Use of fatty acid synthase or its gene activity inhibitor in the preparation of drugs for treating essential thrombocythemia

Abstract

The present invention provides a use of an inhibitor of fatty acid synthase (FASN) or its gene activity in the preparation of a drug for treating essential thrombocythemia (ET). The inventors have verified that the FASN small molecule inhibitor and the BASIN The therapeutic effects of gene editors or inhibitory nucleic acids in ET in vitro and in vivo models were evaluated, and the possibility of FASN or its gene as a new target for ET treatment was evaluated, providing new ideas for the clinical treatment of ET.

Description

Technical Field

[0001] The present disclosure relates to the field of biomedicine, and in particular, to use of an activity inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a medicament for treating essential thrombocythemia (ET). Background Art

[0002] Essential thrombocythemia (ET) is a myeloproliferative neoplasm (MPN) characterized by an abnormal increase in platelets, leading to a significantly increased risk of thrombosis and bleeding. The clinical manifestations of ET are highly heterogeneous. Patients may be asymptomatic for long periods of time, but may also experience symptoms of microcirculatory disturbances such as headaches, dizziness, and numbness in the limbs. Severe cases can lead to fatal complications such as myocardial infarction, stroke, or deep vein thrombosis. The long-term risks of these complications cannot be ignored. Among them, thrombotic events are the main cause of death in ET patients. In addition, some patients may progress to myelofibrosis (MF) or acute myeloid leukemia (AML), which have an extremely poor prognosis.

[0003] The pathogenesis of ET is closely associated with JAK2V617F, CALR, and MPL gene mutations. These mutations activate the JAK-STAT signaling pathway, leading to abnormal megakaryocyte proliferation and overactive platelet production. Current treatment strategies primarily include low-dose aspirin to reduce thrombotic risk and hydroxyurea or interferon α to control platelet levels. However, these treatments have significant limitations. Hydroxyurea may cause cytotoxic side effects and potentially induce progression to AML, while interferon α is poorly tolerated and often causes adverse reactions such as flu-like symptoms and depression, which impacts patient compliance. In recent years, JAK2 inhibitors (such as ruxolitinib), emerging targeted therapies, have shown some efficacy in ET. However, some patients develop resistance to these drugs, and these drugs are not yet effective in preventing progression to MF or AML.

[0004] With the chronic progression of the disease and the recurrence of complications, ET seriously impacts patients' quality of life. Long-term drug treatment and frequent blood monitoring not only increase the medical burden, but also significantly increase treatment costs and the risk of hospitalization if thrombosis occurs or the disease progresses to MF or AML, placing a heavy financial burden on patients' families and the public healthcare system. Therefore, there is an urgent need to explore new therapeutic targets and potential drugs to improve disease management, reduce the risk of complications, and alleviate the financial burden on society and the healthcare system while improving patient outcomes.

[0005] Current treatments for ET aim to reduce the risk of thrombosis and bleeding. However, these treatment options have the following defects and deficiencies: (1) Side effects and tolerance issues: Cytostatic drugs such as hydroxyurea may cause side effects, including bone marrow suppression, oral ulcers, and skin ulcers, which are difficult for some patients to tolerate. In addition, there is still controversy as to whether the use of hydroxyurea increases the risk of AML or other malignancies. (2) Inability to effectively prevent disease progression: Existing therapies mainly focus on symptom management and fail to effectively prevent the progression of ET to MF or AML. Studies have shown that approximately 10% of ET patients progress to MF after diagnosis, and approximately 3% progress to AML. (3) Limited improvement in overall survival: Although existing treatments have a certain effect in reducing the risk of thrombosis and bleeding, they have not been able to significantly prolong the overall survival of patients. Epidemiological data show that the median survival of ET patients is approximately 20 years, and the survival of high-risk patients is significantly shorter than that of the normal population matched for age and gender. In view of the above shortcomings, there is an urgent need to explore new molecular targets and treatment strategies to achieve more effective disease intervention and improve prognosis. Summary of the Invention

[0006] Technical issues solved:

[0007] The first aspect of the present disclosure is to address the shortcomings of the existing technology in the treatment of essential thrombocythemia (ET), which lacks effective targets and related drugs, and provides a use of an activity inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a drug for the treatment of ET.

