ITR deletion detection method

Abstract

The invention relates to a method for detecting deletion in ITR to be detected contained in an AAV vector to be detected. The method comprises the following steps: cutting a fragment containing a sequence of the ITR to be detected from the AAV vector to be detected by using restriction enzyme, detecting the size of the fragment of an enzyme digestion product, and determining whether deletion exists in the ITR to be detected according to the size of the fragment.

Description

[0001] Cross-reference to related applications

[0002] This application claims the priority of a Chinese patent application with the application number 202311851939.4 filed on December 28, 2023, the entire content of which is incorporated herein by reference. Technical Field

[0003] The present invention relates to a nucleic acid detection method, and particularly to a method for detecting ITR deletion in AAV vectors. Background Art

[0004] Gene therapy refers to introducing exogenous genes into target cells to correct diseases caused by gene defects. In recent years, gene therapy has continuously achieved major breakthroughs, bringing hope to patients facing terminal illnesses. Adeno-associated virus (AAV), as a star vector for gene therapy, has attracted much attention. At both ends of the AAV genome are two T-shaped inverted terminal repeats (ITRs). These two ITRs are the starting points for AAV DNA self-replication and signals triggering virus packaging, playing a key role in the virus replication and packaging processes, and participating in the integration and escape processes of the virus genome on the host genome. The CG content in the ITR sequence reaches over 80%, and its sequence can form a T-shaped hairpin structure composed of 2 palindromic arms, 1 long stem palindrome, and a unique 20bp sequence. This structure is highly stable. During the plasmid amplification process using Escherichia coli, deletions often occur in the ITR region of the AAV plasmid. Deletions in different segments of the ITR sequence will all affect AAV production. Currently, the integrity of ITR can be studied through restriction enzyme digestion reactions, but the resolution of gel electrophoresis is relatively low, making it difficult to detect small deletions. Direct sequencing of the ITR region can provide sufficient resolution, but the T-shaped hairpin structure composed of a high GC content and long palindromic sequences (>100bp) will inhibit the polymerase chain reaction in the Sanger sequencing kit, resulting in sequencing failure. Moreover, Sanger sequencing takes a long time. The time for 1 ITR-specific Sanger sequencing is 40h (in the case of successful sequencing once). The ITR-specific sequencing kit can improve the success rate of the sequencing reaction, but often has problems such as double peaks and low peak heights, making the sequencing results inaccurate. Moreover, ITR-specific sequencing cannot quantify the ITR deletions in some molecules in the sample. If 10% of the molecules in a sample have ITR deletions, the ITR-specific results will show that there are no ITR deletions in this sample. ITR-specific sequencing cannot accurately quantify ITR deletions. Summary of the Invention

[0005] The present invention provides a method for detecting deletions in a test ITR contained in a test AAV vector, the method comprising cutting a fragment containing the sequence of the test ITR from the test AAV vector using a restriction endonuclease, detecting the fragment size of the digestion product, and determining whether a deletion exists in the test ITR based on the fragment size.

[0006] In some embodiments, the cleavage sites of the restriction endonuclease are located at both ends of the test ITR, and at a position inside the test ITR and close to the ITR boundary and / or at a position outside the test ITR and close to the ITR boundary, wherein the position inside the test ITR and close to the ITR boundary means that the distance between the cleavage site and the nearer end boundary of the two boundaries of the ITR does not exceed 40 nucleotides, and the position outside the test ITR and close to the ITR boundary means that the distance between the cleavage site and the nearer end boundary of the two boundaries of the ITR does not exceed 100 nucleotides.

[0007] In some embodiments, the length of the fragment containing the sequence of the test ITR is between 100-250 bp.

[0008] In some embodiments, the sequence of the test ITR contains at least 70%, at least 80%, at least 90% or 100% of the full-length sequence of the ITR.

[0009] In some embodiments, the sequence of the test ITR contains at least the B, B', C and C' regions.

[0010] In some embodiments, taking the fragment containing the sequence of the complete ITR generated by digesting the AAV vector containing the complete ITR with the restriction endonuclease as a reference fragment, if the digestion product of the test AAV vector includes a fragment with a length less than that of the reference fragment, it indicates that a deletion exists in the test ITR; if the digestion product of the test AAV vector does not include a fragment with a length less than that of the reference fragment, it indicates that no deletion exists in the test ITR. In some embodiments, for the fragment with a length less than that of the reference fragment, its length is 20-30 bp smaller than that of the reference fragment.

[0011] In some embodiments, the test AAV vector contains two ITRs, and the two ITRs are inverted complementary or non-inverted complementary in the case of no deletion.

[0012] In some embodiments, the restriction endonuclease includes one restriction endonuclease or two restriction endonucleases.

[0013] In some embodiments, the method further includes quantifying the deletion rate and / or integrity rate of a test ITR in a test AAV vector, the quantification including detecting the molar concentration of a fragment containing the sequence of the test ITR in the digestion product, wherein a fragment with a length less than the reference fragment is a fragment containing the sequence of the deleted ITR, and a fragment with a length substantially equal to the reference fragment is a fragment containing the sequence of the intact ITR, using the fragment containing the sequence of the intact ITR generated after digestion of the AAV vector containing the intact ITR with the restriction endonuclease as the reference fragment, and calculating the deletion rate and / or integrity rate of the test ITR according to the following formula:

[0014] Deletion rate of test ITR = molar concentration of fragment containing the sequence of the deleted ITR / (molar concentration of fragment containing the sequence of the deleted ITR + molar concentration of fragment containing the sequence of the intact ITR) * 100%;

[0015] Integrity rate of test ITR = 1 - deletion rate of test ITR.

[0016] In some embodiments, the method further includes quantifying the deletion rate and / or integrity rate of a test ITR in a test AAV vector, wherein the test AAV vector contains two ITRs, and the sequences thereof are such that only one restriction endonuclease can be used to cut off fragments containing the sequences of each of the two ITRs respectively, the quantification including detecting the molar concentration of a fragment containing the sequences of all the ITRs in the digestion product, wherein a fragment with a length less than the reference fragment is a fragment containing the sequence of the deleted ITR, and a fragment with a length substantially equal to the reference fragment is a fragment containing the sequence of the intact ITR, using the fragment containing the sequence of the intact ITR generated after digestion of the AAV vector containing the intact ITR with the restriction endonuclease as the reference fragment, and calculating the deletion rate and / or integrity rate of a test ITR according to the following formula:

[0017] Deletion rate of test ITR = molar concentration of fragment containing the sequence of the deleted ITR / [(molar concentration of fragment containing the sequence of the deleted ITR + molar concentration of fragment containing the sequence of the intact ITR) / 2] * 100%;

[0018] Integrity rate of test ITR = 1 - deletion rate of test ITR.

