An RNA aptamer and its application in improving salt tolerance of rice
By screening and expressing the RNA aptamer eApt-2 that specifically binds to rice eIF4A, the problem of insufficient precision in improving rice salt tolerance was solved, precise regulation of the translation initiation process was achieved, the salt tolerance of rice was improved, and the side effects of traditional methods were avoided.
Patent Information
- Application Number
- CN202510441564.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-04-09
AI Technical Summary
Existing technologies for improving rice salt tolerance lack precision. Traditional methods have long cycles, imprecise targeting, and may bring side effects such as growth retardation, making it difficult to achieve fine regulation of plant stress responses.
The RNA aptamer eApt-2, which can efficiently and specifically bind to the rice eIF4A protein, was screened through the SELEX technology and expressed in rice cells. It can finely regulate protein synthesis under stress conditions, inhibit the RNA helicase activity of eIF4A, and block the 5' cap-dependent translation initiation process.
It achieves precise regulation of the translation initiation process, improves the salt tolerance of rice under salt stress, enhances the overall salt tolerance of the plant, and avoids potential interference with normal growth and the risk of permanent genetic modification.
Smart Images

Figure CN120210216B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of plant molecular biotechnology, and particularly relates to an RNA aptamer and application thereof in improving the salt tolerance of rice. Background Art
[0002] Rice (Oryza sativa) is one of the world's most important food crops, feeding more than half of the world's population. However, soil salinization has become one of the major abiotic stressors limiting rice yield. Salt stress can cause ion imbalances and osmotic stress in plants, disrupting normal physiological and metabolic processes, resulting in reduced seed germination, stunted plant growth, and yellowing and wilting of leaves. In severe cases, it can even lead to crop failure. With rising sea levels caused by climate change and factors such as improper irrigation exacerbating soil salinization, improving rice salt tolerance has become a pressing issue to ensure stable agricultural production and food security. Traditionally, conventional breeding or transgenic approaches (such as overexpression or knockout of salt-tolerance genes) have been used to develop new salt-tolerant crop varieties. However, these approaches often require long timelines and lack precise targeting. Furthermore, over-modification of key genes can lead to side effects such as growth retardation, compromising normal plant physiological functions. In particular, overexpression or knockout of essential genes is often associated with unintended negative effects, making it difficult to precisely regulate plant stress responses.
[0003] Plant adaptation to salt stress involves a complex network of molecular regulators, including signal transduction, stress tolerance gene expression, and protein synthesis. Regulation of translation initiation is crucial, determining which proteins are prioritized for synthesis under stress conditions. Studies have shown that under salt stress, plants prioritize the synthesis of stress-related proteins, such as ion transporters, osmoprotectants, and antioxidant enzymes, while reducing the synthesis of nonessential proteins to conserve energy for stress response. This selective control of protein synthesis is largely determined by the activity of translation initiation factors. Eukaryotic translation initiation factor 4A (eIF4A), a crucial component of the initiation complex, possesses RNA helicase activity and is responsible for unwinding the secondary structure of the 5' untranslated region of mRNA during ribosome loading. The functional state of eIF4A directly influences the efficiency and selectivity of mRNA translation. Studies have shown that under stress conditions, the regulation of translation factors, such as eIF4A, is closely linked to plant stress resistance. Precisely regulating the activity of these factors could optimize the synthesis of stress-related proteins, thereby enhancing plant stress tolerance.
[0004] RNA aptamers are a class of nucleic acid molecules that can specifically bind to target molecules (such as proteins). Compared to traditional genetic engineering methods, RNA aptamers offer more precise and reversible regulation of targets: aptamers can modulate the function of target proteins by binding to them without permanently altering the plant genome. While RNA aptamers have garnered significant attention in fields such as biomedicine, their application in improving plant stress tolerance is still in its infancy. Targeting specific proteins with aptamers holds promise as a novel crop improvement strategy. Given the critical role of eIF4A in salt stress response, identifying RNA aptamers that specifically bind and inhibit eIF4A could potentially precisely control translation initiation, enabling rice to prioritize the synthesis of stress-resistant proteins and suppress the synthesis of non-essential proteins under salt stress, thereby improving salt tolerance. Therefore, developing a technology to enhance rice salt tolerance by regulating eIF4A using RNA aptamers is of great significance. Summary of the Invention
[0005] The present invention aims to overcome the lack of precision in existing approaches to improving rice salt tolerance by providing a novel strategy for enhancing rice salt tolerance by using RNA aptamers to regulate the translation initiation factor eIF4A. This approach involves screening RNA aptamers in vitro to efficiently and specifically bind to the rice eIF4A protein. These aptamers are then expressed in rice cells to finely regulate protein synthesis under stress conditions, thereby enhancing the plant's salt tolerance.
