Molecular marker of rice grain width and grain shape gene GW2 promoter and application

Abstract

The invention discloses a molecular marker of a rice grain width and grain shape gene GW2 promoter and application, and relates to the field of molecular marker-assisted breeding of biological breeding rice. The invention provides an InDel molecular marker GW2p-InDel of a promoter region of a rice grain width and grain shape gene GW2, wherein the nucleotide sequence of the GW2p-InDel is as shown in SEQ ID NO. 1; gGCACACT sequence insertion exists in the SEQ ID NO. 1. The invention also relates to a method for The invention also provides a detection primer, a detection product, a method and application of the molecular marker GW2p-InDel. The molecular marker GW2p-InDel is closely linked with the characters of narrowing rice grains and increasing the length-width ratio, and can be used for identifying and screening rice germplasm materials containing novel allelic variation GW2p in a GW2 gene promoter region or not, so that rapid, efficient and accurate breeding of rice varieties with target characters of narrowing rice grains and increasing the length-width ratio is realized.

Description

Technical Field

[0001] The present invention relates to the technical field of biological breeding rice molecular marker assisted breeding, and in particular to a rice grain width and grain shape gene GW2 Molecular markers and applications of promoters. Background Art

[0002] The length, width, shape (measured by the ratio of grain length to grain width, i.e., aspect ratio) and weight of rice grains affect rice yield and quality, making them an important goal of rice improvement. Rice with long and thin grains with a large aspect ratio and short and thick grains with a small aspect ratio are favored by different consumer groups. How to improve the width and shape of rice grains and ensure rice yield and quality has become an important goal for rice breeders and production companies. Discovering alleles related to grain width and shape genes for use in improving rice grain width and shape will help to quickly, efficiently and accurately carry out molecular breeding of high-yield and high-quality rice.

[0003] The grain width and length-to-width ratio of rice grains are quantitative traits and are regulated by multiple gene loci. At present, there are not many cloned rice grain width and grain shape control genes with breeding application value, and even fewer allelic variations of these grain width and grain shape control genes in different rice germplasm materials have been discovered. Using rice varieties with different grain widths and grain shapes, sequencing and analysis of the promoter and coding regions of grain width and grain shape control genes were carried out to explore new allelic variations of these grain width and grain shape control genes, which can clarify their distribution patterns and functions in various rice germplasm resources, reveal the genetic basis and mechanism of rice grain width and grain shape regulation, and provide important gene targets and theoretical support for the breeding of new high-quality and high-yield rice varieties with different grain widths and grain shapes. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art and provide a rice grain width and grain shape gene GW2 Molecular markers and applications of promoters, specifically providing a rice grain width and shape gene GW2 InDel molecular markers in promoter regions GW2 p-InDel and its detection primers, detection products, methods and applications.

[0005] InDel molecular markers of the present invention GW2 p-InDel, representing the gene controlling grain width in rice GW2 A new variant site found in the promoter region GW2 p, whose allele is GW2 P, the GW2 p is closely linked to rice's narrow grains and long, slender grains with a large length-to-width ratio, while GW2 P is closely linked to rice with wide grains and short and thick grains with a small length-to-width ratio. InDel molecular markers GW2The p-InDel can be used to identify rice germplasm materials containing this new variant site GW2 p or GW2 P, thereby achieving the efficient and precise selection of rice breeding materials with target traits of narrow grains, slender and long grain shapes or wide grains, thick and short grain shapes.

[0006] The technical solution of the present invention is as follows: The first aspect of the present invention provides a molecular marker for the promoter of a rice grain width and grain shape gene GW2 The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the nucleotide sequence corresponding to it on its allelic promoter GW2 P is shown in SEQ ID NO.2.

[0007] Specifically, there is an insertion of the sequence GGCACACT after the 70th base C in SEQ ID NO.1, and there is a deletion of the sequence GGCACACT after the 70th base C in SEQ ID NO.2.

[0008] The present invention has first discovered a new allelic variation in the promoter region of the gene controlling grain width and grain shape located on chromosome 2 of rice GW2 p and GW2 p and GW2 P, and obtained an InDel molecular marker for distinguishing these two allelic variations GW2 p-InDel. This GW2 p is closely linked to the narrow grains and slender and long grain shapes with a large length-width ratio of rice, while GW2 P is closely linked to the wide grains and thick and short grain shapes with a small length-width ratio of rice.

