Method for improving positioning specificity of peroxisome and application thereof
By fusing the expression of the N-terminal localization sequences of PTSp and PTS1 in plant cells, the non-specific localization problem of peroxisome signal peptides is solved, and the specific localization of peroxisome is achieved, the targeting accuracy of proteins in plant cells is improved, and the subcellular localization marker library is enriched.
Patent Information
- Application Number
- CN202510727776.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-03
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-06-03
AI Technical Summary
In the prior art, single peroxisome signal peptides are not specific in plant cells, making it difficult to determine the specificity of protein targeting, affecting the accuracy of plant subcellular localization research.
By fusing the peroxisome N-terminal localization sequence PTSp and type I signal peptide PTS1 with the target gene, it was introduced into plant cells using Agrobacterium-mediated transient transformation technology, and fluorescence imaging was performed in combination with laser confocal microscopy to achieve specific localization of peroxisome.
It improves the specificity of peroxisome localization, enriches the subcellular localization marker library, enhances the target accuracy of the target protein in peroxisome, and provides a reliable method for plant subcellular localization research.
Smart Images

Figure CN120230792A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of biotechnology and botany, and particularly relates to a method for improving the peroxisome localization specificity and its application. Background Art
[0002] Plant cells mainly include two major parts: cell walls and protoplasts. Protoplasts contain cell membranes, cytoplasm, and nuclei. The cytoplasm includes cytoplasmic matrix and organelles such as mitochondria, chloroplasts, endoplasmic reticulum, vacuoles, Golgi apparatus, peroxisomes, and lysosomes. The normal function of cells depends on the dynamic changes in the types, contents, and modification states of proteins under specific spatial distributions to precisely regulate various biological processes. Therefore, as a core element, subcellular localization plays a decisive role in the physiological function of proteins within cells. Protein subcellular localization analysis has become an experimental method widely used in the field of gene function exploration, which can provide key reference information for clarifying the specific functions of proteins encoded by unknown genes and occupies an important position in the process of modern biological research.
[0003] Organelle markers are fundamental tools in cell biology. Their conventional uses are to track and detect the dynamic behaviors of corresponding organelles and to assist in precisely locking the subcellular localization coordinates of biological macromolecules. The application of fluorescent proteins enables researchers to accurately determine the localization of proteins through fluorescence imaging. However, sometimes there is a lack of accurate and single reference objects, and the targeting specificity of proteins cannot be determined. Therefore, a visual fluorescent organelle marker has key value and can serve as a benchmark scale for protein localization at the subcellular level. Especially for proteins with a punctate fluorescence distribution pattern such as those in plant peroxisomes, its precise positioning role is even more prominent.
[0004] Plant peroxisomes play important roles in all stages of growth and development and in response to environmental stresses. They are a type of single-membrane-enclosed round or oval organelles with small size, simple structure, rich metabolic functions, and obvious tissue and species specificities. Peroxisomes play important roles in biological processes such as fatty acid degradation, plant hormone synthesis, reactive oxygen species scavenging, and photorespiration. Current research shows that most peroxisomal proteins contain a C-terminal tripeptide localization signal PTS1. However, in most cases, a single PTS1 signal peptide cannot achieve specific localization. In addition, there is also an N-terminal localization signal peptide PTS2, but its conservation is poor and the research on it is not in-depth. The research on the proteome of plant cell peroxisomes has very important applications in cell biology and agricultural biotechnology. Therefore, developing a method for specific localization of plant peroxisomes has important scientific significance for enriching the marker library and importing target proteins. Summary of the Invention
[0005] In view of this, the present invention provides a method for improving the specificity of peroxisome localization and its application, which can solve the problem of non-specific localization caused by a single peroxisome signal peptide.
