Indian rice moth granulosis virus strain and application thereof in trapping and killing Indian rice moth

By using bait made of granule virus strain of the Indian Valley Monster granule virus strain combined with sucrose ester, the shortcomings of existing chemical control methods are solved, efficient biological control of the Indian Valley Monster granule is achieved, and the risk of pest resistance is reduced.

CN120230723AActive Publication Date: 2025-07-01WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510352474.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-07-01
Estimated Expiration
2045-03-24

AI Technical Summary

Technical Problem

The existing chemical methods have problems such as high pesticide residues, pest resistance and high usage costs when preventing and controlling Indian valley borer, and lack efficient biological control methods.

Method used

The Plodia interpunctella granulovirus Wuh (preservation number CCTCC NO: V202510) was used to combine sucrose as a food attractant to make bait to lure and kill Indian borer.

Benefits of technology

It provides an efficient biological control strategy, significantly improves the killing effect of Indian valley borer and avoids the defects of chemical control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230723A_ABST
    Figure CN120230723A_ABST
Patent Text Reader

Abstract

The invention discloses a Plodia interpunctella Granulovirus strain and an application thereof in trapping and killing Plodia interpunctella, the Plodia interpunctella Granulovirus strain has a preservation number of CCTCC NO: V202510, the Plodia interpunctella Granulovirus strain is verified to have a good killing effect on Plodia interpunctella, the Plodia interpunctella Granulovirus strain is added with sucrose acid ester as a main phagostimulant component to prepare a bait, the Plodia interpunctella Granulovirus strain can efficiently trap and kill Plodia interpunctella, and the Plodia interpunctella Granulovirus strain can be used for trapping and killing Plodia interpunctella. And a new strategy is provided for prevention and treatment of the stored insect Indian rice moth.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biological control of storage pests, and specifically to a Plodia interpunctella granulovirus strain and its application in trapping and killing Plodia interpunctella. Background Art

[0002] Plodia interpunctella can damage all plant storage materials such as grains, candied fruits and Chinese patent medicines, and is widely distributed around the world. The larvae of Plodia interpunctella like to eat the embryo and epidermis of grains, and the feces discharged during the damage process can cause grain pollution, which is very harmful to grain storage. According to the sixth national survey of stored grain insects in 2004 - 2005, Plodia interpunctella was listed as one of the main Lepidoptera stored grain pests with serious damage and wide distribution.

[0003] Currently, the control methods for Plodia interpunctella mainly include chemical fumigation, chemical trapping, carbon dioxide circulation fumigation, etc. These methods have disadvantages such as high pesticide residues, easy generation of pest resistance, and high use costs.

[0004] Insect baculoviruses have characteristics such as high insecticidal activity, difficult generation of resistance in pests, and ability to cause pest population epidemics, and are a type of biological pesticide with distinct characteristics.

[0005] Therefore, finding an insect baculovirus bait for efficiently trapping and killing Plodia interpunctella has great application prospects in the biological control of the storage pest Plodia interpunctella. Summary of the Invention

[0006] The present invention provides a Plodia interpunctella granulovirus strain and its application in trapping and killing Plodia interpunctella. By isolating and screening, a Plodia interpunctella granulovirus strain is obtained, which is used for an insect baculovirus bait for efficiently trapping and killing Plodia interpunctella, providing a new strategy for the control of the storage pest Plodia interpunctella.

[0007] In view of this, the solution of the present invention is as follows:

[0008] The first aspect of the present invention is to provide a Plodia interpunctella granulovirus strain (Plodia interpunctella granulovirus Wuh), which is preserved in the China Center for Type Culture Collection, and the preservation number is CCTCC NO: V202510.

[0009] The second aspect of the present invention is to provide the application of the Plodia interpunctella granulovirus strain described in the first aspect in killing Plodia interpunctella.

[0010] The third aspect of the present invention is to provide a bait for killing Plodia interpunctella, which is characterized by comprising the Plodia interpunctella granulovirus strain described in the first aspect and a feeding attractant.

[0011] Furthermore, the attractant includes sucrose ester.