[0008] Technical solution:

[0009] Use of an activity inhibitor of fatty acid synthase (FASN) or its gene in the preparation of a medicament for treating essential thrombocythemia (ET).

[0010] Furthermore, the activity inhibitor may be a product that blocks or reduces the expression of the gene, or a product that blocks or reduces the activity of the fatty acid synthase.

[0011] In some embodiments of the present disclosure, the activity inhibitor may be an activity inhibitor comprising a polypeptide that specifically binds to FASN.

[0012] Furthermore, in other embodiments of the present disclosure, the above-mentioned activity inhibitor can be an antibody that specifically binds to FASN or an antigen-binding portion of the antibody, a complex containing an E3 ubiquitin ligase that specifically binds to FASN, an antibody-drug conjugate that specifically binds to FASN, or a chimeric antigen receptor that specifically binds to FASN.

[0013] Specifically, the above-mentioned activity inhibitor can be a small molecule compound inhibitor, which is selected from C75 or its enantiomer, FASN-IN-1, FASN-IN-3, FASN-IN-4, FASN-IN-4 tosylate, FASN-IN-5, FASN-IN-6, Denifanstat, Fasnall or its enantiomer, Fasnallbenzenesulfonate, Orlistat, FT113, GSK837149A, TVB-3166, UCM05, Desoxyrhaponticin, IPI-9119, TVB-3664, Cerulenin, GSK2194069, PFM046, Androsin, CTL-06, CTL-12, YW1128, BI 99179 or Niga-ichigoside F1, or at least one salt of the above small molecule compounds.

[0014] The above-mentioned small molecule compound inhibitors can be used according to the prescribed dosage and method. The above-mentioned small molecule compound inhibitors can be used alone or in combination.

[0015] In some embodiments of the present disclosure, the activity inhibitor may also be an inhibitory nucleic acid targeting the FASN gene or a gene editor targeting the FASN gene. Furthermore, in some embodiments of the present disclosure, the gene editor may include a sgRNA. The sgRNA can be designed and obtained using conventional methods in the art. Specifically, the sgRNA may be Fasn Mouse Pre-designed siRNA Set A (Genbank ID: 14104), FASN Human Pre-designed siRNA Set A (Genbank ID: 2194), or Fasn Rat Pre-designed siRNA Set A (Genbank ID: 50671).

[0016] In some embodiments of the present disclosure, the inhibitory nucleic acid comprises shRNA, and the shRNA comprises a nucleotide pair as shown in SEQ ID No. 1 or 2, or a nucleotide pair as shown in SEQ ID No. 3 or 4.

[0017] The second aspect of the present disclosure provides use of a composition for preparing a medicament for treating essential thrombocythemia (ET), wherein the composition comprises an activity inhibitor of FASN or its gene.

[0018] In some embodiments, the above composition may further include a pharmaceutically acceptable carrier, a delivery medium, an excipient, a stabilizer, a diluent, a surfactant, a preservative, an isotonic agent, or the like, or a combination thereof.

[0019] The third aspect of the present disclosure provides a use of an inhibitor of FASN or its gene activity in the preparation of a product that reduces the differentiation level of hematopoietic stem / progenitor cells into megakaryocytes (Mk).

[0020] Beneficial effects:

[0021] The inventors verified the therapeutic effects of FASN small molecule inhibitors and gene editors or inhibitory nucleic acids targeting the FASN gene in in vitro and in vivo ET models, and further evaluated the possibility of FASN or its gene as a new target for ET treatment, providing new ideas for the clinical treatment of ET. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 In the embodiment of the present disclosure, the FASN gene was detected before and after knockdown, and the Mk (CD41a + CD42b + ) Proportional result diagram;

[0023] Figure 2 In the embodiment of the present disclosure, the CD34 + On Day 9 and Day 12 of hematopoietic stem / progenitor cells (HSPCs) differentiation into MK, the MK (CD41a + CD42b + ) Proportional result diagram;

[0024] Figure 3 In the embodiment of the present disclosure, FASN inhibitor C75 (0 μM (DMSO), 10 μM, 20 μM) was added to the MEG-01 to Mk differentiation system, and the Mk (CD41a + CD42b + ) Proportional result diagram;

[0025] Figure 4 This is a graph showing the platelet count results of peripheral blood of ET mice tested on Day 14 after intraperitoneal injection of C75 (0 mg / Kg (DMSO), 30 mg / Kg) in the embodiments of the present disclosure.