[0006] The technical solution of the present invention is implemented as follows: In the first aspect, the present invention provides a method for improving the specificity of peroxisome localization, including the following steps: S1, fusing and expressing the peroxisome N-terminal localization sequence PTSp with the nucleotide sequence shown in SEQ ID No.1 and the type I signal peptide PTS1 with the target gene by homologous cloning to obtain a PTSp-target gene-PTS1 fusion construct; S2, transforming the fusion construct into Agrobacterium tumefaciens; S3, injecting the transformed Agrobacterium tumefaciens into plant leaves using an Agrobacterium-mediated transient transformation system; S4, performing fluorescence imaging using a laser confocal microscope to detect the specific localization of the target gene in peroxisomes of plant cells.
[0007] Based on the above technical solution, preferably, the nucleotide sequence of the type I signal peptide PTS1 is shown in SEQ ID No.2.
[0008] Based on the above technical solution, preferably, in step S1, the target gene is an exogenously introduced transgene or an endogenous gene, and its expression product is a protein or polypeptide.
[0009] Based on the above technical solution, preferably, the target genes are the red fluorescent protein mKate2 and the actin AtActin2.
[0010] In the second aspect, the present invention provides a fusion gene construct for improving the specificity of peroxisome localization, comprising a peroxisome N-terminal localization sequence PTSp, a type I signal peptide PTS1, and a target gene, wherein the nucleotide sequence of the N-terminal localization sequence PTSp is shown in SEQ ID No.1.
[0011] Based on the above technical solution, preferably, the target genes are the red fluorescent protein mKate2 and the actin AtActin2.
[0012] In the third aspect, the present invention provides an expression cassette for improving the specificity of peroxisome localization, comprising the fusion gene construct.
[0013] In the fourth aspect, the present invention provides the application of the above method, fusion gene construct or expression cassette in plant subcellular localization research.
[0014] A method for improving the specificity of peroxisome localization and its application according to the present invention have the following beneficial effects compared with the prior art: In the present invention, the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1 are fused and expressed with the target gene by homologous cloning, so that the target gene is localized in the peroxisome. Subsequently, the red fluorescent protein mKate2 and the actin AtActin2 are used as the target genes, and Agrobacterium is transformed by the Agrobacterium-mediated transient genetic transformation technology. Then, the tobacco leaves are injected, and fluorescence imaging is performed by a laser confocal microscope to obtain the fluorescence signal specifically localized in the peroxisome. The present invention can solve the problem of non-specific localization of a single peroxisome signal peptide, provide a favorable method for plant subcellular localization research, and has important significance.
[0015] The peroxisome localization marker of plant cells according to the present invention enriches the subcellular localization marker library and can be used as a marker control for peroxisome localization; in addition, genes that are not localized in the peroxisome can also be specifically localized in the peroxisome, improving the accuracy of target protein targeting. BRIEF DESCRIPTION OF THE DRAWINGS
[0016] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without creative efforts.
[0017] Figure 1 It is the vector map of PTS-mKate2; Figure 2 It is the localization map of pBWA(V)-PTS-mKate2 in Nicotiana benthamiana epidermal cells; Figure 3 It is the localization map of PTS-AtActin2 -mKate2 in tobacco epidermal cells; Figure 4 It is the localization map of PTS1-AtActin2 -mKate2 in tobacco epidermal cells. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0018] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts belong to the scope of protection of the present invention.
[0019] Example 1 The present invention provides a method for improving the peroxisome localization specificity, comprising the following steps: S1, fusing and expressing the peroxisome N-terminal localization sequence PTSp and the type I signal peptide PTS1 with the target gene by homologous cloning to obtain a PTSp-PTS1-target gene fusion construct. The specific method is as follows: 1) Synthesize the N-terminal localization sequence PSTp by total gene synthesis, which is synthesized by General Biosystems Co., Ltd.