[0009] The "grain width" in the present invention refers to narrow grains, wide grains, and grain widths between the two, and the "grain shape" refers to slender and long grain shapes, thick and short grain shapes, and grain shapes between the two.

[0010] Optionally, narrow grains and slender and long grain shapes mean that the average length-width ratio of rice is ≥3.2 and the average grain width is ≤2.7 mm; wide grains and thick and short grain shapes mean that the average length-width ratio of rice is ≤2.7 and the average grain width is ≥3.0 mm.

[0011] The second aspect of the present invention provides a primer pair for detecting the molecular marker, and the primer pair includes GW2 p-InDel-F and GW2 p-InDel-R. The GW2 nucleotide sequence of p-InDel-F is shown in SEQ ID NO.3, and the GW2 nucleotide sequence of p-InDel-R is shown in SEQ ID NO.4.

[0012] The third aspect of the present invention provides a product for detecting the grain width and grain shape of rice, and the product contains the above primer pair.

[0013] Optionally, the product is a kit, and the product further contains Taq DNA polymerase used for PCR amplification, 10× Taq buffer containing 20 mM MgCl2, dNTPs, and nuclease-free water.

[0014] The fourth aspect of the present invention provides a method for detecting the grain width and grain shape of rice, and the method includes the following steps: S1. Extract the genomic DNA of the leaves of the rice germplasm material to be detected; S2. Using the extracted DNA as a template, perform PCR amplification with the above primer pair or the above product to obtain an amplification product; S3. Detect the amplification product by agarose gel electrophoresis, and judge the grain width and grain shape of the rice germplasm material to be detected according to the length of the amplification product.

[0015] Optionally, in S1, the rice germplasm material to be detected is representative rice varieties from different sources, different ecological types, and different indica and japonica subspecies, including at least one of Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, Yuexiangzhan, Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Suiyangnian, Meitezhan, 19Xiang, Fudao 88, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, Guiyu 11, Yuebiao 5, Efengsimiao, Yingxiangsimiao.

[0016] Optionally, in S2, The PCR reaction system is: 5 μL of 10× Taq buffer containing 20 mM MgCl2, 2 μL of dNTPs, 0.5 μL of 10 μM forward primer GW2 p-InDel-F, 0.5 μL of 10 μM reverse primer GW2 p-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of DNA, and make up nuclease-free water to a total volume of 50 μL; The PCR reaction program is: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, cycle 35 times, and extension at 72°C for 10 min.

[0017] Optionally, in S3, When the length of the amplification product is 106 bp, the promoter type of the grain width and grain shape gene in the rice germplasm material to be detected GW2 is GW2 p, and the grains show narrow and slender grain shapes; When the length of the amplification product is 98 bp, the promoter type of the grain width and grain shape gene in the rice germplasm material to be detected GW2 is GW2 P, and the grains show wide and short and thick grain shapes; When the amplification product is a heterozygous type with both 106 bp and 98 bp present, the promoter type of the grain width and grain shape gene in the rice germplasm material to be detected GW2 is GW2 p / GW2 P, the grain width is between wide and narrow grains, and the grain shape is between slender and short and thick grain shapes.

[0018] The fifth aspect of the present invention provides an application of the molecular marker or the primer pair or the product or the method as described above in detecting the grain width and grain shape of rice germplasm materials.

[0019] The sixth aspect of the present invention provides an application of the molecular marker or the primer pair or the product or the method as described above in improving the grain width and grain shape of rice by using a molecular marker-assisted breeding method.

[0020] The present invention has at least one of the following beneficial effects: The present invention provides an InDel molecular marker GW2 of the promoter of a rice grain width and grain shape gene GW2 p-InDel and its detection primers, detection products, methods and applications. The present invention discovers for the first time a new allelic variation GW2 in the promoter region of the gene controlling grain width and grain shape located on chromosome 2 of rice GW2 p and GW2 P, and obtains an InDel molecular marker GW2 p-InDel for distinguishing these two allelic variations. Just by detecting the size of the amplification band of the above molecular marker, it can be judged whether the rice material to be tested contains GW2 the new allelic variation GW2 p and GW2 P in the promoter region of the gene, realizing predicting the grain width and grain shape of rice germplasm materials from the gene level or improving the grain width and grain shape of rice by molecular marker-assisted breeding, such as being used to identify or screen rice breeding materials with slender or short and thick grain shape phenotypes. The molecular marker described in the present invention can quickly and efficiently identify the GW2The type of gene promoter is used to precisely cultivate high-yield and high-quality rice varieties with slender or short and thick grain shapes, greatly reducing the time and labor costs required for breeding work. Description of the Drawings

