups.

6. The siRNA according to any one of claims 2 to 3, wherein The nucleotides linked by phosphorothioate groups are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides between at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are linked by phosphorothioate groups, and the nucleotides between at least the 1st and 2nd positions, the 2nd and 3rd positions, the 21st and 22nd positions, and the 22nd and 23rd positions of the antisense strand are linked by phosphorothioate groups; or, The nucleotides linked by phosphorothioate groups are located in the antisense strand and the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotides between at least the 1st and 2nd positions, and the 2nd and 3rd positions of the sense strand are linked by phosphorothioate groups, and the nucleotides between at least the 1st and 2nd positions, the 2nd and 3rd positions, the 19th and 20th positions, and the 20th and 21st positions of the antisense strand are linked by phosphorothioate groups.

7. The siRNA according to any one of claims 2 to 3, characterized in that, The nucleotides modified with 2-methoxyethyl groups are located in the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotide at least at the 1st position of the sense strand is a nucleotide modified with 2-methoxyethyl groups.

8. The siRNA according to any one of claims 2 to 3, wherein The nucleotides modified with LNA are located in the sense strand of the nucleotide sequence. And, in the direction from the 5'-end to the 3'-end, the nucleotide at least at the 1st position of the sense strand is a nucleotide modified with LNA.

9. The siRNA according to claim 2 to 3, wherein The 3'-end of the sense strand of the siRNA is conjugated with a ligand, and the ligand is GalNAc.

10. A product for inhibiting XDH, characterized in that, The product contains an active ingredient and a pharmaceutically acceptable carrier, and the active ingredient is the siRNA according to any one of claims 1 to 9.

11. The product according to claim 10, characterized in that, The product is a pharmaceutical composition or a kit.

12. Use of the siRNA according to any one of claims 1 to 9 or the product according to any one of claims 10 to 11 in the preparation of a product for preventing, diagnosing, and / or treating a pathological condition or disease caused by XDH.

Citation Information

Patent Citations

  • PCSK9 iRNA Composition and Its Application Method

    CN108220295B

  • Oligonucleotide-ligand conjugates and process for their preparation

    WO2015006740A2