[0020] The nucleotide sequence of PSTp is: ATGGATCGCGCCCGCCTCGCCGTGCTCTCCGC CCACCTCGCCTCCCCCGCCGCCGCCTGCGGGGAGGCGGACGCGGCGGGGCCGCTGGAGAGGTCGGCGGCGTCTGCGGGGGCGCGAGGCGGCGCGCTGGCGGTGGTGGATGGGAGGACGGGGAAGAGGTACGAGGTCAAGGTGTCGGACGAGGGGACCGTGCGCGCCACCGACTTCAAGAAGATTACCACTGGAAAGGACGACAAGGGTCTTAAGATCTATGATCCTGGTTATCTCAACACAGCCCCAGTTCGCTCATCCATCTGCTAC. (SEQ ID No.1) The nucleotide sequence of PTS1 is: TCTGCCCTGTGA. (SEQ ID No.2) The nucleotide sequence of mKate2 is: GTGAGCGAGCTGATTAAGGAGAACATGCAC ATGAAGCTGTACATGGAGGGCACCGTGAACAACCACCACTTCAAGTGCACATCCGAGGGCGAAGGCAAGCCCTACGAGGGCACCCAGACCATGAGAATCAAGGCGGTCGAGGGCGGCCCTCTCCCCTTCGCCTTCGACATCCTGGCTACCAGCTTCATGTACGGCAGCAAAACCTTCATCAACCACACCCAGGGCATCCCCGACTTCTTTAAGCAGTCCTTCCCCGAGGGCTTCACATGGGAGAGAGTCACCACATACGAGGACGGGGGCGTGCTGACCGCTACCCAGGACACCAGCCTCCAGGACGGCTGCCTCATCTACAACGTCAAGATCAGAGGGGTGAACTTCCCATCCAACGGCCCTGTGATGCAGAAGAAAACACTCGGCTGGGAGGCCTCCACCGAAACCCTGTACCCCGCTGACGGCGGCCTGGAAGGCAGAGCCGACATGGCCCTGAAGCTCGTGGGCGGGGGCCACCTGATCTGCAACTTGAAAACCACATACAGATCCAAGAAACCCGCTAAGAACCTCAAGATGCCCGGCGTCTACTATGTGGACAGAAGGCTGGAAAGAATCAAGGAGGCCGACAAAGAAACCTACGTCGAGCAGCACGAGGTGGCTGTGGCCAGATACTGCGACCTCCCTAGCAAACTGGGGCACAGA. (SEQ ID No.3) 2) Design recombinant primers according to the sequence
[0021] 3) Amplification of the target fragment Amplify the target gene using the following PCR system and procedure.
[0022] Amplification system: 20 μL of Nuclease-free water, 25 μL of Pfu PCR MIX, 2 μL of upstream primer F, 2 μL of downstream primer R, 1 μL of template (pBWA(V)HS-mKate2 plasmid, PTSp nucleotide sequence), a total of 50 μL.
[0023] AtActin2 (At3g18780) was amplified from the cDNA of Columbia wild-type Arabidopsis thaliana as an example gene sequence.
[0024] Amplification procedure: 5 min at 94 °C, 30 sec at 94 °C, 45 sec at 50 °C, 20 sec at 72 °C, 30 cycles, 10 min at 72 °C.
[0025] Perform electrophoresis on a 1.5% agarose gel, cut and recover the electrophoretic fragments under ultraviolet light. The recovery procedure was carried out according to the operation of the DNA gel recovery kit (Axygen). Finally, recover the DNA with 30 μL of water.
[0026] 4) Enzyme digestion of the vector Using the plasmid of pBWA(V)HS-mKate2 as the vector (SEQ ID No.5), perform double enzyme digestion with Eco31 Ⅰ and Apa Ⅰ. The enzyme digestion system was 12 μL of Nuclease-free water, 2 μL of 10×Buffer, 1 μL each of Eco31 Ⅰ and Apa Ⅰ, 4 μL of vector, a total of 20 μL. Digest at 37 °C for 1 h. Purify and recover the enzyme digestion products using the DNA gel recovery kit (Axygen) for recombinant reaction.