[0021] Figure 1 For rice germplasm materials with different grain widths and shapes GW2 InDel molecular markers of the gene promoter GW2 The amplified product sizes of p-InDel. M is the marker, indicating the positions of 50 bp, 100 bp, and 200 bp. The serial numbers 1 to 16 respectively represent: 1, Longdao 24; 2, Xiangyaxiangzhan; 3, Wuyunjing 24; 4, Nipponbare; 5, Longjing 25; 6, Kendao 14; 7, Heijing 8; 8, Jijing 515; 9, Sanjiang 2; 10, Nanguizhan; 11, Huangguangyouzhan; 12, Qigui B; 13, Nongxiang 39; 14, Huahang 38; 15, Shuangyinzhan; 16, Yuexiangzhan.

[0022] Figure 2 Using GW2 InDel molecular markers of the gene promoter GW2 p-InDel was used to identify whether 24 rice germplasm materials contained GW2 p allelic variations. M is the marker, indicating the positions of 50 bp, 100 bp, and 200 bp. The serial numbers 1 to 24 respectively represent: 1, Ganningjing 3; 2, Jijing 88; 3, Kendao 11; 4, Suijing 18; 5, Huangguangtaizhan; 6, Dizhan; 7, Yuehesimiao; 8, Chenghui 377; 9, Hujing 137; 10, Longdun 103; 11, Longjing 57; 12, Yulong 7; 13, Suiyangnian; 14, Meitezhan; 15, 19Xiang; 16, Fudao 88; 17, Mudanjiang 26; 18, Suijing 4; 19, Longjing 40; 20, Kendao 20; 21, Guiyu 11; 22, Yuebiao 5; 23, Efengsimiao; 24, Yingxiangsimiao. Detailed Embodiments

[0023] In order to make the technical problems, technical solutions, and beneficial effects solved by the present invention clearer, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] The technical means used in the embodiments are all conventional technical means well-known to those skilled in the art; the raw materials or materials used in the embodiments are all commercially available.

[0025] Example 1: The InDel molecular marker of the rice grain width and shape gene GW2 PromoterGW2 Development and Validation of p-InDel (1) Genes Related to Grain Width and Grain Shape in Rice GW2 Discovery of Sequence Variation Sites in Promoter Regions and Molecular Markers GW2 The design of p-InDel is as follows: It is reported that GW2 is a major gene controlling grain width cloned on chromosome 2 of rice, with the gene number LOC_Os02g14720. The loss of its function will make the grains wider (Song et al., A QTL for rice grain width and weight encodes a previously unknown RING-type E3 ubiquitin ligase, Nature genetics, 2007, 39:623-630. doi: 10.1038 / ng2014). Based on this, we explored whether there are sequence regulations closely linked to the traits of rice grain width and grain shape in the GW2 gene promoter region of natural rice germplasm materials. Sequencing was performed on the GW2 gene promoter regions of the wide-grain rice variety Longdao 24 and the narrow-grain rice variety Xiangyaxiangzhan. Sequence comparison and analysis found that there is an insertion of the GGCACACT sequence (see SEQ ID NO.1) in the GW2 gene promoter region of the narrow-grain variety Xiangyaxiangzhan, and a deletion of the GGCACACT sequence (see SEQ ID NO.2) in the GW2 gene promoter region of the wide-grain variety Longdao 24.

[0026] SEQ ID NO.1: CAAGAAAAACCAAAACCTAACACGTGGATACAAAATGCAACCTGGACCCCACGTAACCCCTCCACCTCACGGCACACTTGTACATCCAGCTAGAGATCATCCTACG.

[0027] SEQ ID NO.2: CAAGAAAAACCAAAACCTAACACGTGGATACAAAATGCAACCTGGACCCCACGTAACCCCTCCACCTCACTGTACATCCAGCTAGAGATCATCCTACG.