[0026] Sequence description.

[0027] DETAILED DESCRIPTION

[0028] The present invention discloses the use of an inhibitor of fatty acid synthase (FASN) or its gene activity in the preparation of a medicament for treating essential thrombocythemia (ET). Those skilled in the art may refer to the disclosure herein and appropriately modify the process parameters to achieve this. It should be noted that all similar substitutions and modifications obvious to those skilled in the art are considered encompassed by the present invention, and relevant persons will clearly be able to modify, alter, and combine the disclosure herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0029] In this disclosure, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly indicated, throughout the specification and claims, the term "comprise" or its variations such as "comprises" or "comprising" will be understood to include the elements or components stated without excluding other elements or other components. The terms "a", "an", and "the" include plural referents. The term "multiple" refers to two or more. The terms "such as", "for example", etc. are intended to refer to exemplary embodiments and are not intended to limit the scope of this disclosure.

[0030] In this disclosure, when a range of values ​​is provided, it is understood that the endpoints are included in the range and that each intervening value between the upper and lower limits of the range and any other specified value or intervening value in the stated range and any smaller range between the specified values ​​are encompassed unless the context clearly dictates otherwise.

[0031] In this disclosure, the term "about" generally refers to a variation within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.

[0032] Throughout this disclosure, references to "one embodiment," "an example," "some embodiments," "specific embodiments," "related embodiments," "an example," "some examples," "additional embodiments," or "further embodiments," "further implementations," or "another embodiment," "other examples" mean that at least one feature or characteristic description is included in connection with an embodiment. Thus, references to these phrases in various places throughout this disclosure are not necessarily referring to the same embodiment. Furthermore, particular features may be combined in any suitable manner in one or more embodiments.

[0033] In this disclosure, unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. For definitions of common terms in molecular biology, see Lewin's Genes, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, Publisher: Jones & Bartlett Learning. For definitions of common terms in biochemistry, see Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, Publisher: WH Freeman. For definitions of common terms in cell biology, see Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, Publisher: Garland Science. For definitions of common terms in genetics, see Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, Publisher: Jones & Bartlett Learning.

[0034] Unless otherwise specified, the experimental techniques herein employ conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard books such as Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.

[0035] definition:

[0036] The term "fatty acid synthase" (FASN) as used herein is a multifunctional enzyme (RefSeq: NP_004095.4) that converts acetyl-CoA and malonyl-CoA to palmitic acid, playing a central role in fatty acid synthesis and metabolism. Physiologically, FASN is primarily expressed in the liver, adipose tissue, and mammary gland, and participates in key processes such as energy storage, cell membrane synthesis, and signaling molecule production. FASN also plays a crucial role in regulating cell proliferation, differentiation, and redox homeostasis. The FASN gene is located on human chromosome 17. The FASN protein is 2511 amino acids long and has a molecular mass of approximately 273,427 daltons (Da). Under pathological conditions, abnormal FASN expression is closely associated with the onset and progression of various diseases. FASN is highly expressed in various solid tumor cells, and its overactivation is believed to be part of tumor metabolic reprogramming (the Warburg effect), promoting rapid tumor cell proliferation, inhibiting apoptosis, and enhancing drug resistance. High FASN expression has been found to be closely associated with aggressiveness and poor prognosis in breast, prostate, colorectal, and ovarian cancers. By promoting lipid bilayer synthesis, FASN provides the building blocks for biomembrane synthesis in tumor cells, supporting their high proliferation and migration capabilities. Furthermore, FASN promotes tumor cell growth and survival by regulating signaling pathways such as PI3K / AKT / mTOR and HER2 / EGFR, further driving tumor progression.