[0019] In some embodiments, an Agilent DNA 1000 quantification detection kit is used to detect the fragment length, an Agilent 2100 bioanalyzer is used to detect the fragment length and molar concentration, and / or capillary electrophoresis (CGE) is used to detect the fragment length or molar concentration. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1: Results of the ITR sequence digested by the same restriction endonuclease detected by the Agilent 2100 Bioanalyzer.

[0021] Figure 2 : Partially enlarged results of the ITR sequence digested by the same restriction endonuclease detected by the Agilent 2100 Bioanalyzer.

[0022] Figure 3 : Results of the ITR1 sequence digested by different restriction endonucleases detected by the Agilent 2100 Bioanalyzer.

[0023] Figure 4 : Results of the ITR2 sequence digested by different restriction endonucleases detected by the Agilent 2100 Bioanalyzer.

[0024] Figure 5 : Results diagram of the ITR detected by Sanger sequencing; (This diagram is the result of Sanger sequencing of the ITR sequence in Example 1. The ITR position is 75 - 188. After the sequencing reaction enters the ITR hairpin sequence, the signal drops suddenly and disappears. The ITR hairpin structure causes the sequencing reaction to terminate prematurely, and the ITR sequence cannot be sequenced through.)

[0025] Figure 6 : Results diagram of the ITR detected by ITR - specific Sanger sequencing. (This diagram is the result of sequencing the ITR sequence in Example 1 using an ITR - specific kit. The ITR position is 75 - 188. This method first performs RCA normal - temperature amplification on the sample to open the ITR hairpin, and then performs Sanger sequencing. The success rate of this method for one - time sequencing is about 50%. The resolution of this method is low, and it cannot detect deletions within 10% of the molecules in the sample. Moreover, this method will result in double peaks and high bottom peaks, making the sequencing results inaccurate.) Detailed implementation mode

[0026] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0027] All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In case of conflict, the present specification (including definitions) shall prevail. Additionally, the materials, methods, and examples described herein are illustrative only and not intended to be limiting.

[0028] When the terms "about" and "approximate" are used in conjunction with numerical variables, they generally mean that the value of the variable and all values of the variable are within the measurement or experimental error (e.g., 95% confidence interval of the mean) or within a wider range of the specified value (e.g., ±5% or ±10%).

[0029] The term "comprising" or its variants such as "containing", "having", "including" means including the stated steps or elements, but not excluding any other steps or elements. "Consisting of" means not including steps or elements not listed. "Consisting essentially of" means not excluding steps or elements that do not materially affect the basic and novel features of the claimed invention. The term "comprising" a particular step or element and its variants also includes the cases of "consisting of" the particular step or element and "consisting essentially of" the particular step or element.

[0030] When referring to a numerical range, it should be regarded as specifically disclosing the specific values of its upper and lower limits, as well as all intermediate ranges included therein, such as the intermediate range between its upper or lower limit and any intermediate value, or the intermediate range between any two of its intermediate values. And, any intermediate range, sub-range, and all individual numerical values described in the said numerical range may be excluded from the said numerical range.

[0031] The term "and / or" should be understood as meaning any one or any combination of several elements connected by this term.

[0032] In the present invention, "nucleotide" and "base" can be used interchangeably and are usually represented by conventional single letters, where A is deoxyadenosine monophosphate or adenosine monophosphate, C is deoxycytidine monophosphate or cytidine monophosphate, G is deoxyguanosine monophosphate or guanosine monophosphate, and T is thymidine monophosphate.

[0033] Unless otherwise specified, in this article, nucleic acids are written from left to right in the 5' to 3' direction, and amino acid sequences are written from left to right in the direction from the amino terminus to the carboxyl terminus.

[0034] The inventor of the present invention sequenced AAV plasmid samples produced by different strains such as JM108, Stble, EPI300, DH10B, GT115, top10, and Stable3 using an ITR-specific kit, and counted 238 successfully sequenced samples (samples with unsequenced or unsuccessful ITR sequences were not counted). Among them, 20 samples were ITR-deleted samples, and all these 20 deletions were 20-30 bp deletions, without deletions shorter than 20 bp. Therefore, it can be concluded that more than 95% of the samples with ITR deletions are 20-30 bp deletions, and the deleted regions are all in the T-shaped hairpin regions of B, B', and / or C, C' of the ITR. To solve the problem that ITR-specific sequencing cannot quantify ITR deletions and shorten the detection time, the present invention provides a method for detecting the ITR deletion rate, which can accurately detect the ITR deletion rate of AAV plasmids through relatively simple steps. The detection time can be shortened to 2 h, the success rate of detecting the ITR integrity is 19 / 19, and it can accurately quantify the ITR deletions of some molecules in the sample.

[0035] An AAV plasmid contains 2 ITRs. Since the ITR can form a highly stable secondary structure, when constructing an ITR plasmid, restriction enzyme cleavage sites will be added at both ends of the ITR to facilitate sequence assembly and verification. Restriction endonucleases can cut off the ITRs on the AAV plasmid, separating the sequences containing the ITRs from the other sequences of the plasmid, and the sizes and molar concentrations of all sequences in the enzyme digestion products are detected using an Agilent 2100 bioanalyzer. For some AAV plasmids, the restriction enzyme cleavage sites at both ends of the ITRs are the same, and the two ITRs can be digested with the same enzyme, and each AAV plasmid requires 1 enzyme digestion reaction; for some AAV plasmids, the restriction enzyme cleavage sites at both ends of the ITRs are different, and different ITRs need to be digested with different enzymes, and each AAV plasmid requires 2 enzyme digestion reactions. The analysis range of the Agilent DNA 1000 quantification detection kit is 25–

[0036] 1000 bp. When the fragment length is 25–100 bp, the resolution of this kit is ±5 bp; when the fragment length is 100–500 bp, the resolution of this kit is ±5%. The length of the sequence cut off containing the ITR is generally between 100-250 bp. When the cut-off length is 250 bp, the resolution of the kit is ±12.5 bp. The palindromic arm region of the ITR is most prone to deletion, and the deleted ITR is generally 20-30 bp shorter than the complete ITR. Therefore, the Agilent DNA 1000 quantification detection kit can be used to detect the integrity of the ITR, determine which sequence is the complete ITR and which sequence is the deleted ITR based on the sequence length, and then calculate the deletion rate and integrity rate of the ITR according to the molar concentration.