[0027] 5) Vector construction Using the BioRun Seamless Cloning Kit (#RDA01), the target fragment was ligated with the linear vector. The reaction system was as follows: 5 μL of linear vector, 5 μL of target fragment, and 10 μL of Biorun 2×EasyClone Mix, for a total of 20 μL. The reaction system was ligated at 37 °C for 1 h. Then, 5 μL of the ligation product was added to 50 μL of Escherichia coli DH5α competent cells melted on ice. After gently mixing, it was left standing on ice for 30 min, heat shocked in a 42 °C water bath for 45 sec, and quickly left standing on ice for 2 min without shaking. 700 μL of LB liquid medium without antibiotics (tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L) was added to the centrifuge tube. After mixing, it was recovered at 37 °C and 200 rpm for 1 h. The transformed competent cells were evenly spread on a petri dish containing LB solid medium with kanamycin (containing 15 g / L of agar), and cultured inverted at 37 °C for 12 h. Positive monoclonal colonies were screened for sequencing identification. The plasmid map of the PTS-mKate2 vector is as shown in Figure 1 shown.
[0028] The recombinant vector pBWA(V)-PTS-mKate2 was obtained by replacing the small fragment between the Eco31 Ⅰ and Apa Ⅰ restriction enzyme recognition sites of pBWA(V)HS-mKate2 with the DNA fragments of PTSp, mKate2, and PTS1, while keeping the other nucleotide sequences unchanged.
[0029] S2. The fusion construct was transformed into Agrobacterium. The specific method was as follows: The constructed vector plasmid was added to Agrobacterium (GV3101) melted on ice. After gently mixing, it was left standing on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and in an ice bath for 5 min. 700 μL of YEB liquid medium without antibiotics (yeast extract 1 g / L, beef extract 5 g / L, peptone 5 g / L, sucrose 5 g / L, MgSO4•7H2O 0.5 g / L, pH = 7.0) was added to the centrifuge tube. After mixing, it was recovered at 28 °C and 200 rpm for 2 h. The transformed competent cells were evenly spread on YEB solid medium containing kanamycin (containing 15 g / L of agar), and cultured inverted at 28 °C for 2 d. Positive clones were picked and inoculated into 10 mL of YEB liquid medium containing kanamycin, cultured overnight at 170 rpm / min, centrifuged at 4000 rpm / min for 4 min, and the supernatant was discarded. The cells were resuspended with a suspension of 10 mM MgCl2 (containing 120 μL of AS, acetosyringone), and the OD 600 was adjusted to about 0.6.
[0030] S3. The transformed Agrobacterium was injected into the plant leaves using an Agrobacterium-mediated transient transformation system.
[0031] Select tobacco plants with good growth conditions, and inject the transformed Agrobacterium tumefaciens into the lower epidermis of tobacco leaves using a 1 mL syringe without a needle. After culturing the injected tobacco plants under low light for 2 days, observation can be carried out.
[0032] S4. Perform fluorescence imaging using a laser confocal microscope to detect the specific localization of the target gene in peroxisomes of plant cells.
[0033] Take the tobacco leaves injected with Agrobacterium tumefaciens, make them into temporary slides, and observe and photograph them under a laser confocal microscope (Olypus FV3000). The localization results are as Figure 2 、 Figure 3 shown.
[0034] Figure 2 It is the localization map of pBWA(V)-PTS-mKate2 in Nicotiana benthamiana epidermal cells. From left to right in the picture are the localization maps of pBWA(V)-eGFP in tobacco epidermal cells, which are green signals in the figure; the localization map of pBWA(V)-PTS-mKate2, which are red signals in the figure; the localization map of chloroplasts, which are purple in the figure; the bright-field map of tobacco epidermal cells; and the overlay field map.
[0035] It can be found that the fluorescence signal of pBWA(V)-PTS-mKate2 does not overlap with the fluorescence of pBWA(V)-eGFP and chloroplasts. The method of this example can introduce the red fluorescent protein mKate2 into peroxisomes and can be observed in living cells, saving time and effort and facilitating the study of protein functions. Furthermore, the generated pBWA(V)-PTS-mKate2 expression cassette can be effectively used for peroxisome localization.
[0036] Figure 3 Shown is an application example of the plant peroxisome localization expression cassette. From left to right in the picture are the localization maps of AtActin2 in tobacco epidermal cells, which are red signals in the figure; the localization map of chloroplasts, which are purple in the figure; the bright-field map of tobacco epidermal cells; and the overlay field map.
