MRNA vaccine and construction method thereof

Abstract

The invention belongs to the technical field of biology, and discloses an mRNA vaccine, and the mRNA vaccine is an mRNA vaccine encapsulated by LNP. The mRNA is designed according to the gene sequence of the avian influenza H5N6 strain, the mRNA vaccine disclosed by the invention is an mRNA vaccine obtained through LNP encapsulation, the vaccine can reach the action point more accurately through encapsulation, meanwhile, the mRNA part of the vaccine is designed according to the gene sequence of the avian influenza H5N6 strain, and in addition, the mRNA part of the vaccine can reach the action point more accurately. A challenge test shows that the mRNA vaccine not only has good humoral immunocompetence, but also has good cellular immunocompetence.

Description

Technical Field

[0001] This application relates to the field of biotechnology, and particularly to an mRNA vaccine and a method for constructing the same. Background Art

[0002] Avian influenza is a zoonotic disease caused by influenza A virus. According to the difference in virus pathogenicity, it can be divided into highly pathogenic and low pathogenic avian influenza. Highly pathogenic avian influenza is mainly caused by the infection of H5 and H7 subtype AIVs, resulting in high morbidity and mortality of animals, causing great harm to the aquaculture industry. The H5 subtype AIV continues to evolve and constantly undergoes recombination. Since 2014, the H5N6 subtype strains have gradually become dominant. Currently, the main evolutionary branches of the H5 subtype avian influenza virus are 2.3.4.4b and 2.3.4.4h. An mRNA vaccine is to introduce mRNA containing the antigen protein-encoding sequence into the body, directly translate it to form the corresponding antigen protein, thereby inducing the body to produce a specific immune response and achieving the effect of preventive immunity.

[0003] Chinese Patent Application No. 202310509346.3 discloses an avian influenza virus mRNA vaccine and its preparation method and application. The mRNA vaccine includes a T7 promoter, a 5'-untranslated region, a codon-optimized HA antigen-encoding gene, a 3'-untranslated region, and a polyadenylic acid; wherein, the amino acid sequence encoded by the codon-optimized HA antigen-encoding gene is as shown in SEQ ID NO.7 and / or SEQ ID NO.10.

[0004] Animal experiments in this scheme show that the avian influenza mRNA vaccine has a good protective effect against avian influenza strains. Single vaccination with the mRNA vaccine can provide 100% protection against heterologous avian influenza strain challenges. Moreover, through the sequential immunization method of this mRNA vaccine and the HA subunit vaccine, it is found that sequential immunization is as effective as single immunization with the mRNA vaccine. Further observing paragraph 94 of the specification of this scheme, it can be seen that the strain and vaccine used in this scheme are both the H5N1 subtype H5 subtype avian influenza virus A / chicken / Guangdong / D889 / 2015 (H5N1) strain, but the cellular immune ability of this scheme has not been verified.

[0005] The problem to be solved by this application: How to provide an mRNA vaccine that can activate multiple immune pathways. Summary of the Invention

[0006] The object of this application is to provide an mRNA vaccine for immunizing against H5N6 avian influenza, and this mRNA vaccine not only has good humoral immune ability but also has excellent cellular immune ability.

[0007] To achieve the above object, the present application discloses an mRNA vaccine, which is an mRNA vaccine encapsulated by LNP;

[0008] And the mRNA part in the mRNA vaccine is designed based on the gene sequence of the avian influenza H5N6 strain.

[0009] Preferably, the mRNA part is designed based on the gene sequence of the 2.3.4.4h clade strain of avian influenza H5N6.