[0006] The first object of the present invention is to provide an RNA aptamer, the nucleotide sequence of which is shown in SEQ ID NO.4.
[0007] The present invention utilizes the systematic evolution screening (SELEX) technology of nucleic acid aptamers to enrich aptamer sequences with high affinity for eIF4A from an oligonucleotide library containing random sequences; the target is the recombinant eIF4A protein derived from rice, and the random RNA library is 40 nucleotides in length. After multiple rounds of forward screening combined with reverse screening to remove non-specific sequences, an eIF4A aptamer sequence eApt-2 with specificity and high affinity was screened out. Experiments have shown that eApt-2 can specifically bind to the eIF4A protein, and its dissociation constant Kd is approximately 0.86 μM, indicating that the binding force is very strong. More importantly, after binding, eApt-2 can inhibit the RNA helicase activity of eIF4A, thereby selectively blocking the 5' cap-dependent translation initiation process. Therefore, the present invention obtains an RNA aptamer that can accurately regulate translation initiation.
[0008] The second object of the present invention is to provide a recombinant expression vector, which contains a DNA sequence encoding the RNA aptamer and can transcribe and express the RNA aptamer in plant cells.
[0009] The third object of the present invention is to provide a transgenic plant cell containing the recombinant expression vector.
[0010] The fourth object of the present invention is to provide a transgenic plant, which is a plant in which the recombinant expression vector is transferred and integrated into the genome and expresses the RNA aptamer.
[0011] The fifth object of the present invention is to provide the use of the RNA aptamer in improving plant salt tolerance.
[0012] Preferably, the plant is rice.
[0013] After the eApt-2 aptamer is expressed in the transgenic rice cells of the present invention, it can bind to the endogenous eIF4A and partially inhibit its function without changing the expression level of any endogenous gene, thus achieving dynamic regulation of the translation mechanism. Under salt stress conditions, plant cells expressing the aptamer can reduce the input to the synthesis of non-critical proteins, give priority to the translation of stress defense-related proteins, and thus improve overall salt tolerance. The transgenic rice plants obtained by cultivation showed significantly enhanced salt tolerance under salt treatment, for example, their growth conditions were better than those of the control plants, their biomass accumulation was higher, and their chlorophyll content and photosynthetic efficiency decreased less. The aptamer regulation strategy of the present invention provides a new approach for crop salt resistance breeding.
[0014] Compared to existing technologies that improve salt tolerance by overexpressing or knocking out genes, the present invention uses RNA aptamers to finely regulate translation initiation factors, offering the following significant advantages: First, the regulation is highly specific; eApt-2 only affects the translation process associated with eIF4A, without interfering with other elements of the plant genome, thus reducing potential impacts on normal growth; second, the regulatory effect is reversible; the aptamer can be degraded and inactivated when no longer needed, avoiding the risks associated with permanent genetic modification; and third, the introduction of aptamer sequences is relatively safe for plants, without causing the accumulation of exogenous proteins, thus avoiding the physiological and metabolic disturbances and ecological risks that may be associated with traditional genetic modification. Therefore, the present invention provides a more precise, efficient, and safe method for improving rice salt tolerance, with promising application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1 Schematic diagram of SELEX screening strategy (A) and RNA library design (B).
[0016] Figure 2 The enrichment curve of eApt-2 (A) and the stem-loop structure prediction (B) are shown.
[0017] Figure 3The binding affinity of eApt-2 to eIF4A (A) and its effect on eIF4A protein level (B).
[0018] Figure 4 Dual luciferase assay was used to verify the inhibitory effect of eApt-2 on cap-dependent translation.