[0037] The term "activity inhibitor" as used herein refers to a substance that can bind to and inhibit the protein activity of FASN, preventing it from effectively participating in pathological processes. Examples include competitive inhibitors, which have a structure similar to that of the substrate and compete for binding to the enzyme's active site; noncompetitive inhibitors, which bind to the enzyme's inactive site, causing a conformational change and preventing the catalytic reaction; uncompetitive inhibitors, which bind only to the enzyme-substrate complex (ES) and block product formation; irreversible inhibitors that covalently modify the enzyme's active site; covalently reversible inhibitors; and allosteric inhibitors. The term "activity inhibitor" may also refer to substances that can downregulate or inhibit FASN gene expression. In some embodiments, downregulation or inhibition can refer to either direct or indirect downregulation or inhibition. In some embodiments, downregulation or inhibition of FASN gene expression can be achieved by regulating the FASN gene at at least one of the following levels: transcriptional regulation, translational regulation, post-transcriptional modification, or post-translational modification. To achieve optimal results, these regulatory methods can be used alone or in combination. The above-mentioned regulation method can be carried out by the method disclosed in the prior art, for example, refer to Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281-297. Further, in some embodiments, the downregulation or inhibition of FASN gene expression is achieved by at least one of the following treatments on the FASN gene: gene silencing, gene knockout or knockdown, gene mutation. In order to achieve better results, the above-mentioned treatment methods can be used alone or in combination. The above-mentioned treatment methods can be carried out by the method disclosed in the prior art, for example, refer to Ito Y, Inoue S, Nakashima T, et al. Epigenetic profiles guide improved CRISPR / Cas9-mediated gene knockout in human T cells. Nucleic Acids Res. 2024;52(1):141-153.

[0038] The term "enantiomers" as used herein refers to stereoisomers that are non-superimposable mirror images of one another. For example, when a compound has an asymmetric center, it is bonded to four different groups, and a pair of enantiomers may exist. Enantiomers can be characterized by the absolute configuration of their asymmetric center and described according to the Cahn–Ingold–Prelog (CIP) rules of R and S order, or by the way the molecule rotates the plane of polarized light, thereby designating them as right- or left-handed (i.e., (+) or (-)-isomers, respectively). Chiral compounds can exist as either individual enantiomers or as mixtures thereof. A mixture containing equal proportions of enantiomers is called a "racemic mixture."

[0039] The term "C75" in the present disclosure is a synthetic FASN inhibitor. C75 inhibits the half inhibitory concentration (IC50) of prostate cancer cells PC3. 50 ) was 35 μM. C75 is a potent activator of carnitine palmitoyltransferase 1A (CPT1A). The structural formula of C75 is shown below in Formula I. See Rae C, et al. Inhibition of Fatty Acid Synthase Sensitizes Prostate Cancer Cells to Radiotherapy. Radiat Res. 2015 Nov;184(5):482-93.doi: 10.1667 / RR14173.1.

[0040]

[0041] Formula I

[0042] The term "inhibitory nucleic acid" (INA) as used herein refers to a class of nucleic acid molecules capable of inhibiting the expression of specific genes or the function of proteins. Through specific sequence design and modification, these molecules can bind to complementary sequences of target gene mRNA or proteins, thereby disrupting their normal function or expression levels. Common examples of inhibitory nucleic acids include antisense oligonucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), and other nucleic acid molecules that function through the RNA interference (RNAi) mechanism.

[0043] Example:

[0044] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention is further described in detail below with reference to specific embodiments.

[0045] Example 1: Construction of FASN-shRNA knockdown plasmid.

[0046] 1. The pSIH1-H1-copGFP shRNA expression lentiviral vector was purchased from System Biosciences. The control shRNA (Scramble) plasmid was constructed according to the product manual. Verified sequences were searched on the Sigma website, and the following FASN-shRNA sequence was synthesized by BGI.

[0047] FASN -sh1F:

[0048] GATCCGCTACGACTACGGCCCTCATTCTTCCTGTCAGAAATGAGGGCCGTAGTCGTAGCTTTTTG (SEQID No: 1)

[0049] FASN -sh1R:

[0050] AATTCAAAAAGCTACGACTACGGCCCTCATTTCTGACAGGAAGAATGAGGGCCGTAGTCGTAGCG (SEQ ID No: 2)

[0051] FASN -sh2F:

[0052] GATCCGCATGGAGCGTATCTGTGAGAACTTCCTGTCAGATTCTCACAGATACGCTCCATGCTTTTTG (SEQ ID No: 3)

[0053] FASN -sh2R:

[0054] AATTCAAAAAGCATGGAGCGTATCTGTGAGAATCTGACAGGAAGTTCTCACAGATACGCTCCATGCG (SEQ ID No: 4)

[0055] 2. Vector construction.