[0010] Preferably, the preparation process of the mRNA part includes the following steps:

[0011] Step 1: Codon optimization is performed on the gene sequence of the 2.3.4.4h clade strain of avian influenza H5N6 to obtain Sequence 1, and the nucleotide sequence of Sequence 1 is shown as SEQ ID NO: 1;

[0012] Step 2: Using human β-globin as the 5' UTR, two tandem human β-globins as the 3' UTR, and synthesizing and ligating with Sequence 1 prepared in Step 1 to a plasmid to obtain a plasmid carrying Sequence 1;

[0013] Step 3: Linearize the plasmid prepared in Step 2 into a DNA fragment, and then perform in vitro transcription, capping, and tailing reactions to obtain the mRNA part, and the nucleotide sequence of the mRNA part is shown as SEQ ID NO: 2.

[0014] Preferably, during the in vitro transcription process of Step 3, all uracils in the mRNA part are replaced with pseudouridine.

[0015] Preferably, the LNP is prepared by mixing ionizable lipids, phospholipids, PEGylated lipids, and steroidal lipids;

[0016] The ionizable lipid is D-Link-MC3;

[0017] The phospholipid is selected from at least one of distearoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, and lauroyl phosphatidylcholine;

[0018] The PEGylated lipid is selected from at least one of dimyristoyl glycerol-polyethylene glycol, distearoyl glycerol-polyethylene glycol, distearoyl phosphatidylethanolamine-polyethylene glycol, and dimyristoyl amino-polyethylene glycol;

[0019] The steroidal lipid is selected from at least one of cholesterol, stigmasterol, campesterol, and β-sitosterol.

[0020] Preferably, the molar ratio of the ionizable lipid, phospholipid, PEGylated lipid, and steroidal lipid is 45-55:8-12:1-2:35-40.

[0021] In addition, the present application also discloses a construction method for constructing the above-mentioned mRNA vaccine. The mRNA part is designed based on the gene sequence of the avian influenza H5N6 strain, and then the mRNA part is encapsulated with LNP to obtain the mRNA vaccine.

[0022] The beneficial effects of the present application are as follows: The mRNA vaccine disclosed in the present application is an mRNA vaccine encapsulated with LNP. Encapsulation enables the vaccine to reach its action site more precisely. At the same time, the mRNA part of the vaccine is designed based on the gene sequence of the avian influenza H5N6 strain. Moreover, through the virus challenge test, it is found that this mRNA vaccine not only has good humoral immunity but also induces CD4 + T cell, CD8 + T cell expression and CD4 + and CD8 + co-expression of T cells and cellular immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a schematic structural diagram of mRNA;

[0024] Figure 2 is an electrophoresis diagram of linearized plasmid;

[0025] Figure 3 is the WB result diagram of transfected 293T cells. In Figure 3 M is Marker, Figure 3 1 is the positive control in Figure 3 2 is the negative control in Figure 3 3 is the mRNA sample in

[0026] Figure 4 is the WB result diagram of transfected DF-1 cells; Figure 4 In it, M is Marker, Figure 4 1 is the negative control in Figure 4 2 is the positive control in Figure 4 3 is the mRNA sample in

[0027] Figure 5 is the result diagram of mRNA transfected 293T cell samples in IFA test;

[0028] Figure 6 is the result diagram of mRNA transfected DF-1 cell samples in IFA test;

[0029] Figure 7 is the negative control in IFA test;

[0030] Figure 8It is a graph showing the test results of the particle size of the mRNA-LNP complex;

[0031] Figure 9 It is a comparison graph of the CD3 + / CD4 + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 14th day;

[0032] Figure 10 It is a comparison graph of the CD3 + / CD8α + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 14th day;

[0033] Figure 11 It is a comparison graph of the CD4 + / CD8α + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 14th day;

[0034] Figure 12 It is a comparison graph of the CD3 + / CD4 + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 21st day;

[0035] Figure 13 It is a comparison graph of the CD3 + / CD8α + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 21st day;

[0036] Figure 14 It is a comparison graph of the CD4 + / CD8α + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 21st day;

[0037] Figure 15 It is a comparison graph of the CD3 + / CD4 + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 28th day;