[0037] Based on the above findings, the present invention provides a method for detecting ITR deletion in an AAV vector, the method comprising cutting a fragment containing the sequence of the ITR from the AAV vector using a restriction endonuclease, detecting the fragment size of the digestion product, and determining whether there is a deletion in the ITR according to the fragment size. The AAV vector to be detected may be referred to herein as the "AAV vector to be tested".

[0038] The term "AAV vector" refers to a vector that contains a polynucleotide of interest or its expression cassette, or a site that can be used to insert a polynucleotide of interest or its expression cassette, and is flanked by AAV inverted terminal repeats (ITRs) at the 5' and 3' ends of the polynucleotide of interest or its expression cassette or the site that can be used to insert the polynucleotide of interest or its expression cassette. Such an AAV vector can be replicated and packaged into infectious virus particles when present in a host cell that has been transfected with a vector encoding and expressing the rep and cap gene products. In some embodiments, the AAV vector is a recombinant AAV vector (rAAV vector), which includes an AAV vector that does not belong to the polynucleotide sequence of AAV origin (i.e., the polynucleotide of interest). In some embodiments, the AAV vector is an AAV plasmid. In some embodiments, the AAV vector is an AAV vector amplified in Escherichia coli.

[0039] The term "ITR" or "inverted terminal repeat" refers to a region recognized in the art found at the 5' and 3' ends of the AAV genome, which functions in cis as an origin of DNA replication and as a packaging signal for the viral genome. Typically, one ITR of AAV contains regions A, B, B', C, C', A' and D, forming three palindromic structures. B and B', C and C' are reverse complementary to form two palindromic arms, which constitute the top of the T-shaped hairpin structure. A and A' are reverse complementary to form a long-stem palindromic structure, which together with region D constitutes the stem of the T-shaped structure.

[0040] In the present invention, the AAV vector contains at least one ITR, which is located at one end of the polynucleotide of interest or its expression cassette, or at one end of the site that can be used to insert the polynucleotide of interest or its expression cassette. In some embodiments, the AAV vector contains at least a pair of ITRs, which are respectively located at both ends of the polynucleotide of interest or its expression cassette, or at both ends of the site that can be used to insert the polynucleotide of interest or its expression cassette. In some embodiments, the AAV vector may contain two pairs of ITRs or more pairs of ITRs. In some embodiments, any pair of ITRs among the one or more pairs of ITRs contained in the AAV vector may be arranged in the same direction or in the opposite direction. In some embodiments, the AAV vector contains two paired ITRs. In some embodiments, the two paired ITRs are arranged in the same direction or in the opposite direction.

[0041] The term "ITR deletion" or "deletion" refers to the deletion of a part of the base sequence of at least one ITR contained in the AAV vector relative to the complete ITR.

[0042] In this article, the term "complete ITR" may also be referred to as "parental ITR", which is the ITR used for comparison with the deleted ITR. The term "complete ITR" may refer to the ITR that is desired to be used in the AAV vector. Generally, when preparing the AAV vector, the initially designed and constructed AAV vector contains the ITR that is desired to be used, but the ITR may be deleted after amplification. It should be understood that in this article, the term "complete ITR" is relative to the ITR deletion to be detected, and does not mean that it necessarily contains all the sequences of the typical AAV ITR. In some embodiments, the complete ITR may be a wild-type AAV ITR, or it may be a mutant thereof, such as a mutant obtained by insertion, substitution, and / or deletion of one or more nucleotides from the wild-type AAV ITR, including but not limited to the AAV ITR mutant lacking the D region. In some embodiments, the complete ITR contains at least the B, B', C, and C' regions. In some embodiments, the complete ITR contains at least the A, B, B', C, C', and A' regions. In some embodiments, the complete ITR contains all the sequences of the typical AAV ITR, which contains the A, B, B', C, C', A', and D regions. In some embodiments, the complete ITR consists of 145 bases.

[0043] In some embodiments, the complete ITR can be from various AAV serotypes, including but not limited to AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, murine AAV, and ovine AAV.

[0044] The term "deleted ITR" refers to an ITR that is missing a portion of the base sequence relative to the complete ITR. In some embodiments, the length of the base sequence missing from the deleted ITR relative to the complete ITR can be 20 - 30 nucleotides. In some embodiments, the missing base sequence is located in the B, B’, C, and / or C’ regions of the ITR.

[0045] The methods of the present invention can be used to detect the presence of deletions in each ITR contained in an AAV vector. The ITR to be detected can be referred to herein as the "ITR to be tested". Depending on the number of ITRs contained in the AAV vector, the AAV vector can include one, two, or more ITRs to be tested. In some embodiments, two or more ITRs to be tested in the AAV vector can be detected simultaneously by a single digestion reaction. In some embodiments, a single digestion reaction can detect one ITR to be tested, and two or more ITRs to be tested are detected by two or more digestion reactions, respectively.

[0046] In some embodiments, the method of the present invention uses an AAV vector containing a complete ITR as a reference AAV vector. The term "AAV vector containing a complete ITR" refers to a vector in which the sequences of the non-ITR parts are the same as those of the AAV vector to be tested, and the ITR part is a complete ITR. In some embodiments, the "AAV vector containing a complete ITR" may refer to the AAV vector before amplification, and the AAV vector to be tested refers to the AAV vector after amplification of the AAV vector containing the complete ITR. In some embodiments, the amplification may be carried out in Escherichia coli. In some embodiments, the amplification is one round or more rounds of amplification. It should be understood that the number and arrangement of ITRs in the AAV vector containing the complete ITR are the same as those in the AAV vector to be tested. In some embodiments, the AAV vector containing the complete ITR contains at least one ITR at one end of the polynucleotide of interest or its expression cassette, or at one end of the site available for inserting the polynucleotide of interest or its expression cassette. In some embodiments, the AAV vector containing the complete ITR contains at least a pair of ITRs, which are respectively located at both ends of the polynucleotide of interest or its expression cassette, or at both ends of the site available for inserting the polynucleotide of interest or its expression cassette. In some embodiments, the AAV vector containing the complete ITR may contain two pairs of ITRs or more pairs of ITRs. In some embodiments, any pair of ITRs in the one or more pairs of ITRs contained in the AAV vector containing the complete ITR may be arranged in the same direction or in the opposite direction. In some embodiments, the AAV vector containing the complete ITR contains two pairs of paired ITRs. In some embodiments, the two pairs of paired ITRs are arranged in the same direction or in the opposite direction. In some embodiments, any pair of ITRs in the one or more pairs of complete ITRs contained in the AAV vector containing the complete ITR may be reverse complementary or non-reverse complementary to each other.