[0019] Figure 5 The co-localization of eApt-2 and eIF4A is enhanced under salt stress.
[0020] Figure 6 Figure 3 is the expression of eApt-2 in transgenic rice and its improvement of salt tolerance; A is the root length of wild type (WT) and transgenic seedlings under salt stress (150 mM NaCl), B is the biomass of wild type and transgenic seedlings under salt stress (150 mM NaCl); C is the qRT-PCR analysis of eIF4A aptamer expression in transgenic seedlings, D is the chlorophyll content of wild type and transgenic seedlings determined by SPAD value, and E is the Western blot analysis of eIF4A protein levels in wild type and transgenic seedlings. DETAILED DESCRIPTION
[0021] The following examples are provided to further illustrate the present invention, but are not intended to limit the present invention.
[0022] Example 1: In vitro screening of eIF4A-specific RNA aptamers
[0023] Preparation of target protein: The coding sequence (nucleotide sequence shown in SEQ ID NO.2) of rice eIF4A protein (amino acid sequence shown in SEQ ID NO.1) was cloned into the prokaryotic expression vector pCold vector, and the recombinant eIF4A protein with 6×His tag was induced to express in Escherichia coli BL21 (DE3). When the bacterial solution was cultured to OD≈0.6, the temperature was lowered and IPTG was added to induce protein expression. After appropriate culture, the bacteria were collected and the protein was extracted by lysis. 2 The His-tagged eIF4A protein was purified and enriched using a Ni-NTA affinity column, and its purity was verified by SDS-PAGE. The purified eIF4A protein was immobilized on Ni-NTA agarose beads and used as a target vector for subsequent SELEX screening.
[0024] Random nucleic acid library and SELEX conditions: The initial single-stranded DNA random library was synthesized, containing about 101 different sequences, each with 40 random bases (N) or 26 random bases (N) in the middle. 26 )-stem structure sequence-26 random bases (N 26 ), flanked by a T7 promoter sequence and fixed primer regions for in vitro transcription ( Figure 1 B in the figure). The DNA library was transcribed into an RNA library using a T7 in vitro transcription kit. The RNA library was mixed with the eIF4A protein immobilized on agarose beads in a binding buffer (containing 20mM HEPES, 150mM NaCl, 5mM MgCl, 1mM DTT, 0.1% Tween-20) and incubated at room temperature for a certain period of time to allow the aptamer to fully bind to the target protein. Afterwards, the unbound RNA sequence was removed (this can be achieved by multiple centrifugation washes) and the RNA-protein complex retained on the beads was collected. An appropriate amount of elution buffer (containing 10mM EDTA) was added to dissociate the RNA aptamer. The eluted enriched RNA aptamer was immediately reverse transcribed into cDNA and PCR amplified using a high-fidelity DNA polymerase to obtain a new round of enriched DNA fragments for the next round of in vitro transcription. Multiple rounds of screening were performed in this way, and each round included binding, elution and amplification steps ( Figure 1 A in the figure). During the screening process, the selection pressure was gradually increased: starting from the second round, a reverse screening step was added. Prior to each round of forward screening, the RNA library was incubated with an unrelated His-tagged protein system to remove sequences that might bind to common His tags or nonspecific sites. Simultaneously, as screening rounds increased, the target eIF4A protein dosage was gradually reduced and the washing intensity was increased to eliminate low-affinity binders. In later screening rounds (rounds 18-20), a competitive elution step was added: a known eIF4A inhibitor (a rocaglate-type small molecule) was added to the RNA-bound eIF4A beads, preferentially eluting high-affinity aptamers that compete with the eIF4A active site. This strategy improved the specificity and affinity of the selected aptamers. In this example, a total of 20 rounds of SELEX screening were performed.
[0025] Sequencing and aptamer acquisition: After the final round of screening, the enriched aptamer pool was sequenced and analyzed. High-throughput sequencing (Illumina sequencing platform) was used to read the aptamer sequences, and bioinformatics methods (FASTAptamer toolkit) were used to analyze the sequence enrichment and frequency distribution.