[0038] Figure 16 It is a comparison graph of the CD3 + / CD8α + levels of the PBS group, the commercial vaccine group, and the 225-LNP group (mRNA-LNP) on the 28th day;

[0039] Figure 17 It is a comparison graph of the CD4+ / CD8α + Horizontal comparison chart;

[0040] Figure 18 Schematic diagram of pathological sections of the PBS group;

[0041] Figure 19 is Figure 18 Local enlarged schematic diagram;

[0042] Figure 20 Schematic diagram of pathological sections of the commercial vaccine group;

[0043] Figure 21 is Figure 20 Local enlarged schematic diagram;

[0044] Figure 22 Schematic diagram of pathological sections of the mRNA-LNP vaccine group;

[0045] Figure 23 is Figure 22 Local enlarged schematic diagram. Detailed implementation method

[0046] The following will combine the embodiments of the present invention to clearly and completely describe the present invention. In the description of the present invention, it should be noted that for those not specifying specific conditions in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. For reagents or instruments not specifying the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0047] The raw material information during the experiment is as follows:

[0048] H5N6 subtype 2.3.4.4h branch strain: Preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University;

[0049] PUC57 plasmid: Purchased from Suzhou Hongxun Biotechnology Co., Ltd.;

[0050] M13-47: Synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.;

[0051] mRNA-R: Synthesized by Guangzhou Tianyi Huiyuan Gene Technology Co., Ltd.;

[0052] HEK-293T cells: Preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University; DF-1 cells: Preserved and provided by the Key Laboratory of Infectious Diseases, College of Veterinary Medicine, South China Agricultural University.

[0053] Example 1

[0054] 1.1 Establishment of PUC57 plasmid

[0055] Select an influenza virus strain of the 2.3.4.4h branch of the H5N6 subtype, sequence and optimize the HA fragment to obtain Sequence 1 (the nucleotide sequence of Sequence 1 is shown in SEQ ID NO: 1);

[0056]

[0057] The 5’UTR uses the human β-globin sequence (the nucleotide sequence of the 5’UTR is shown in SEQ ID NO: 3), the 3’UTR uses two tandem human β-globin sequences (the nucleotide sequence of the 3’UTR is shown in SEQ ID NO: 4), the T7 promoter (shown in SEQ ID NO: 8), the protective bases (CGCC, GGG, CC, GTG); the Kozak sequence (shown in SEQ ID NO: 9), the BamHⅠ restriction site: GGATCC. The sequence was synthesized by Suzhou Huaxun Biotechnology Co., Ltd. (the nucleotide sequence of the synthesized sequence is shown in SEQ ID NO: 5), and the synthesized sequence was ligated to the PUC57 plasmid.

[0058] T7 promoter (shown in SEQ ID NO: 8): TAATACGACTCACTATAGG

[0059] Protective bases: CGCC, GGG, CC, GTG

[0060] Kozak sequence (shown in SEQ ID NO: 9): GCCACCATGG

[0061] BamHⅠ restriction site: GGATCC

[0062]

[0063] 1.2 Construction of mRNA

[0064] The plasmid was linearized into DNA fragments using M13-47 and mRNA-R primers (as Figure 2 shown), and in vitro transcription, capping, tailing reactions were carried out using a kit and purified to obtain mRNA (the nucleotide sequence of the mRNA is shown in SEQ ID NO: 2); the schematic diagram of the structure of the mRNA is as Figure 1 shown.

[0065] The nucleotide sequence of the above M13-47 is shown in SEQ ID NO: 6; the nucleotide sequence of mRNA-R is shown in SEQ ID NO: 7.