[0047] The term "restriction endonuclease" may also be referred to as "restriction enzyme", which refers to an enzyme that can recognize a specific nucleotide sequence and cleave the nucleotide sequence at a specific site. A variety of restriction endonucleases are well known to those skilled in the art, and the recognition sequences and cleavage sites of different restriction endonucleases can be easily obtained, for example, from the website of NEB (New England Biolabs).

[0048] In the method of the present invention, the AAV vector to be tested is digested with a restriction endonuclease to generate a fragment containing the ITR sequence, and whether there is an ITR deletion in the AAV vector is determined according to the length of the fragment.

[0049] The restriction endonuclease can cut at both ends of the ITR to be tested (i.e., cut at each of the two ends of the ITR to be tested), so as to cut off the sequence of the ITR to be tested from the AAV vector to be tested. The digestion product includes a fragment containing the sequence of the ITR to be tested.

[0050] Taking the fragment containing the sequence of the complete ITR generated after digestion of the AAV vector containing the complete ITR by the restriction endonuclease as a reference fragment, if the digestion product of the AAV vector to be tested includes a fragment with a length shorter than the reference fragment, it indicates that there is a deletion in the ITR to be tested; if the digestion product of the AAV vector to be tested does not include a fragment with a length shorter than the reference fragment, it indicates that there is no deletion in the ITR to be tested. At this time, the digestion product should include a fragment with a length substantially equal to the reference fragment. The fragment with a length shorter than the reference fragment in the digestion product is a fragment containing the sequence of the ITR with a deletion, and the fragment with a length substantially equal to the reference fragment is a fragment containing the sequence of the complete ITR.

[0051] The term "substantially equal" when used to describe the length of a nucleic acid sequence means that the lengths of the two nucleic acid sequences connected by this term are exactly equal, or differ by no more than 5 nucleotides or base pairs, or differ by no more than 2% of the nucleotides or base pairs of the full length of the longer nucleic acid sequence.

[0052] It should be understood that only a part of the ITRs to be tested in the AAV vector to be tested may have deletions. Therefore, the fragments containing the sequences of the ITRs to be tested in the digestion product may include fragments of different lengths, among which some fragments contain the sequences of the complete ITRs, and some other fragments contain the sequences of the ITRs with deletions. In this case, the digestion product includes both fragments with a length shorter than the reference fragment and fragments with a length substantially equal to the reference fragment.

[0053] The cleavage positions of the restriction endonuclease at both ends of the ITR to be tested can be positions within the ITR to be tested and close to the ITR boundary, or positions outside the ITR (i.e., in other sequences in the AAV vector other than the ITR to be tested) and close to the ITR boundary. In some embodiments, the cleavage positions of the restriction endonuclease at both ends of the ITR to be tested can be that the cleavage positions at both ends are within the ITR to be tested and close to the ITR boundary, or the cleavage positions at both ends are outside the ITR and close to the ITR boundary, or the cleavage position at one end is within the ITR to be tested and close to the ITR boundary, while the cleavage position at the other end is outside the ITR to be tested and close to the ITR boundary. Therefore, the "fragment containing the sequence of the ITR to be tested" in the cleavage product can contain the full-length sequence of the ITR to be tested or a part of its sequence, such as a sequence containing at least 70%, at least 80%, at least 90% or 100% of the full length of the ITR. In some embodiments, the "fragment containing the sequence of the ITR to be tested" in the cleavage product contains at least the entire sequences of the B, B', C, and C' regions of the ITR to be tested.

[0054] "The position within the ITR to be tested and close to the ITR boundary" herein means that the distance between the cleavage position and the closer end boundary of the two boundaries of the ITR does not exceed 40 nucleotides, does not exceed 30 nucleotides, does not exceed 20 nucleotides or does not exceed 10 nucleotides, for example, it can be within the range of 0 - 30 nucleotides, within the range of 0 - 20 nucleotides or within the range of 10 - 30 nucleotides.

[0055] "The position outside the ITR to be tested and close to the ITR boundary" herein means that the distance between the cleavage position and the closer end boundary of the two boundaries of the ITR does not exceed 100 nucleotides, does not exceed 90 nucleotides, does not exceed 80 nucleotides, does not exceed 70 nucleotides, does not exceed 60 nucleotides, does not exceed 50 nucleotides, does not exceed 40 nucleotides, does not exceed 30 nucleotides, does not exceed 20 nucleotides or does not exceed 10 nucleotides, for example, it can be within the range of 0 - 60 nucleotides, within the range of 0 - 30 nucleotides, within the range of 0 - 20 nucleotides, within the range of 10 - 60 nucleotides or within the range of 10 - 30 nucleotides.

[0056] In some embodiments, the length of the fragment containing the sequence of the ITR to be tested in the digestion product does not exceed 450 bp, does not exceed 400 bp, does not exceed 350 bp, does not exceed 300 bp, or does not exceed 250 bp. In some embodiments, the length of the fragment to be tested containing the ITR region to be tested is not less than 80 bp, not less than 90 bp, not less than 100 bp, not less than 110 bp, not less than 120 bp, not less than 130 bp, not less than 140 bp, not less than 150 bp, not less than 160 bp, not less than 170 bp, not less than 180 bp, not less than 190 bp, not less than 200 bp, not less than 210 bp, or not less than 220 bp. In some embodiments, the length of the fragment to be tested containing the ITR region to be tested is between 80 - 250 bp, between 100 - 250 bp, between 100 - 240 bp, or between 100 - 230 bp.

[0057] In some embodiments, the deleted ITR lacks 20 - 30 nucleotides compared to the complete ITR. Thus, in some embodiments, the fragment containing the sequence of the deleted ITR is 20 - 30 bp shorter than the fragment containing the sequence of the complete ITR. Therefore, in some embodiments, taking the fragment containing the sequence of the complete ITR generated by digesting the AAV vector containing the complete ITR with the restriction endonuclease as the reference fragment, if the digestion product of the AAV vector to be tested includes a fragment whose length is 20 - 30 bp smaller than the reference fragment, it indicates that there is a deletion in the ITR to be tested; if the digestion product of the AAV vector to be tested does not include a fragment whose length is 20 - 30 bp smaller than the reference fragment, it indicates that there is no deletion in the ITR to be tested.