[0012] Furthermore, the bait contains an infectious liquid with a content of Plodia interpunctella granulovirus strain of 1×10 11 OB / mL, and sucrose ester with a concentration of 1-20%, and the volume ratio of the two is 1:1; the concentration of the sucrose ester is preferably 10-15%.

[0013] Furthermore, the bait further includes at least one of a humectant, a preservative, and a porous structure filler.

[0014] Furthermore, the humectant is glycerol; and / or, the preservative is propionic acid; and / or, the porous structure carrier is nano-silica.

[0015] In the fourth aspect of the present invention, there is provided a preparation method of the bait described in the second aspect, which is obtained by mixing the Plodia interpunctella granulovirus strain with the attractant and then drying.

[0016] In the fifth aspect of the present invention, there is provided a method for killing Plodia interpunctella, which uses the bait described in the third aspect to kill Plodia interpunctella.

[0017] Furthermore, when the bait is used, it is scattered in the storage area, where there are stored grains or their processed products, milk powder, dried fruits, candies, spices, raw medicinal materials or traditional Chinese medicine pills. The grains mainly damaged by Plodia interpunctella include but are not limited to corn, rice, wheat, beans, rapeseed, peanuts, etc., which are stored as food products or seeds; the processed grain products include but are not limited to cereal flour, rice and wheat products, etc.; the dried fruits include but are not limited to melons, red dates and other crops; the raw medicinal materials such as ginseng, adenophora, codonopsis, etc., and Plodia interpunctella affects their quality and medicinal value.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The Plodia interpunctella granulovirus strain (Plodia interpunctella granulovirus Wuh) with the preservation number of CCTCC NO: V202510 provided by the present invention has been verified to have a good killing effect on Plodia interpunctella and has great application prospects in the biological control of the storage pest Plodia interpunctella.

[0020] The bait for killing Plodia interpunctella provided by the present invention can efficiently trap and kill Plodia interpunctella by adding sucrose ester as the main attractant component and combining with the Plodia interpunctella granulovirus, providing a new strategy for the control of the storage pest Plodia interpunctella. Description of the Drawings

[0021] Figure 1 It is a schematic diagram of the dead Plodia interpunctella found in Example 1 of the present invention.

[0022] Figure 2 Schematic diagram of the genomic structure comparison between the Plodia interpunctella granulovirus Wuh strain and the Cambridge strain described in Example 1 of the present invention. Specific embodiments

[0023] The technical solutions of the present invention will be clearly and completely described below in conjunction with the preferred embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the scope of protection of the present invention.

[0024] Example 1 Isolation of the virus

[0025] A large number of Plodia interpunctella larvae were found in a long-unused rice bucket in a family kitchen in Wuchang District, Wuhan City. Among them, there were a small number of dead insects ( Figure 1 ). These dead larvae were homogenized and subjected to 3 rounds of differential centrifugation at 8000 rpm for 5 min and 6000 rpm for 30 min to obtain a grayish-white precipitate. The precipitate was observed under an electron microscope, and a typical oval granulovirus structure was found. The DNA of the virus was extracted, and PCR was performed using the universal primers lef-8 and lef-9 of baculovirus and sequenced. After comparison with the gene bank of NCBI, it was found that their nucleotide identities with the Plodia interpunctella granulovirus (PlinGV) Cambridge strain were 98.6% and 96.1% respectively. This virus was named Plodia interpunctella granulovirus Wuh (hereinafter referred to as PlinGV-wh). The complete genomic sequence of PlinGV-wh was sequenced, and its genome size was 112,443 bp, which was 93 bp smaller than the 112,536 bp of the PlinGV Cambridge strain. Their overall genomic structures were similar, but there were 1125 bp of variations ( Figure 2 ). The Plodia interpunctella granulovirus Wuh strain was deposited with the China Center for Type Culture Collection on February 21, 2025, and its deposit number is CCTCC NO: V202510.