[0037] AtActin2 itself is a protein localized in the cytoplasm, as Figure 3 shown above. From the PTS-AtActin2-mKate2 localization map, it can be seen that the red signal disappears from the cytoplasm and shows a granular structure, which is a characteristic of peroxisomes and does not overlap with the chloroplast localization signal (purple), indicating that AtActin2 is specifically localized to peroxisomes, as Figure 3 shown below.
[0038] In summary, the Arabidopsis gene AtActin2 (At3g18780) was originally localized in the cytoplasm ( Figure 3 red signal above), but when it was linked to the peroxisome localization sequence, the red signal in the cytoplasm disappeared, and a large number of granular fluorescences appeared instead, which did not overlap with the chloroplast fluorescence signal, indicating that AtActin2 was specifically localized in peroxisomes ( Figure 3 below).
[0039] Figure 4 The following shows the localization example in tobacco epidermal cells containing only the type I signal peptide PTS1 and the target gene. From left to right in the picture are the localization maps of tobacco epidermal cells containing only PTS1 and AtActin2, which are red signals in the figure; the chloroplast localization map, which is purple in the figure; the bright-field map of tobacco epidermal cells; and the overlay field map.
[0040] Figure 4 In the overlay field map, in addition to the red granular signal, there are other red fluorescence signals, indicating that AtActin2 was not completely guided into peroxisomes but still remained in the cytoplasm.
[0041] Thus, when only PTS1 is present, the AtActin2 protein is still widely distributed throughout the cytoplasm in the form of a red signal. This indicates that AtActin2 was not specifically localized in peroxisomes, thus proving that the peroxisome N-terminal localization sequence PTSp of this application can significantly improve the specificity of peroxisome localization.
[0042] The above is only the preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A method for improving the specificity of peroxisome localization, characterized in that: It includes the following steps: S1, fusing and expressing the peroxisomal N-terminal targeting sequence PTSp and type I signal peptide PTS1 with nucleotide sequences as shown in SEQ ID No.1 with the target gene through homologous cloning to obtain a PTSp-target gene-PTS1 fusion construct; S2, transforming the fusion construct into Agrobacterium tumefaciens; S3, injecting the transformed Agrobacterium tumefaciens into plant leaves using an Agrobacterium-mediated transient transformation system; S4, performing fluorescence imaging using a laser confocal microscope to detect the specific localization of the target gene in peroxisomes of plant cells.
2. The method for improving the peroxisome localization specificity according to claim 1, wherein: In step S1, the nucleotide sequence of the type I signal peptide PTS1 is as shown in SEQ ID No.
2.
3. The method for improving the peroxisome localization specificity according to claim 1, wherein: In step S1, the target gene is an exogenously introduced transgene or an endogenous gene, and its expression product is a protein or polypeptide.
4. The method for improving the peroxisome localization specificity as described in claim 3, wherein: The target genes are selected as the red fluorescent protein mKate2 and actin AtActin2.
5. A fusion gene construct for enhancing the specificity of peroxisome localization, characterized in that, It contains the peroxisomal N-terminal targeting sequence PTSp, type I signal peptide PTS1 and target gene described in claim 1.
6. The fusion gene construct according to claim 5, characterized in that, The target genes are the red fluorescent protein mKate2 and actin AtActin2.
7. An expression cassette for improving the specificity of peroxisome localization, characterized in that, It contains the fusion gene construct described in claim 5 or 6.
8. Use of the fusion gene construct according to any one of claims 5-6 or the expression cassette according to claim 7 in plant subcellular localization research.
Citation Information
Patent Citations
A method for the production of plants with altered photorespiration and improved co2 fixation
CA3148934A1
Methods in increasing grain value by improving grain yield and quality
CN102066565A
Angiogenin expression in plants
CN102753011A
Series of plant peroxisome type 1 core signal peptides PTS1-3aa
CN118652313A
Recombination tyrosine kinase expressed in pichia yeast organelle, gene, derivative fusion albumen and preparation method thereof
CN1920015A