[0058] In some embodiments, there are no additional sites in the sequence containing the ITR to be tested between the restriction enzyme cleavage sites at both ends of the ITR to be tested. In other words, there are no additional sites in the fragment of the sequence containing the ITR to be tested generated by cleavage at both ends of the ITR to be tested by the restriction enzyme that can be cleaved by the restriction enzyme. In some embodiments, the restriction enzyme used only cleaves at both ends of the ITR to be tested, and there are no additional cleavage sites of the restriction endonuclease in other sequences of the AAV vector. In some embodiments, in addition to both ends of the ITR to be tested, the restriction enzyme may also generate cleavage in other ITR sequences of the AAV vector, but it should be understood that such cleavage should not generate fragments with lengths similar to those of the fragments of the sequence containing the ITR to be tested in the digestion products. For example, such cleavage will not generate fragments with lengths not exceeding 450 bp, not exceeding 400 bp, not exceeding 350 bp, not exceeding 300 bp or not exceeding 250 bp, and not less than 80 bp, not less than 90 bp, not less than 100 bp, not less than 110 bp, not less than 120 bp, not less than 130 bp, not less than 140 bp, not less than 150 bp, not less than 160 bp, not less than 170 bp, not less than 180 bp, not less than 190 bp, not less than 200 bp, not less than 210 bp or not less than 220 bp, or will not generate fragments with lengths between 80 - 250 bp, between 100 - 250 bp, between 100 - 240 bp or between 100 - 230 bp. In some embodiments, the restriction enzyme is selected such that in the digestion products of the AAV vector to be tested by the restriction enzyme pair, the fragments with lengths not exceeding 450 bp, not exceeding 400 bp, not exceeding 350 bp, not exceeding 300 bp or not exceeding 250 bp, and not less than 80 bp, not less than 90 bp, not less than 100 bp, not less than 110 bp, not less than 120 bp, not less than 130 bp, not less than 140 bp, not less than 150 bp, not less than 160 bp, not less than 170 bp, not less than 180 bp, not less than 190 bp, not less than 200 bp, not less than 210 bp or not less than 220 bp are all fragments of the sequence containing the ITR to be tested. In some embodiments, the restriction enzyme is selected such that in the digestion products of the AAV vector to be tested by the restriction enzyme, the fragments with lengths between 80 - 250 bp, between 100 - 250 bp, between 100 - 240 bp or between 100 - 230 bp are all fragments of the sequence containing the ITR to be tested. Therefore, by selecting the restriction enzyme, it is easy to determine which fragments in the digestion products are fragments of the sequence containing the complete ITR and which fragments are fragments of the sequence containing the deleted ITR according to the fragment sizes of the digestion products.

[0059] Specific restriction enzymes can be selected according to the specific sequence of the AAV vector so that the restriction enzymes can cut at both ends of the ITR to be tested, generating a fragment containing the sequence of the ITR to be tested. The number of restriction enzymes used to detect a sequence of an ITR to be tested can be one or two.

[0060] In some embodiments, when there are the same restriction enzyme recognition and cleavage sites at both ends of an ITR to be tested that can be recognized and cleaved by a specific restriction enzyme, only this one restriction enzyme can be used to achieve cleavage at both ends of the ITR to be tested. In some embodiments, the cleavage positions of the one restriction enzyme at both ends of the ITR to be tested can both be within the ITR to be tested and close to the ITR boundary. In some embodiments, the cleavage positions of the one restriction enzyme at both ends of the ITR to be tested can both be outside the ITR to be tested and close to the ITR boundary. In some embodiments, the cleavage positions of the one restriction enzyme at both ends of the ITR to be tested can be that the cleavage position at one end is within the ITR to be tested and close to the ITR boundary, while the cleavage position at the other end is outside the ITR to be tested and close to the ITR boundary.

[0061] In some embodiments, two restriction enzymes can be used to cut both ends of the ITR to be tested respectively, where one restriction enzyme can recognize and cut one end of the ITR to be tested, and the other restriction enzyme can recognize and cut the other end of the ITR to be tested. Simultaneous enzymatic digestion of the AAV vector to be tested with the two restriction enzymes can generate a fragment containing the sequence of the ITR to be tested. In some embodiments, the cleavage positions of the two restriction enzymes at both ends of the ITR to be tested can be outside the ITR to be tested and close to the ITR boundary. In some embodiments, the cleavage positions of the two restriction enzymes at both ends of the ITR to be tested can be within the ITR to be tested and close to the ITR boundary. In some embodiments, the cleavage positions of the two restriction enzymes at both ends of the ITR to be tested can be that the cleavage position at one end is within the ITR to be tested and close to the ITR boundary, while the cleavage position at the other end is outside the ITR to be tested and close to the ITR boundary.

[0062] In some embodiments, the AAV vector to be tested contains two paired ITRs, and these two ITRs can be detected by a single enzymatic digestion, or the two ITRs can be detected separately by two enzymatic digestions. In some embodiments, one or two restriction enzymes can be used for each enzymatic digestion.

[0063] In some embodiments, the two ends of the two ITRs contained in the AAV vector to be tested have the same sequences that can be recognized and cleaved by the same restriction endonuclease. At this time, the same restriction endonuclease can be used to generate cleavages at both ends of these two ITRs in a single digestion, so as to generate fragments respectively containing the sequences of each of the two ITRs to be tested. The type of the restriction endonuclease can be one or two. For example, in some embodiments, both ends of each of the two ITRs have sequences that can be recognized and cleaved by the same restriction endonuclease, and only this one restriction endonuclease can be used to achieve the cleavage at both ends of each of the two ITRs to be tested (a total of four positions), respectively generating fragments containing the sequences of each of the ITRs to be tested. In some embodiments, both of the two ITRs have sequences that can be recognized and cleaved by the same restriction endonuclease at one end, and have sequences that can be recognized and cleaved by another restriction endonuclease at the other end. At this time, these two restriction endonucleases can be used to respectively cleave both ends of the two ITRs to be tested, and the AAV vector to be tested can be digested with the two restriction endonucleases simultaneously, respectively generating fragments containing the sequences of each of the ITRs to be tested.

[0064] In some embodiments, the two paired ITRs contained in the AAV vector cannot be detected by a single digestion using the same restriction endonuclease. At this time, these two ITRs can be detected separately. For one of the ITRs, one or two restriction endonucleases are used to cleave both ends of the ITR as described above, generating a fragment containing the sequence of the ITR. For the other ITR, another one or two restriction endonucleases are used to cleave both ends of the ITR as described above, generating a fragment containing the sequence of the ITR.