[0066]

[0067] Nucleotide sequence of 5’UTR (SEQ ID NO: 3): ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC;

[0068] Nucleotide sequence of 3’UTR (SEQ ID NO: 4): GCTCGCTTTCTTGCTGTCCAA TTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGA TATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTAT TTTCATTGC;

[0069] Nucleotide sequence of M13-47 (SEQ ID NO: 6): AGGGTTTTCCCAGTCACG;

[0070] Nucleotide sequence of mRNA-R (SEQ ID NO: 7): TGACCATGATTACGCCCAC GCAATG.

[0071] In vitro transcription: Replace all uracil (U) with pseudouracil (Ψ) to prevent the host immune system from recognizing unmodified mRNA as foreign RNA, inducing an inflammatory response and interrupting mRNA translation. The linearized plasmid was used for in vitro transcription with the T7 High Yield RNA Transcription Kit from Vazyme. All components were placed on ice, and the reaction system was configured as shown in Table 1:

[0072] Table 1

[0073]

[0074] Gently mix the reaction system, add 1 μL of DNase I to the reaction system after incubating at 37 °C for 2 h, incubate at 37 °C for 15 min to digest the transcription template, and then perform purification.

[0075] Capping: Use the kit from Vazyme for capping and methylation modification. Take the required amount of in vitro transcribed RNA product into a 1.5 mL centrifuge tube, heat at 65 °C for 5 min to open the higher-order structure at the 5’ end, take out the centrifuge tube and place it on ice for 5 min, and configure the system as shown in Table 2:

[0076] Table 2

[0077]

[0078] Incubate at 37°C for 1 h; purify and measure the concentration of the product.

[0079] Polyadenylation: Use the kit from Vazyme for polyadenylation. Place all components on ice and prepare the reaction system as shown in Table 3:

[0080] Table 3

[0081]

[0082]

[0083] Incubate at 37°C for 3 h; purify and measure the concentration of the product.

[0084] Purification: Purify using the lithium chloride purification method to remove proteins and most free nucleotides. The operating steps are as follows:

[0085] (1) Dilute the product with 30 μL of DEPC water.

[0086] (2) Add 30 μL of lithium chloride precipitation solution (7.5 M lithium chloride, 50 mM EDTA), and incubate at -20°C for 30 min.

[0087] (3) Centrifuge at 12000 rpm for 15 min and discard the supernatant.

[0088] (4) Add 500 μL of pre-cooled 70% ethanol to wash the RNA precipitate, centrifuge at 15000 rpm for 15 min at 4°C, discard the supernatant, and repeat three times.

[0089] (5) Open the lid and dry for 2 min, add 40 μL of DEPC water to dissolve the RNA precipitate, ensure complete dissolution without lumps, and measure the RNA concentration.

[0090] 1.3 Verification of protein expression by WB and IFA experiments

[0091] Transfect the above mRNA product into HEK-293T cells and DF-1 cells. The operating steps are as follows:

[0092] (1) Culture the cells using DMEM medium (containing 10% fetal bovine serum). When the cells are in good growth condition, dilute the cells to 2×10 5 cells / mL, evenly plate them in a 6-well plate (the 6-well plate for inoculating HEK-293T cells was previously treated with 1% polylysine), and culture them in a cell culture incubator at 37°C and 5% CO2.

[0093] (2) After about 24 h, when the cell density reaches 80% - 90%, refer to Lipofectamine TMInstruction Manual for 2000 Reagent: Add mRNA and transfection reagent at a ratio of 1:2, mix well, and incubate at room temperature for 20 min.

[0094] During this period, wash the 6-well plate twice with PBS, add Opti-MEM. After incubation, add the mRNA-liposome complex to the 6-well plate and culture it in a cell incubator at 37°C and 5% CO2 for 24 h.

[0095] The protein expression level after transfection can be verified by WB. The operation steps are as follows:

[0096] (1) After 24 h of transfection, discard the culture medium, wash 3 times with PBS, add RIPA cell lysate, scrape the cells in the 6-well plate with a cell scraper, collect them into a 1.5 mL centrifuge tube, and let it stand on ice for 30 min for sufficient lysis.