[0026] PlinGV-Wuh lef-9 gene sequence: (96.1% identity with the Cambridge strain)

[0027] TCAGTATCTCTACTACGACATTCCTCAATACCGGCAGTTTTTACGCCAATGTCCAGTGTTTCAACGGTGTGAACGAAATCAAACCACCGCCTATGAGCGTGGCGCGCTACTACGGTAGGCGCGTGGACGAGGTTCGTGTATGGAACACACGACATCC

[0028] PlinGV - Wuh lef - 8 gene sequence: (98.6% identity with Cambridge strain)

[0029] TGGGGGGTTGAAGGAATTCTTCGTGTGTCACAACGTGTTACTGCCCGACGTGAATTACAAGTTCGTAGCCGACCTATTCAGAGTGATGGTAGAAAAAAAATTATTTTTCGATGATGACGAATTAGCGGCCAAAAAATTAAATTTTAAAATTTCAGCCGCTAATTCGTCATCATCATCCGAATTCGACATCATGATGGTATCATTTAATAACCGACCGACCAAATTCTATTGCGACTCACAGCATATTCTGGATGTATACTATCATTTCAAACGCAGCTACAGCCCGGTAGAGATCAAAATCAGCGACGGTATCCTCTTCATCAATCATCACGAGGGAATGGTTATGAAAAAGAAGATAGTGTGCATCGGTGACGACGTTCATATTAACACTCTCCAAACAACTTTCGAGTACCACAACGAAAGCAGCGTGGTCAATACCAATGACGCACTGAAATTCGTAGATAAACCCGGGGAAGACAACACAACGACACTGATGTCCACTATGATTCTGAAATATTACAAGAATCATCTTCACATATTCAACACTATCCCTGTTGCCAAACTGATAGTCAGTCTGACCAATCTCAAGAACGGAATGGTGGTTCAAAGAAAAGACTACAAAATTCTACCTATAGGAAACAGCGTAATGGTGGGCGATAGTGTTTATTACAACGATAGAATGTTTTCGCTGTGGACGTTGGTGATTGATAACAAGCTGAAAACCGCCGAAGATCCCTGCAT Example 2

[0030] Wash the wheat / corn / peanuts, put them in an oven at 120 °C and dry for 12 h, treat them at -20 °C for 3 days, place them in a dry environment at room temperature to dry, and crush them with a crusher through a 100-mesh sieve, then store them in the refrigerator for later use.

[0031] Infection solution: Mix the PlinGV-Wuh strain of Plodia interpunctella granulovirus (1×10 11 OB / mL), attractant (15% sucrose fatty acid ester / 15% sucrose + blue dye), glycerol, and propionic acid in a volume ratio of 1:1:1:0.005 to prepare the infection solution, and then add 5% nano-silica according to the weight / volume ratio.

[0032] Mix the above-mentioned infection solution, attractant and auxiliary materials according to the ratio to make the virus insecticidal bait, dry it in a cool place, and store it in the refrigerator for later use.

[0033] Prepare an artificial diet for raising Plodia interpunctella using 300 g of crushed wheat grains / oatmeal, 14 ml of glycerol, 0.07 ml of propionic acid and 10 g of yeast powder. Put 200 g of the artificial diet into a feed rearing tank with a diameter of 10 cm and a height of 18 cm, and introduce 50 Plodia interpunctella larvae at the 1st - 2nd instar. Two days later, sprinkle the virus insecticidal bait on the surface of the artificial diet and gently stir to make the bait penetrate 1.5 cm below the surface of the diet. At the same time, set up a control without sprinkling the bait.

[0034] Cultivation conditions: 28 °C, 65% humidity, 12 h:12 h light.

[0035] After 10 days, check the Plodia interpunctella larvae in the artificial diet and calculate the mortality rate.

[0036] From the results in Table 1, when the attractant is 15% sucrose fatty acid ester, the mortalities of Plodia interpunctella larvae caused by wheat, corn and peanuts as baits are 86.0%, 85.3% and 88.7% respectively, and the effects are not very different. When the attractant is 15% sucrose, the mortalities of Plodia interpunctella larvae caused by wheat, corn and peanuts as baits are 75.3%, 74.7% and 76.7% respectively, and the effects are also not very different. However, when 15% sucrose fatty acid ester is used as the attractant, the mortality rate of Plodia interpunctella larvae is higher than that when 15% sucrose is used as the attractant, regardless of whether wheat, corn or peanuts are used as baits.