[0065] In some embodiments, the restriction endonucleases that can be used include but are not limited to MscI, PacI, NheI, and / or XhoI. In some embodiments, the restriction endonucleases used do not include SmaI, XmaI, and AhdI.

[0066] The method of the present invention can further quantify the ITR deletion rate and / or ITR integrity rate in the AAV vector. The term "ITR deletion rate" refers to the proportion of the sequence deletion for a certain ITR contained in the AAV vector. The term "ITR deletion rate" can refer to the proportion of the AAV vectors with deletions in a certain ITR among all the AAV vectors to be tested in the AAV vector to be tested. "ITR integrity rate" = 1 - ITR deletion rate.

[0067] In some embodiments, the ITR deletion rate is calculated based on the molar concentration of the digestion products generated after digesting the AAV vector with a restriction endonuclease. Specifically, for a certain ITR contained in the AAV vector, the fragment with a length less than the reference fragment in the digestion products is the fragment containing the sequence of the deleted ITR, and the fragment with a length substantially equal to the reference fragment is the fragment containing the sequence of the complete ITR. The ITR deletion rate = the molar concentration of the fragment containing the sequence of the deleted ITR / (the molar concentration of the fragment containing the sequence of the deleted ITR + the molar concentration of the fragment containing the sequence of the complete ITR) * 100%. When the fragment containing the sequence of the ITR to be tested includes a fragment with a length less than the reference fragment, the ITR deletion rate is greater than 0, and the ITR integrity rate is less than 100%. When the fragment containing the sequence of the ITR to be tested does not include a fragment with a length less than the reference fragment and includes a fragment with a length substantially equal to the reference fragment, the ITR deletion rate is equal to 0, and the ITR integrity rate is equal to 100%.

[0068] In some embodiments, when using the same endonuclease (e.g., the same one or two endonucleases) to simultaneously detect two paired ITRs, the ITR deletion rate = the molar concentration of the fragment containing the sequence of the deleted ITR / [(the molar concentration of the fragment containing the sequence of the deleted ITR + the molar concentration of the fragment containing the sequence of the complete ITR) / 2] * 100%, and the ITR integrity rate = 1 - the ITR deletion rate.

[0069] In some embodiments, when using different endonucleases to separately detect two paired ITRs. For any one of the ITRs, the ITR deletion rate = the molar concentration of the fragment containing the sequence of the deleted ITR / [(the molar concentration of the fragment containing the sequence of the deleted ITR + the molar concentration of the fragment containing the sequence of the complete ITR) / 2] * 100%, and the ITR integrity rate = 1 - the ITR deletion rate. The size and molar concentration of the fragment containing the sequence of the ITR to be tested (e.g., the fragment containing the sequence of the deleted ITR and the fragment containing the sequence of the complete ITR) can be determined by a high-resolution nucleic acid detection method. Preferably, the resolution of the high-resolution nucleic acid detection method does not exceed 20 bp, does not exceed 15 bp, or does not exceed 10 bp. The nucleic acid detection method should be able to detect the size of the fragment containing the ITR region. In some embodiments, the nucleic acid detection method can further determine the molar concentration of fragments of different sizes. In some embodiments, the nucleic acid detection method can be to detect the fragment size using an Agilent DNA 1000 quantification detection kit, detect the fragment size and molar concentration using an Agilent 2100 bioanalyzer, or detect the fragment size or molar concentration using capillary electrophoresis (CGE).

[0070] The present invention is further described by the following embodiments, which should not be construed as limiting the present invention.

[0071] The reagents used in the following embodiments are all commercially available products unless otherwise specified. For the molecular biology experimental methods not specifically described in the embodiments, they are all carried out according to the specific methods listed in J. Sambrook, Molecular Cloning: A Laboratory Manual, Third Edition, or according to the kits and product instructions.

[0072] Example 1 Study on the position and length of ITR deletion fragments

[0073] ITR-specific kit sequencing was performed on AAV2 plasmid samples produced by different strains such as JM108, Stble, EPI300, DH10B, GT115, top10, and Stable3. A total of 238 successfully sequenced samples were counted (samples with unsequenced or unsuccessful ITR sequences were not counted). The results are shown in Table 1 below. Among them, 20 samples were ITR-deleted samples, and all these 20 deletions were 20 - 30 bp deletions, without deletions shorter than 20 bp. Therefore, it can be concluded that more than 95% of the samples with ITR deletions are 20 - 30 bp deletions, and the deleted regions are all in the T-shaped hairpin regions of B, B', and / or C, C' of ITR.

[0074] Table 1 ITR deletion lengths in different strains

[0075]

[0076]

[0077] Example 2 Digesting the ITR sequence with the same restriction endonuclease

[0078] In this example, referring to the AAV2 plasmid (containing the complete ITR), there are two reverse complementary ITRs. The specific sequence of the 5' ITR is as follows:

[0079] T TGGCCA CTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGT

[0080] CGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGA GAGGGAG TGGCC AACTCCATCACTAGGGGTTCCT (SEQ ID NO:1), a total of 145 bp. There are two MscI restriction enzyme cleavage sites in each ITR sequence (the underlined sequence is the recognition sequence of MscI), and there is no MscI restriction enzyme cleavage site in the plasmid except for the ITR sequence. Therefore, Msc1 can be used to cut the two ITRs from the plasmid, and the lengths of the two fragments containing the complete ITR sequences obtained are both 117 bp.

[0081] Configure the restriction enzyme reaction system. Add 10 μg of the AAV2 plasmid to be tested, 5 μl of 10× cutsamrt buffer, and 1 μl of MscI to the reaction system, and make up to 50 μl with water to perform restriction enzyme digestion on the plasmid.

[0082] The reaction system is as follows:

[0083] Plasmid 10 μg 10× cutsamrt buffer 5 μl MscI 1 μl <![CDATA[H2O]]> up to 50 μl

[0084] Reaction conditions: 37 °C, 1 h.

[0085] In addition, Sanger sequencing was used to sequence the ITR region, and the sequencing success rate was 0 / 36. The Sanger sequencing results are shown in Figure 5 , and the ITR position is 75 - 188. Using an ITR-specific sequencing kit to sequence the ITR region can improve the success rate of the sequencing reaction, but problems such as double peaks and low peak heights often occur, making the sequencing results inaccurate. The results are shown in Figure 6 , and the ITR position is 75 - 188.