[0028] Based on this sequence variation site, the InDel molecular marker of the promoter of the grain width and grain shape gene described in the present invention was designed using Primer Premier 5 software GW2 for the promoter of the grain width and grain shape gene GW2p-InDel, the primer sequences are shown in Table 1, and the product sizes are 106 bp and 98 bp in Xiangyaxiangzhan and Longdao 24, respectively.

[0029] Table 1 Grain width and grain shape genes GW2 InDel molecular markers of the promoter GW2 Primer sequences of p-InDel (2) Verifying molecular markers using 16 rice germplasm materials with different grain widths and grain shapes GW2 The relationship between p-InDel and the phenotypes of grain width, length-to-width ratio of grain shape is as follows: For 16 rice germplasm materials with different grain widths and grain shapes, namely Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, the traits of grain length, grain width, length-to-width ratio, 1000-grain weight, etc. of mature grains were examined and analyzed. It was found that there were obvious phenotypic differences in grain width and length-to-width ratio among them. Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, and Sanjiang 2 had wider grain widths and smaller length-to-width ratios; while Xiangyaxiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan had narrower grain widths and larger length-to-width ratios. See Table 2 for details.

[0030] Taking leaves from these 16 rice germplasm materials, genomic DNA of leaves was extracted by the CTAB method as a template, and PCR amplification was carried out using the forward and reverse primers of the InDel molecular marker GW2 p-InDel.

[0031] The PCR reaction system was: 5 μL of 10×Taq Buffer (buffer) containing 20 mM MgCl2, 2 μL of dNTPs (10 mM), 0.5 μL of 10 μM forward primer GW2 p-InDel-F, 0.5 μL of 10 μM reverse primer GW2 p-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of DNA (10 pg – 1 μg), and nuclease-free water was added to make the total volume 50 μL.

[0032] The PCR reaction program was: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, 35 cycles, and extension at 72°C for 10 min.

[0033] The above PCR products were detected by 5% (g / 100 mL, m / v) agarose gel electrophoresis. The results of the electrophoresis detection are as Figure 1 shown. The PCR band patterns of varieties with wide grains and small length-width ratios, such as Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, and Sanjiang 2, were approximately 98 bp; while the PCR band patterns of varieties with narrow grains and large length-width ratios, such as Xiangyaxiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, were approximately 106 bp. There was an 8-bp difference in the PCR band patterns between the germplasm materials with wide grains and small length-width ratios and those with narrow grains and large length-width ratios.

[0034] The allele type of the gene promoter with an electrophoresis band of 98 bp in the molecular marker amplification product and a deletion of the GGCACACT sequence in the sequence was named GW2 P; the allele type of the gene promoter with an electrophoresis band of 106 bp in the molecular marker amplification product and an insertion of the GGCACACT sequence in the sequence was named GW2 p. GW2 The allele type of the gene promoter was GW2 p. GW2 Rice germplasm materials with the allele type of the gene promoter being GW2 P, such as Longdao 24, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, and Sanjiang 2, showed thick and short grain shapes with wide grains and small length-width ratios; while GW2 rice germplasm materials with the allele type of the gene promoter being GW2 p, such as Xiangyaxiangzhan, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, and Yuexiangzhan, showed slender grain shapes with narrow grains and large length-width ratios (Table 2). The GW2 allele type of the gene promoter GW2 p identified in the present invention can cause rice grains to show slender grain shapes with narrow grains and large length-width ratios, while the allele type GW2 P can cause rice grains to show thick and short grain shapes with wide grains and small length-width ratios.