[0097] (2) Centrifuge at 12000 rpm for 10 min at 4°C, aspirate the supernatant into a new centrifuge tube, and measure the protein concentration.

[0098] (3) Mix the protein sample with 0.25 times the volume of 5×SDS loading buffer, and incubate in a metal bath at 100°C for 5 min for sufficient denaturation.

[0099] (4) Prepare the polyacrylamide electrophoresis solution, add the sample, electrophorese at 80 V for 30 min, then adjust the voltage to 120 V and electrophorese for 1 h.

[0100] (5) Prepare the transfer buffer, cut the gel to an appropriate size, transfer the protein blot to a nitrocellulose membrane (NC membrane), and electrophorese at 200 mA for 1 h.

[0101] (6) Take out the NC membrane, put it into an incubation box containing 5% BSA, and incubate on a shaker at room temperature for 2 h.

[0102] (7) Wash 3 times with TBST, 5 min each time, add the primary antibody, and incubate at 4°C for 14 ± 2 h.

[0103] (8) Wash 3 times with TBST, 5 min each time, add the secondary antibody for incubation, and incubate on a shaker at room temperature for 1 h.

[0104] (9) Wash 3 times with TBST, 5 min each time, and scan with an imager.

[0105] Among them, the WB test results of transfected HEK-293T cells are as Figure 3As shown, M is the marker, lane 1 is the positive control, lane 2 is the negative control, lane 3 is the mRNA product, the theoretical size of the target protein is about 68 kDa, and an obvious band can be seen at about 70 kDa in lane 3. The actual result is larger, probably because of chemical modification. The result verifies that the prepared mRNA can successfully express the correct protein in HEK-293T cells;

[0106] The WB test results of transfected DF-1 cells are as Figure 4 shown. M is the marker, lane 1 is the negative control, 2 is the positive control, 3 is the mRNA product, the theoretical size of the target protein is about 68 kDa, and an obvious band can be seen at about 70 kDa in lane 3. The actual result is larger, probably because of chemical modification. The result verifies that the prepared mRNA can successfully express the correct protein in DF-1 cells;

[0107] IFA can be used to verify the protein expression after transfection. The operation steps are as follows:

[0108] (1) After 24 h of transfection, discard the culture medium, wash 3 times with PBS, and add 4% paraformaldehyde to fix for 15 min;

[0109] (2) Wash 3 times with PBS, add 0.5% Triton X-100, and permeate at room temperature for 20 min;

[0110] (3) Wash 3 times with PBS, add 5% BSA blocking solution, and block at room temperature for 1 h;

[0111] (4) Wash 3 times with PBS, add the primary antibody diluted 1:500, and incubate at 4 °C for 12 - 16 h;

[0112] (5) Wash 3 times with PBS, add the corresponding diluted secondary antibody, incubate at room temperature for 1 h, and observe using a fluorescence inverted microscope;

[0113] Refer to Figures 5 - 7 , mRNA can correctly express proteins in both 293T cells and DF1 cells.

[0114] 1.4 Use LNP to encapsulate mRNA to obtain mRNA-LNP

[0115] Preparation of related solutions: 20×citrate-sodium citrate buffer: Weigh 13.762 g of citric acid and 10.146 g of sodium citrate and add them to 30 mL of DEPC-treated water. After complete dissolution, continue to add DEPC water to 50 mL. Mix well and dispense. 1×TE Buffer: Add 12.1 g of Tris and 0.37 g of EDTA to 800 mL of deionized water. After complete dissolution, make up to 1 L, filter and sterilize with a 0.22 μm filter, and mix with DEPC-treated water in a ratio of 1:19 to dilute to 1×TE Buffer. TE Buffer containing 2% Triton X-100: Take 10 mL of 1×TE Buffer and add 200 μL of Triton X-100, and mix well.