[0086] Example 3 Use different restriction endonucleases to digest the ITR sequence

[0087] In this example, the AAV2 plasmid (containing the complete ITR) has two reverse complementary ITRs. The sequence of one of them is as follows:

[0088] CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGA

[0089] CCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAA CTCCATCACTAGGGGTTCCTTGTAGTTAATGATTA (SEQ ID NO:2), a total of 145 bp. There is no enzyme in the AAV plasmid that can cut the two ITRs at the same time. Different enzymes are selected to cut the 5' ITR (abbreviated as ITR1) and the 3' ITR (abbreviated as ITR2) respectively.

[0090] The sequence of ITR1 and its vicinity is as follows:

[0091] ACGCCAGAT TTAATTAA GGCCTTAATTAGGCTGCGCGCTCGCTCGCTCACTGAGGCC

[0092] GCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCG

[0093] AGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCTTGTAGTTA

[0094] ATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGGAAGATCGGAATTC

[0095] GCCCTTAA GCTAGC TAGTTATTAA(SEQ ID NO:3). Select restriction enzyme sites PacI and NheI (the underlined sequences are their recognition sequences), and the original AAV plasmid can be cut into a 221 bp fragment containing the complete ITR1 sequence, and other fragments of 2798 bp and 2495 bp. The 221 bp fragment containing the complete ITR1 sequence can be analyzed using the Agilent DNA 1000 quantification detection kit.

[0096] ITR2 and the nearby sequences are as follows:

[0097] TGCTGGGGA CTCGAG TTAAGGGCGAATTCCCGATAAGGATCTTCCTAGAGCATGGCT

[0098] ACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAACCCCTAGTGATGG

[0099] AGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAG

[0100] GTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCA

[0101] GCC TTAATTAACCTAATT (SEQ ID NO:4). Select restriction enzyme sites PacI and XhoI (the underlined sequences are their recognition sequences), which can cut the original AAV plasmid into a 223bp fragment containing the complete ITR2 sequence, and other fragments of 2798bp and 2493bp. The 223bp fragment containing the complete ITR2 sequence can be analyzed using the Agilent DNA 1000 quantification detection kit.

[0102] Configure the restriction enzyme reaction system. Add 10 μg of the AAV2 plasmid to be tested, 5 μl of 10× cutsamrt buffer, 1 μl of NheI (or XhoI), and 1 μl of PacI to the reaction system, and make up to 50 μl with water to digest the plasmid.

[0103] The reaction system is as follows:

[0104] Plasmid 10 μg 10× cutsamrt buffer 5 μl NheI (or XhoI) 1 μl PacI 1 μl <![CDATA[H2O]]> up to 50 μl

[0105] Reaction conditions: 37 °C, 1 h.

[0106] Example 4 Detection of the restriction enzyme digestion product by Agilent 2100 bioanalyzer

[0107] 1. Take out the kit and equilibrate it to room temperature for about 30 minutes, paying attention to avoiding light. Add 25 μl of dye to the gel, mix well by pipetting, add it to the centrifuge tube, and centrifuge at 2000 g for 10 min.

[0108] 2. Take out 9 μl of the gel dye mixture and add it to the injection hole of the electrophoresis chip.

[0109] 3. Place the chip on the injection platform, pull the syringe plunger to the 1 ml scale and fasten the upper cover, press the plunger to the fixed frame buckle, time for 60 s, release the fixed frame buckle when the time is up, and slowly pull the syringe plunger back to the 1 ml scale after waiting for the syringe plunger to stop moving, and release the upper cover of the injection platform.

[0110] 4. Take out the chip from the injection platform and add 9 μl of the gel dye mixture to each of the two upper right injection holes.

[0111] 5. Add 5 μl of Marker to each of the sample wells and the Ladder well on the electrophoresis chip.

[0112] 6. Add 1 μl of Ladder to the Ladder well and 1 μl of the restriction enzyme digestion product to each of the sample wells.

[0113] 7. Place the electrophoresis chip with the added samples into the chip mixer slot and vortex at 2000 rpm for 1 min.

[0114] 8. Open the top cover of the 2100 bioanalyzer, put in the mixed chip, and gently close the top cover. The 2100Expert software Instrument operation interface recognizes that the chip has been loaded. Click DNA1000SeriesII.xsy in Assays dsDNA, set the data saving path, and click Start to start the operation. The instrument can automatically detect the ladder and all samples. Example 5 Agilent 2100 bioanalyzer detection data analysis

[0115] 1. To level the baseline, select Advanced in Local, select Baseline Correction, and level the baseline.

[0116] 2. Because the enzyme digestion product contains a sequence greater than 1500bp, the marker automatically determined by the Agilent 2100 bioanalyzer may not be accurate. You need to manually set the marker and set the Lower according to the peak time of the ladder.

[0117] Marker and Upper Marker.

[0118] 3. Determine the complete ITR and missing ITR based on the length of the sequence, and the molar concentration of the two sequences

[0119] (Molarity) Calculate the deletion rate and integrity rate of ITR. The analysis range of the Agilent DNA 1000 quantitative detection kit is 25-1000bp, so the band after the Upper Maker (1500bp) can be ignored. For the same restriction endonuclease to cut the ITR sequence (Example 1), ITR deletion rate = molar concentration of fragments containing the sequence of the deleted ITR / [(molar concentration of fragments containing the sequence of the deleted ITR + molar concentration of fragments containing the sequence of the complete ITR) / 2]*100%, ITR integrity rate = 1-ITR deletion rate, the results are shown in Table 2. For different restriction endonucleases to cut the ITR sequence (Example 2), ITR1 deletion rate = molar concentration of fragments containing the sequence of the deleted ITR1 / (molar concentration of fragments containing the sequence of the deleted ITR1 + molar concentration of fragments containing the sequence of the complete ITR1)*100%, ITR1 integrity rate = 1-

[0120] ITR1 deletion rate; ITR2 deletion rate = molar concentration of fragments containing the deleted ITR2 sequence / (molar concentration of fragments containing the deleted ITR2 sequence + molar concentration of fragments containing the complete ITR2 sequence)

[0121] *100%, ITR2 integrity rate = 1-ITR2 deletion rate; the results are shown in Tables 3 and 4 respectively.

[0122] 4. We sequenced the AAV plasmids cultured from different strains and under different conditions using an ITR-specific kit. Among them, one ITR was very stable, and the number of ITR deletions in 139 successfully sequenced samples was

[0123] 0; the other ITR was less stable, and the number of ITR deletions in 238 successfully sequenced samples was 20.