[0035] Table 2 Analysis of grain width and grain shape of 16 rice germplasm materials and GW2 identification of allele types of promoters Note: The data represent the average value ± standard deviation of at least 30 mature seeds of each rice germplasm material Example 2: Using the InDel molecular marker of the promoter of the rice grain width and grain shape gene GW2 p-InDel to identify whether the rice germplasm materials contain GW2 p and GW2 p andGW2 P allelic variations. Taking 24 rice germplasm materials, namely Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Suiyangnian, Meitezhan, 19Xiang, Fudao 88, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, Guiyu 11, Yuebiao 5, Efengsimiao, and Yingxiangsimiao, as examples, to identify whether they contain GW2 p and GW2 P allelic variations. The specific steps are as follows: (1) Extraction of genomic DNA from rice germplasm materials: For 24 rice germplasm materials, leaves were sampled at the seedling stage, and CTAB method was used to extract genomic DNA from leaves; (2) Amplifying molecular markers using a standard PCR amplification system GW2 p-InDel related fragments: Using molecular marker primers GW2 p-InDel-F and GW2 p-InDel-R, with the genomic DNA of the rice to be detected as the template, PCR amplification was carried out. The system and procedure of the PCR reaction were the same as those in step (2) of Example 1; (3) Electrophoresis detection and analysis of amplification products: The PCR products were detected by 5% (g / 100 mL, m / v) agarose gel electrophoresis. If the molecular marker can amplify a 106 bp band pattern, it indicates that there is an insertion of the GGCACACT sequence in the gene promoter region of the detected rice germplasm material, and the promoter allelic type is GW2 p; if the molecular marker can amplify a 98 bp band pattern, it indicates that there is a deletion of the GGCACACT sequence in the gene promoter region of the detected rice germplasm material, and the promoter allelic type is GW2 P; if the molecular marker amplifies a 106 bp / 98 bp heterozygous band pattern, it indicates that the promoter allelic type of this material GW2 is GW2 p / GW2 P; GW2 According to the electrophoresis results ( GW2 ), the PCR band patterns of rice germplasm materials such as Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Suiyangnian, Meitezhan, 19Xiang, Fudao 88, Guiyu 11, Yuebiao 5, Efengsimiao, and Yingxiangsimiao are 106 bp, there is an insertion of the GGCACACT sequence in the gene promoter region, and the promoter allelic type is Figure 2 p, GW2 and the promoter allelic type is GW2p; while the PCR band patterns of rice germplasm materials such as Gangningjing 3, Jijing 88, Kendao 11, Suijing 18, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Mudanjiang 26, Suijing 4, Longjing 40, and Kendao 20 are 98 bp, GW2 There is a deletion of the GGCACACT sequence in the gene promoter region, and the promoter allelic type is GW2 P.

[0036] (4) Verification and analysis of the grain width and grain shape of 24 rice germplasm materials: For these 24 rice germplasm materials with different grain widths and grain shapes, the traits such as grain length, grain width, length-width ratio, and 1000-grain weight of the grains were examined and analyzed at the mature stage. The results are shown in Table 3. It was found that GW2 The promoter allelic type of the gene is GW2 p of the rice germplasm materials, Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Suiyangzhan, Meitezhan, 19xiang, Fudao 88, Guiyu 11, Yuebiao 5, Efengsimiao, and Yingxiangsimiao, their grains show a narrow and long grain shape with a large length-width ratio; while GW2 The promoter allelic type of the gene is GW2 P of the rice germplasm materials, Gangningjing 3, Jijing 88, Kendao 11, Suijing 18, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Mudanjiang 26, Suijing 4, Longjing 40, and Kendao 20, their grains show a wide and short grain shape with a small length-width ratio. The rice grain width and grain shape gene of the present invention GW2 The InDel molecular marker of the promoter GW2 p-InDel can be used to identify whether the rice germplasm materials contain the grain width and grain shape gene GW2 of the promoter GW2 p and GW2 P allelic variations, so as to predict the grain width and grain shape of rice germplasm materials at the gene level.

[0037] Table 3 Grain width and grain shape results of 24 rice germplasm materials with GW2 p or GW2 P allelic differences Note: The data represent the average value ± standard deviation of at least 30 mature seeds of each rice germplasm material As can be seen from the above examples, using the InDel molecular marker GW2 p-InDel of the promoter of the rice grain width and grain shape gene of the present invention GW2 and its detection primers, detection products, and methods are mainly applied to identify the rice grain width and grain shape gene GW2Whether there is an insertion or deletion of the GGCACACT sequence in the promoter region. Through PCR detection and agarose gel electrophoresis identification, it is possible to determine as early as possible and accurately whether there is an allelic variation in the rice germplasm material to be tested that causes the grains to exhibit narrow grains and a large aspect ratio of long and slender grain shapes GW2 p, and the allelic variation that causes the grains to exhibit wide grains and a small aspect ratio of thick and short grain shapes GW2 P, so as to achieve rapid, efficient, accurate molecular marker-assisted breeding selection and accelerate the breeding process.