[0116] (2) Preparation of LNP: Dilute the ionizable lipid D-Link-MC3-DMA and PEG-DMG to 100 mM respectively using pharmaceutical-grade absolute ethanol, and dissolve DSPC and cholesterol to 10 mM using pharmaceutical-grade absolute ethanol; mix them in sequence according to the molar ratio of D-Link-MC3: distearoylphosphatidylcholine (DSPC): cholesterol: dimyristoyl glycerol-polyethylene glycol (PEG-DMG) of 50:10:38.5:1.5. Finally, add pharmaceutical-grade absolute ethanol to dilute the mixture into a 20 mg / mL solution, dispense it into brown glass bottles, and store it in a -20°C refrigerator for later use.

[0117] (3) Encapsulation of LNP: After thawing the mRNA product on ice, dilute it with 20×citrate-sodium citrate buffer and DEPC water to make the mRNA into a solution with pH = 4 and a concentration of 1 mg / mL; use a microfluidic system to push the LNP and mRNA solutions (aqueous phase: ethanol phase = 1:1) at a speed of 1.5 mL / min to prepare the mRNA-LNP complex; add the complex to 10 times the volume of PBS, mix it by inverting up and down, then add it to an ultrafiltration tube, and centrifuge it using a horizontal rotor centrifuge at 2500 rpm at room temperature for 10 min. After centrifugation, discard the lower layer of liquid until it is concentrated to the required amount. Finally, rinse the particles adhering to the membrane with PBS.

[0118] Particle size detection:

[0119] Use a Malvern Zetasizer Nano ZS90 nanometer particle size and zeta potential analyzer to detect the particle size of the mRNA-LNP complex. Take 1 μL of the complex and add it to 1 mL of PBS and mix well. Add the mixture to a quartz cuvette, put it into the instrument, adjust the parameters for detection and record the data;

[0120] The test results are as Figure 8As shown, it can be seen that the peak is between 200 and 300 d.nm, that is, the particle size is between 200 and 300 d.nm.

[0121] Encapsulation efficiency detection:

[0122] Take a part of the sample and divide it into two parts. One part is diluted with 1×TE Buffer, and the other part is diluted with TE Buffer containing 2% Triton X-100. Add the samples to a black 96-well plate, with three replicates for each sample. Add 100 μL of solution to each well, and then add 1×RiboGreen solution to the wells containing the samples at a ratio of 1:1. Incubate in the dark at room temperature for 5 min; set the excitation wavelength of the multifunctional microplate reader to 485 nm and the emission wavelength to 528 nm, and measure the fluorescence of the samples; record the measurement results, measure the concentrations of total RNA and free RNA according to the standard curve, and calculate the encapsulation efficiency. The calculation formula is shown in Equation 1:

[0123]

[0124] In Equation 1, A is the concentration of free RNA;

[0125] B is the concentration of total RNA;

[0126] According to the calculation, the encapsulation efficiency is 83.4%.

[0127] 1.5 Conduct animal experiments on chickens

[0128] Randomly divide 24 2-week-old SPF chickens into 3 groups, with 8 chickens in each group. One group is the PBS group, one group is the commercial H5+H7 trivalent inactivated vaccine group, and the remaining group is the 25 μg mRNA-LNP vaccine group. The immunization dose for each group is injected at 0.3 mL / chicken; the injection method is intramuscular injection in the chest. A booster immunization is carried out 2 weeks after the first immunization, and the chickens are challenged 2 weeks after the booster immunization. The challenge dose is 10 6 EID 50 / 0.1 mL / chicken, and the challenge strain (A / duck / Shandong / 225 / 2023(H5N6)) is infected via the nasal route. Record the morbidity and mortality 14 days after the challenge, and finally euthanize the chickens.