[0037] The mortalities of Plodia interpunctella using different concentrations of sucrose fatty acid ester as attractants are shown in Table 2. It can be seen that when the attractant is 5% sucrose fatty acid ester, the mortality rate of Plodia interpunctella is significantly lower than that when the concentrations of sucrose fatty acid ester are 10%, 15% and 20%. However, when the concentration of sucrose fatty acid ester is 20%, the mortality rate of Plodia interpunctella does not increase further. Therefore, the optimal use concentration of sucrose fatty acid ester is 10 - 15%.

[0038] Table 1: Mortality of Plodia interpunctella using different bait formulations

[0039]

[0040] The bait formulations in Table 1 are as follows:

[0041] B1: The bait is wheat, and the attractant is 15% sucrose fatty acid ester;

[0042] B2: The bait is corn, and the attractant is 15% sucrose fatty acid ester;

[0043] B3: The bait is peanut, and the attractant is 15% sucrose fatty acid ester;

[0044] B4: The bait is wheat, and the attractant is 15% sucrose;

[0045] B5: The bait is corn, and the attractant is 15% sucrose;

[0046] B6: The bait is peanut, and the attractant is 15% sucrose;

[0047] CK1: The bait is wheat, the attractant is 15% sucrose fatty acid ester, and no virus is added to the infection solution;

[0048] CK2: The bait is corn, the attractant is 15% sucrose fatty acid ester, and no virus is added to the infection solution;

[0049] CK3: The bait is peanut, the attractant is 15% sucrose fatty acid ester, and no virus is added to the infection solution.

[0050] * Different letters after the average mortality indicate that there is a significant difference between the two after analysis of variance (α = 0.05).

[0051] Table 2: Mortality of Plodia interpunctella using different concentrations of sucrose fatty acid ester as attractant

[0052]

[0053] The bait formulations in Table 2 are as follows:

[0054] B7: The bait is peanut, and the attractant is 5% sucrose fatty acid ester;

[0055] B8: The bait is peanut, and the attractant is 10% sucrose fatty acid ester;

[0056] B9: The bait is peanut, and the attractant is 15% sucrose fatty acid ester;

[0057] B10: The bait is peanut, and the attractant is 20% sucrose fatty acid ester;

[0058] CK1: The bait is peanut, the attractant is 5% sucrose fatty acid ester, and no virus is added to the infection solution;

[0059] CK2: The bait is peanut, the attractant is 7.5% sucrose fatty acid ester, and no virus is added to the infection solution;

[0060] CK3: The bait is peanut, the attractant is 15% sucrose fatty acid ester, and no virus is added to the infection solution;

[0061] CK4: The bait is peanut, the attractant is 20% sucrose fatty acid ester, and no virus is added to the infection solution.

[0062] * Different letters behind the average mortality rate indicate that there are significant differences between the two after analysis of variance (α = 0.05).

[0063] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principle and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A Plodia interpunctella granulovirus Wuh strain, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: V202510.

2. Use of the Indian meal moth granulovirus strain according to claim 1 in killing Indian meal moth.

3. A bait for killing Indian meal moth, characterized in that: It comprises the Indian meal moth granulovirus strain as claimed in claim 1, and an attractant.

4. The bait according to claim 3, characterized in that The phagostimulant includes sucrose ester.

5. The bait according to claim 4, characterized in that The bait contains 1×10 11 OB / mL infection fluid and 1-20% sucrose ester, the volume ratio of the two is 1:

1.

6. The bait according to claim 3, characterized in that The bait also includes at least one of a moisturizer, a preservative, and a porous structure carrier.

7. The bait according to claim 6, characterized in that The moisturizing agent is glycerin; and / or the preservative is propionic acid; and / or the porous structure filler is nano silicon oxide.

8. The method for preparing the bait according to any one of claims 3 to 7, characterized in that: The Indian meal moth granulovirus strain is mixed with an attractant and then dried.

9. A method for killing Indian meal moth, characterized in that: Use the bait described in any one of claims 3 to 7 to kill Indian meal moth.

10. The method according to claim 9, characterized in that The bait is spread to a storage area when in use, and the storage area stores grains or processed products thereof, milk powder, dried fruits, candies, spices, raw medicinal materials or Chinese medicine pills.

Citation Information

Patent Citations

  • Composite particles for controlling arthropod infestation

    CN107920535A