[0038] The above is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, makes equivalent substitutions or changes, and should be covered by the protection scope of the present invention.

Claims

1. A molecular marker for a rice grain width and grain shape gene GW2 The promoter is characterized in that The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and the nucleotide sequence corresponding to the molecular marker on its allelic promoter GW2 P is as shown in SEQ ID NO.

2.

2. A primer pair for detecting the molecular marker according to claim 1, characterized in that, The primer pair includes GW2 p-InDel-F and GW2 p-InDel-R. The GW2 nucleotide sequence of p-InDel-F is shown as SEQ ID NO.3, and the GW2 nucleotide sequence of p-InDel-R is shown as SEQ ID NO.

4.

3. A product for detecting the grain width and grain shape of rice, characterized in that, The product contains the primer pair described in claim 2.

4. The product according to claim 3, characterized in that, The product is a kit, and the product further contains Taq DNA polymerase used for PCR amplification, 10× Taq buffer containing 20 mM MgCl2, dNTPs, and nuclease-free water.

5. A method for detecting the grain width and grain shape of rice, characterized in that, The method comprises the following steps: S1. Extract the genomic DNA of the leaves of the rice germplasm material to be detected; S2. Using the extracted DNA as a template, perform PCR amplification with the primer pair described in claim 2 or the product described in claim 3 to obtain an amplification product; S3. Detect the amplification product by agarose gel electrophoresis, and judge the grain width and grain shape of the rice germplasm material to be detected according to the length of the amplification product.

6. The method according to claim 5, characterized in that, In S1, The rice germplasm material to be detected is representative rice varieties of different origins, different ecological types, and different indica and japonica subspecies, including at least one of Longdao 24, Xiangyaxiangzhan, Wuyunjing 24, Nipponbare, Longjing 25, Kendao 14, Heijing 8, Jijing 515, Sanjiang 2, Nanguizhan, Huangguangyouzhan, Qigui B, Nongxiang 39, Huahang 38, Shuangyinzhan, Yuexiangzhan, Ganningjing 3, Jijing 88, Kendao 11, Suijing 18, Huangguangtaizhan, Dizhan, Yuehesimiao, Chenghui 377, Hujing 137, Longdun 103, Longjing 57, Yulong 7, Suiyangnian, Meitezhan, 19Xiang, Fudao 88, Mudanjiang 26, Suijing 4, Longjing 40, Kendao 20, Guiyu 11, Yuebiao 5, Efengsimiao, Yingxiangsimiao.

7. The method according to claim 5, wherein In S2, The PCR reaction system is as follows: 5 μL of 10× Taq buffer containing 20 mM MgCl2, 2 μL of dNTPs, 0.5 μL of 10 μM forward primer GW2 p-InDel-F, 0.5 μL of 10 μM reverse primer GW2 p-InDel-R, 0.25 μL of 5 U / μL Taq DNA polymerase, 1 μL of DNA, supplemented with nuclease-free water to a total volume of 50 μL; The PCR reaction program is: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 15 s, cycle 35 times, and extension at 72°C for 10 min.

8. The method according to claim 5, characterized in that In S3, When the length of the amplification product is 106 bp, the promoter type of the grain width and grain shape gene in the rice germplasm material to be detected GW2 is GW2 p, and the grains show narrow and slender grain shapes; When the length of the amplification product is 98 bp, the promoter type of the grain width and grain shape gene in the rice germplasm material to be detected GW2 is GW2 P, and the grains show wide grains and thick and short grain shapes; When the amplified product is a heterozygous type with both 106 bp and 98 bp present, the grain width and grain shape genes in the rice germplasm material to be detected GW2 The promoter type is GW2 p / GW2 P. The grain width is between wide grains and narrow grains, and the grain shape is between slender grain shape and stubby grain shape.

9. The application of the molecular marker described in claim 1, or the primer pair described in claim 2, or the product described in any one of claims 3 to 4, or the method described in any one of claims 5 to 8 in detecting the grain width and grain shape of rice germplasm materials.

10. The application of the molecular marker described in claim 1, or the primer pair described in claim 2, or the product described in any one of claims 3 to 4, or the method described in any one of claims 5 to 8 in improving the grain width and grain shape of rice by molecular marker-assisted breeding method.

Images