[0129] 1.6 Evaluation of immune effect

[0130] Flow cytometry was used to detect the CD3 + CD4 + levels of peripheral blood lymphocytes in chickens of each group, the CD3 + CD8α + levels of peripheral blood lymphocytes in chickens, and the coexistence level of CD4 + and CD8α + in peripheral blood lymphocytes of chickens. The test results are asFigures 9 - 17 as shown

[0131] Reference Figures 9 - 17 It can be seen that the single-positive level (CD3 + CD4 + level or CD3 + CD8α + level) and double-positive level (CD4 + CD8α + level) in the PBS group showed small fluctuations at 2-4 weeks; it can be seen that the immune cell levels in the PBS injection group did not show an obvious change trend;

[0132] Further observation of the commercial vaccine group showed that its single-positive level (CD3 + CD4 + level or CD3 + CD8α + level) showed a gradually increasing state over time, while the double-positive level (CD4 + CD8α + level) showed a small fluctuation trend. It can be seen that on the one hand, the commercial vaccine can stimulate strong cellular immunity relative to the PBS group, but as time goes on, the double-positive immune level is relatively stable;

[0133] At the same time, observation of the mRNA-LNP group showed that it not only had an advantage over the vaccine group in the single-positive level, but also showed a relatively high double-positive level in the second week, even reaching nearly 3 times the level of the commercial vaccine. It can be seen that mRNA-LNP can rapidly stimulate the double-positive immune level of the body in a short time, and as time goes on, the mRNA-LNP group can maintain the coexistence state of CD4 + CD8α + at a relatively high level;

[0134] It can be seen that the mRNA-LNP group has an advantage not only in the single-positive level relative to the commercial vaccine, but also in the double-positive level, especially in the short-term improvement of the double-positive level, and its advantage is more significant. Therefore, mRNA-LNP can stimulate the cellular immune state of CD4 + CD8α + T cell coexistence in a short time, and then achieve high-efficiency cellular immunity through multiple pathways.

[0135] The neutralizing antibody titer in serum was detected by the HI method, and the test results are shown in Table 4:

[0136] Table 4

[0137]

[0138] Result analysis:

[0139] From Table 4, we can see that although the antibody titer of the LNP vaccine group was slightly weaker than that of the commercial vaccine group after the first immunization, the antibody titer showed a certain advantage after the second immunization;

[0140] It can be seen that the humoral immunity of the LNP vaccine group is comparable to that of the commercial vaccine group, and can provide even better humoral immunity after the second immunization.

[0141] On the third day after the challenge, nine chickens were killed, three in each group, and pathological sections were made to observe the pathological changes in the lungs;

[0142] refer to Figures 18 - 19 PBS group: The lung tissue is composed of bronchial branches at all levels, lung chambers and respiratory capillaries. The respiratory capillaries are connected to the lung chambers. The flat epithelial cells on their surface constitute the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries. A large number of parabronchial hemorrhages can be seen (yellow arrows); a small number of inflammatory cell foci in the secondary bronchial mucosa (blue arrows); more lung chambers are dilated (black arrows); occasional punctate necrosis (black arrows) and nuclear fragmentation; vascular congestion is common (orange arrows); Figure 18 The middle black box indicates the location of the magnified field of view;

[0143] refer to Figures 20 - 21 , Commercial vaccine group: The lung tissue is composed of bronchial branches at all levels, lung chambers and respiratory capillaries. The respiratory capillaries are connected to the lung chambers, and the flat epithelial cells on their surface constitute the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries, and a small amount of parabronchial bleeding can be seen (yellow arrow); a small amount of inflammatory cell clusters can be seen in the primary bronchial mucosa (blue arrow); a small amount of lung chamber dilation (black arrow); vascular congestion is common (orange arrow); Figure 20 The middle black box indicates the location of the magnified field of view;