[0026] The results showed that multiple sequences were significantly enriched during the screening process. In this example, several aptamer sequences with the highest enrichment levels (eApt-1, eApt-2, and eApt-3) were selected, of which eApt-2 and eApt-3 were the two dominant sequences, with sequence lengths of 70 and 72 nucleotides, respectively.
[0027] The nucleotide sequence of eApt-1 is: GGAGGCUCUCGGGACGACGGAAUUGGCGAAAUCAUUGC GCCAACUGUAGUCCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO. 3).
[0028] The nucleotide sequence of eApt-2 is: GGAGGCUCUCGGGACGACGACUGGAGCGGAUGGUAAUC CUGGAAUCGGCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO. 4).
[0029] The nucleotide sequence of eApt-3 is: GGAGGCUCUCGGGACGACGGAAUCGGCGUCUGAUAAUC GCAGACUGAAGUCGUCCCGAUGCUGCAAUCGUAA (SEQ ID NO. 5).
[0030] Among the above sequences, eApt-2 has the highest enrichment in the screening pool, and the enrichment curve is shown in Figure 2 A in the sequence is considered to be the best candidate RNA aptamer sequence, and its stem-loop structure is predicted as follows: Figure 2 As shown in B. The subsequent embodiments will mainly verify the functions of eApt-2.
[0031] Example 2: Interaction between aptamer eApt-2 and eIF4A and its effect on translation initiation
[0032] Binding affinity determination: This example uses dot blot binding experiments and electrophoretic mobility shift assays (EMSA) to evaluate the binding ability of the aptamer to eIF4A. The purified eIF4A protein was spotted on a nitrocellulose membrane, and a certain concentration of aptamer eApt-2 or eApt-3 probe was added for hybridization, and the binding signal intensity was detected by chemiluminescence. The results showed that under the same conditions, the signal intensity generated by the eApt-2 probe was significantly higher than that of eApt-3, indicating that the binding of eApt-2 to eIF4A was stronger. Further, the aptamer with gradient concentrations was incubated with a fixed amount of eIF4A protein, the intensity change of the binding band was observed in EMSA, the binding curve was drawn, and the dissociation constant Kd was calculated. Results ( Figure 3 A) in the figure shows that the Kd of eApt-2 is approximately 0.86 μM, while the Kd of eApt-3 is approximately 13.46 μM, confirming that eApt-2 has a much higher affinity for eIF4A than eApt-3.
[0033] Effect on eIF4A Protein Levels: To investigate whether aptamer binding affects the intracellular stability of eIF4A, this example utilized a rice protoplast transient expression system. First, protoplasts were prepared from leaves of Nipponbare rice seedlings using cellulase (1.5% Cellulase R10) and pectinase (0.5% Macerozyme R10) for 3 hours in the dark. Highly active protoplasts were then purified by filtration and gradient centrifugation. Subsequently, the eApt-2 aptamer sequence (GGAGGCUCUCGGGACGACGACUGGAGCGGAUGGUAAUCCUGGAAUCGGCGUCCCGAUGCUGCAAUCGUAA), synthesized by T7 transcription, was heat-denatured at room temperature (95°C for 5 minutes) and rapidly placed on ice for structural refolding. The refolded aptamer (final concentration 50 nM) was transfected into the protoplasts using 40% PEG4000. Following transfection, the cells were allowed to rest at room temperature for 20 minutes to facilitate uptake. After transfection, the cells were washed and resuspended with W5 buffer and transferred to a medium containing 0.4M mannitol for subsequent culture at room temperature. Protoplasts were collected at different time points, including 0, 1, 4, and 8 hours after transfection. After total protein extraction, the expression level of eIF4A protein was detected using Western Blot technology to explore the effect of the eApt-2 aptamer on the stability of eIF4A in rice cells. Results ( Figure 3 Figure B) shows that, compared to the control without aptamer, eIF4A protein levels decreased significantly over time after eApt-2 transduction: a decrease in eIF4A content was detected 1 hour after transduction, and the protein band intensity further weakened at 4 and 8 hours. This result suggests that eApt-2 binding may accelerate eIF4A protein degradation or affect its stability, suggesting that the aptamer not only inhibits eIF4A function through physical obstruction but also triggers the cellular degradation pathway of the complex.