[0124] Table 2 Results of ITR sequences digested with the same restriction endonuclease detected by Agilent 2100 Bioanalyzer

[0125] Size (bp) Concentration (ng / μl) Molar concentration (nmol / l) Label 1 15 4.20 424.2 Lower Marker 2 96 0.71 11.3 Fragment containing the deleted ITR region 3 117 5.07 65.5 Fragment containing the complete ITR region 4 1500 2.10 2.1 Upper Maker

[0126] ITR deletion rate = 11.3 / [(11.3 + 65.5) / 2] * 100% = 29.43%;

[0127] ITR integrity rate = 1 - 29.43% = 70.57%.

[0128] Table 3 Results of ITR1 sequences digested with different restriction endonucleases detected by Agilent 2100 Bioanalyzer

[0129]

[0130]

[0131] ITR deletion rate = 0 / (0 + 6.3) * 100% = 0;

[0132] ITR integrity rate = 1 - 0 = 100%.

[0133] Table 4 Results of ITR2 sequences digested with different restriction endonucleases detected by Agilent 2100 Bioanalyzer

[0134] Size (bp) Concentration (ng / μl) Molar concentration (nmol / l) Label 1 15 4.20 424.2 Lower Marker 2 217 0.82 5.7 Fragment containing the complete ITR2 region 3 1500 2.10 2.1 Upper Maker

[0135] ITR deletion rate = 0 / (0 + 5.7) * 100% = 0;

[0136] ITR integrity rate = 1 - 0 = 100%.

[0137] The embodiments of the present invention are not limited to those described in the above embodiments. Without departing from the spirit and scope of the present invention, those of ordinary skill in the art can make various changes and improvements in form and detail, and all of these are considered to fall within the protection scope of the present invention.

Claims

1. A method for detecting a deletion in an ITR to be tested contained in an AAV vector to be tested, the method comprising using a restriction endonuclease to cut a fragment containing the sequence of the ITR to be tested from the AAV vector to be tested, detecting the fragment size of the enzyme cutting product, and determining whether there is a deletion in the ITR to be tested based on the fragment size.

2. method as claimed in claim 1, the restriction enzyme site of wherein said restriction endonuclease is positioned at the two ends of described ITR to be measured, and is positioned at the position inside described ITR to be measured and near described ITR boundary and / or outside described ITR to be measured and near described ITR boundary, wherein the position inside described ITR to be measured and near described ITR boundary refers to that the distance of one end boundary near this restriction enzyme cutting position in two boundaries of described ITR is no more than 40 nucleotides, and the position outside described ITR to be measured and near described ITR boundary refers to that the distance of one end boundary near this restriction enzyme cutting position in two boundaries of described ITR is no more than 100 nucleotides.

3. The method according to claim 1 or 2, wherein the length of the fragment comprising the sequence of the ITR to be detected is between 100-250 bp.

4. The method according to any one of claims 1 to 3, wherein the sequence of the ITR to be detected comprises at least 70%, at least 80%, at least 90% or 100% of the full length of the ITR.

5. The method according to any one of claims 1 to 4, wherein the sequence of the ITR to be detected comprises at least B, B', C and C' regions.

6. The method according to any one of claims 1 to 5, wherein a fragment containing the sequence of the complete ITR produced after the AAV vector containing the complete ITR is digested with the restriction endonuclease is used as a reference fragment. If the enzyme digestion product of the AAV vector to be tested includes a fragment whose length is shorter than the reference fragment, it indicates that there is a deletion in the ITR to be tested; if the enzyme digestion product of the AAV vector to be tested does not include a fragment whose length is shorter than the reference fragment, it indicates that there is no deletion in the ITR to be tested.

7. The method of claim 6, wherein the fragment having a length smaller than that of the reference fragment is 20-30 bp shorter than the reference fragment.

8. The method according to any one of claims 1 to 7, wherein the AAV vector to be tested comprises two ITRs, and the two ITRs are reverse complementary or non-reverse complementary when no deletion occurs.

9. The method of any one of claims 1 to 8, wherein the restriction endonuclease comprises one or two restriction endonucleases.

10. The method according to any one of claims 1 to 9, wherein the method further comprises quantifying the deletion rate and / or integrity rate of an ITR to be tested in the AAV vector to be tested, wherein the quantification comprises detecting the molar concentration of a fragment containing the sequence of the ITR to be tested in the enzyme cleavage product, wherein a fragment having a length less than that of the reference fragment is a fragment containing the sequence of the deleted ITR, and a fragment having a length substantially equal to that of the reference fragment is a fragment containing the sequence of the complete ITR, and a fragment containing the sequence of the complete ITR generated after the AAV vector containing the complete ITR is digested with the restriction endonuclease is used as a reference fragment, and the deletion rate and / or integrity rate of the ITR to be tested is calculated according to the following formula: ITR deletion rate to be tested = molar concentration of fragments containing the deleted ITR sequence / (molar concentration of fragments containing the deleted ITR sequence + molar concentration of fragments containing the complete ITR sequence)*100%; The completeness rate of the ITR to be tested = 1 - the missing rate of the ITR to be tested.

11. The method according to any one of claims 1 to 9, wherein the method further comprises quantifying the deletion rate and / or integrity rate of one ITR to be tested in the AAV vector to be tested, wherein the AAV vector to be tested comprises two ITRs, and the sequence thereof allows the use of only one restriction endonuclease to cut off a fragment comprising the sequence of each of the two ITRs, and the quantification comprises detecting the molar concentration of the fragment comprising the sequence of all ITRs in the enzyme cleavage product, wherein the fragment having a length less than the reference fragment is a fragment comprising the sequence of the deleted ITR, and the fragment having a length substantially equal to the reference fragment is a fragment comprising the sequence of the complete ITR, and the fragment comprising the sequence of the complete ITR generated after the AAV vector comprising the complete ITR is digested with the restriction endonuclease is used as the reference fragment, and the deletion rate and / or integrity rate of one ITR to be tested is calculated according to the following formula: ITR deletion rate to be tested = molar concentration of fragments containing deleted ITR sequences / [(molar concentration of fragments containing deleted ITR sequences+molar concentration of fragments containing complete ITR sequences) / 2]*100%; The completeness rate of the ITR to be tested = 1 - the missing rate of the ITR to be tested.

12. The method according to any one of claims 1 to 11, wherein the fragment length is detected using an Agilent DNA 1000 quantitative detection kit, the fragment length and molar concentration are detected using an Agilent 2100 bioanalyzer, and / or the fragment length or molar concentration is detected using capillary electrophoresis (CGE).

Images