[0144] refer to Figures 22 - 23 , mRNA-LNP vaccine group: The lung tissue is composed of bronchial branches at all levels, lung chambers and respiratory capillaries. The respiratory capillaries are connected to the lung chambers, and the flat epithelial cells on their surface constitute the respiratory surface. The respiratory capillaries are surrounded by a large number of capillaries, and more lung chamber bleeding can be seen (yellow arrow); a large amount of lung chamber expansion (black arrow); vascular congestion is common (orange arrow); inflammatory cell foci are occasionally seen around the lung chambers (blue arrow); Figure 22 The middle black box indicates the location of the magnified field of view;

[0145] In addition, after the SPF chickens were challenged with the virus, all the chickens in the PBS group died within 5 days, while there was no death in the commercial vaccine group and the mRNA-LNP vaccine group;

[0146] At the same time, anal pharyngeal swabs were collected on the 3rd / 5th / 7th day after challenge and inoculated with chicken embryos to detect whether there was in vitro excretion of the virus;

[0147] On the 3rd, 5th, and 7th days after further challenging and infecting SPF chickens, oropharyngeal swabs and cloacal swabs of SPF chickens in the commercial vaccine group, mRNA-LNP vaccine group, and PBS group were collected respectively. After processing, they were inoculated into 9- to 11-day-old chicken embryos to evaluate the in vitro virus excretion of SPF chickens in each group. The test results showed that no virus excretion was detected in the commercial vaccine group and the mRNA-LNP vaccine group, while virus excretion was detected in all surviving chickens in the PBS group.

Claims

1. An mRNA vaccine, characterized in that, The mRNA vaccine is an mRNA vaccine encapsulated by LNP; and the mRNA part in the mRNA vaccine is designed based on the gene sequence of the avian influenza H5N6 strain.

2. The mRNA vaccine according to claim 1, wherein The mRNA part is designed based on the gene sequence of the 2.3.4.4h branch strain of avian influenza H5N6.

3. The mRNA vaccine according to claim 1, characterized in that, The preparation process of the mRNA part includes the following steps: Step 1: Optimize the codons of the gene sequence of the 2.3.4.4h branch strain of avian influenza H5N6 to obtain Sequence 1, and the nucleotide sequence of Sequence 1 is shown as SEQ ID NO: 1; Step 2: Use human β-globin as the 5'UTR, use two tandem human β-globins as the 3'UTR, synthesize and ligate with Sequence 1 prepared in Step 1 to a plasmid to obtain a plasmid carrying Sequence 1; Step 3: Linearize the plasmid prepared in Step 2 into a DNA fragment, and then perform in vitro transcription, capping, and tailing reactions to obtain the mRNA part, and the nucleotide sequence of the mRNA part is shown as SEQ ID NO:

2.

4. The mRNA vaccine according to claim 3, characterized in that, During the in vitro transcription process of Step 3, all uracils in the mRNA part are replaced with pseudouridine.

5. The mRNA vaccine according to claim 1, characterized in that, The LNP is prepared by mixing ionizable lipids, phospholipids, PEGylated lipids, and sterol lipids; The ionizable lipid is D-Link-MC3; The phospholipid is selected from at least one of distearoyl phosphatidylcholine, dipalmitoyl phosphatidylcholine, and lauroyl phosphatidylcholine; The PEGylated lipid is selected from at least one of dimyristoyl glycerol-polyethylene glycol, distearoyl glycerol-polyethylene glycol, distearoyl phosphatidylethanolamine-polyethylene glycol, and dimyristoyl amino-polyethylene glycol; The sterol lipid is selected from at least one of cholesterol, stigmasterol, campesterol, and β-sitosterol.

6. The mRNA vaccine according to claim 1, characterized in that, The molar ratio of the ionizable lipid, phospholipid, PEGylated lipid, and sterol lipid is 45-55:8-12:1-2:35-40.

7. A construction method for constructing the mRNA vaccine according to any one of claims 1-6, characterized in that, Design the mRNA part based on the gene sequence of the avian influenza H5N6 strain, and then encapsulate the mRNA part with LNP to obtain the mRNA vaccine.

Images