[0034] In vitro translation activity analysis: In order to clarify the functional effect of the aptamer on the translation initiation process, this example uses a dual-reporter luciferase system for detection. The reporter vector pRF-HCV-IRES used contains two reporter genes, Renilla luciferase (RLuc) and firefly luciferase (FLuc), of which the translation of RLuc depends on the typical 5' cap-dependent pathway, while the translation of FLuc is mediated by the hepatitis C virus IRES element (cap-independent). The above-mentioned dual reporter gene mRNA was co-incubated with the rice cell-free extract (RCE) system, and the synthetic aptamer eApt-2 or other control aptamers (random sequence aptamer N40) were added to measure the luciferase activity of the product. Results ( Figure 4) showed that in the system with the introduction of eApt-2, the activity of Renilla luciferase was significantly reduced, while the activity of firefly luciferase was basically unaffected. Compared with the control without aptamer or with the addition of irrelevant sequence aptamer, and compared with the other screened eApt-1 and eApt-3, eApt-2 showed the strongest inhibitory effect and significantly reduced the activity of RLuc (p<0.01, a decrease of 34.8%), while FLuc did not change significantly. This shows that eApt-2 specifically inhibits the cap-dependent translation initiation process in cell extracts, while having no obvious effect on IRES-mediated translation. It can be seen that eApt-2 binds to eIF4A, hindering its normal function in the ribosome initiation complex, thereby selectively inhibiting the translation of mRNA that depends on the unwinding activity of eIF4A. Combined with the above results, it can be inferred that under adverse conditions such as salt stress, the introduction of eApt-2 will inhibit the synthesis of proteins that are not directly related to the stress, freeing up more translation resources for key stress-resistant proteins, thereby benefiting cell survival under stress.
[0035] Subcellular Localization and Interaction Verification: We further observed the colocalization of the aptamer with eIF4A within the cell using confocal microscopy. A synthetic fluorescently labeled (Cy3) eApt-2 aptamer was introduced into rice protoplasts, and immunofluorescence staining with an anti-eIF4A antibody was performed to detect the localization relationship between the two within the cell. Under normal conditions, only a small amount of aptamer and eIF4A signal overlap was observed; however, after moderate salt stress treatment, the overlap between the aptamer fluorescence and the eIF4A signal increased significantly (Pearson correlation coefficient analysis showed an increase in the colocalization ratio). This phenomenon suggests that under salt stress, eIF4A may undergo conformational changes or alter its subcellular distribution, making it more susceptible to capture and binding by the aptamer. This result indirectly supports the mechanism by which eApt-2 functions under salt stress conditions: stress promotes aptamer-target interaction, thereby more effectively regulating the translation process and optimizing the stress response.
[0036] Example 3: Verification of the ability of aptamer eApt-2 to improve salt tolerance in transgenic rice
[0037] Vector Construction and Genetic Transformation: In this example, the expression sequence of the aptamer eApt-2 was introduced into rice cells to verify its effect on salt tolerance in the entire plant. First, based on the RNA sequence of eApt-2 (SEQ ID NO. 4), a corresponding DNA sequence was designed and synthesized: GGAGGCTCTCGGGACGACGACTGGAGCGGATGGTAATCCTGGAATCGGCGTCCCGATGCTGCAATCGTAA. Appropriate promoter and terminator elements were added to construct an expression cassette. The CaMV 35S promoter was used to drive nuclear transcription of the aptamer, achieving constitutive expression. This aptamer expression cassette was cloned into a plant expression vector (pCAMBIA1300 plasmid) to obtain the recombinant vector p35S-eApt-2. Rice (Nipponbare) callus tissue was transformed using Agrobacterium-mediated transfection. After resistance screening and tissue culture regeneration, transgenic rice lines stably integrating the eApt-2 expression cassette were obtained. Correct insertion of the aptamer transgene was verified by PCR and sequencing.
[0038] Aptamer expression and its effect on eIF4A: Aptamer expression levels were detected in seedlings. Total RNA was extracted from transgenic rice and wild-type controls, and reverse transcription quantitative PCR (qRT-PCR, forward primer: GGAGGCTCTCGGGACGA; reverse primer: TTACGATTGCAGCATCGGGAC) was performed using aptamer-specific primers. The results were ( Figure 6 C) confirmed that the transcripts of the aptamer eApt-2 accumulated in the transgenic plants, while the wild-type control had no such amplification signal, indicating that the exogenous aptamer gene was successfully expressed in the transgenic rice.
[0039] At the same time, the total protein of the corresponding materials was extracted and Western Blot analysis of eIF4A protein was performed. The results showed that under normal conditions, the eIF4A protein content of the transgenic plants was slightly lower than that of the control; after 48 hours of 150mM NaCl salt stress treatment, the eIF4A protein level in the transgenic plants was significantly lower than that in the control group ( Figure 6 Under the same conditions, eIF4A levels in the control plants remained unchanged or were slightly increased. This result is consistent with the trend in the protoplast experiment in Example 2, further demonstrating that aptamer expression can affect the steady-state level of eIF4A protein at the whole plant level.
[0040] Salt tolerance phenotypic analysis: In order to evaluate the effect of the eApt-2 aptamer on the salt tolerance of rice, transgenic rice seedlings and non-transgenic control seedlings were subjected to a salt stress comparison experiment under greenhouse conditions. The two groups of seedlings were placed in a culture medium containing 150mMNaCl for 7 to 14 days, and the growth conditions and physiological indicators of the plants were observed. The results showed that transgenic rice expressing eApt-2 showed stronger tolerance under salt stress: their leaves remained relatively green and upright, and the degree of plant growth inhibition was significantly lower than that of the control. Quantitative measurements showed that after one week of salt stress, the plant height and fresh weight of the transgenic plants were significantly higher than those of the control group, and the average fresh weight of the transgenic plants was about 1.3 times that of the control (p<0.05) ( Figure 6 At the same time, the chlorophyll content was detected using a SPAD chlorophyll meter ( Figure 6 The SPAD value of the leaves of the transgenic plants decreased only slightly after salt treatment (31, average value), remaining above 80% of the pre-stress value, while that of the control plants dropped to approximately 25 (average value). This indicates that photosynthesis in the transgenic plants was less affected by salt stress. In addition, the transgenic plants accumulated more biomass and had more developed root systems than the control plants ( Figure 6 All these evidences support that the expression of the eApt-2 aptamer significantly improves the tolerance of rice to salt stress.
[0041] Combined with the results of the above examples, it can be inferred that the molecular mechanism by which eApt-2 improves rice salt tolerance is as follows: After entering plant cells, the aptamer directly binds to eIF4A, inhibiting its unwinding activity and triggering a decrease in its protein level. Due to the restricted activity of eIF4A, the efficient translation of mRNAs that rely on the 5' cap structure (mostly genes encoding proteins related to normal growth) is suppressed. In contrast, some mRNAs that can still be translated under stress (which may have simpler 5' structures or contain IRES elements and often encode stress-resistant proteins) are less affected and thus increase their contribution to overall translation. As a result, under salt stress, plants allocate resources more towards the synthesis of stress-resistant proteins rather than secondary growth-related proteins. This translational reprogramming enhances cellular adaptability to salt stress. Furthermore, as exogenous molecules, the effects of RNA aptamers are reversible and regulatory: in the absence of stress, the aptamer's impact on eIF4A is relatively limited, not seriously impeding normal plant growth. However, when stress occurs, its regulatory effect can rapidly enhance the plant's defense capabilities.
[0042] In summary, the present invention achieves precise improvement of plant salt resistance through RNA aptamer-mediated translation control, providing a new technical approach that is different from traditional gene manipulation.
[0043] This study identified an RNA aptamer, eApt-2, that specifically binds to rice eIF4A using the SELEX technique and validated its ability to enhance salt tolerance by inhibiting cap-dependent translation initiation. eApt-2 provides a precise, reversible new tool for improving rice salt tolerance, with significant theoretical and practical value.
Claims
1. An RNA aptamer, characterized in that The nucleotide sequence is shown in SEQ ID NO.
4.
2. A recombinant expression vector, characterized in that: The invention contains a DNA sequence encoding the RNA aptamer according to claim 1 and can transcribe and express the RNA aptamer in plant cells.
3. Use of the RNA aptamer according to claim 1 in improving the salt tolerance of rice.