[0056] (1) Enzyme digestion of vector plasmid.

[0057] system:

[0058]

[0059] After enzyme digestion, the linear fragment vector was recovered by gel.

[0060] (2) Primer annealing.

[0061] system:

[0062]

[0063] PCR reaction:

[0064]

[0065] (3) Connection.

[0066] system:

[0067]

[0068] Incubate overnight at 16°C.

[0069] (4) Transformation.

[0070] Use Trans5α competent cells for transformation, plate the plates, pick clones and shake the cells the next day, and send them for sequencing.

[0071] (5) Select the shRNA plasmid with the correct sequence.

[0072] The bacteria were shaken one day in advance, and the remaining bacteria were frozen with 50% glycerol at -80℃. The remaining bacterial liquid was extracted with a plasmid extraction kit and frozen at -80℃.

[0073] 3. Virus packaging.

[0074]

[0075] Plate 293T cells 2 days in advance and package the virus when confluence reaches 95%. Collect the supernatant 48 and 72 hours after virus packaging, pool the supernatant, centrifuge at 3000 rpm for 15 minutes, filter through a 0.45 μm filter, and concentrate by centrifugation at 20,000 rpm for 2.5 hours. Aliquot and store at -80°C.

[0076] Example 2: Virus infection of human megakaryoblastic leukemia cell line (MEG-01), umbilical cord blood CD34 + Hematopoietic stem / progenitor cells (HSPCs) were induced to differentiate into megakaryocytes (MK) in vitro.

[0077] 1. The virus obtained in Example 1 was used to infect MEG-01.

[0078] (1) According to 7x10 5 Prepare cells at a density of 1:2000 cells / mL, calculate the volume of virus to be added according to the virus titer, and add 8 mg / mL polybrene.

[0079] (2) Wrap with sealing film and centrifuge at 37°C, 2000 rpm for 90 minutes.

[0080] (3) After centrifugation, remove the sealing film and place the cells in the incubator. After 12 hours, change to the differentiation induction medium: RPMI-1640 + 10% fetal bovine serum (FBS) + 1% penicillin-streptomycin combined with antibiotics (P / S) + 50 ng / mL 12-myristoylphorbol-13-acetate (PMA).

[0081] (4) GFP was obtained by flow cytometry sorting + cells, induced to differentiate into Mk. The cell density was 1x10 5 cells / mL / well, and the medium was changed every 3 days until Day 6. Excess cells were collected during each medium change, and a portion was used for protein extraction and Western Blot analysis of gene knockdown effects; the remaining portion was incubated with CD41a-APC and CD42b-PE flow cytometry antibodies to detect the proportion of cells that differentiated into MK.

[0082] 2. Umbilical cord blood-derived CD34 + Enrichment of hematopoietic stem / progenitor cells (HSPCs).

[0083] Fresh cord blood samples were diluted 1:1 with sorting buffer (phosphate buffered saline (PBS) + 2% FBS + 1% P / S + 2mM ethylenediaminetetraacetic acid (EDTA)). 1 / 2 volume of human lymphocyte separation buffer was added to a 15mL centrifuge tube. The diluted sample was slowly added along the tube wall, keeping the lymphocyte separation buffer at the bottom and the diluted sample at the top. Centrifuge at 680g for 20 minutes with slow ramp up and down. The buffy coat layer was aspirated into a new 15mL centrifuge tube. 10mL of sorting buffer was added and centrifuged at 1600rpm for 5 minutes. The supernatant was discarded. The centrifugation was repeated at 1400rpm, the supernatant was discarded, and the sample was resuspended in sorting buffer for counting. Each 1x10 7 Add 10µL blocking agent and 10µL CD34 + Magnetic beads, incubate at 4℃ in the dark for 30min. Add 10mL sorting buffer to wash the cells, centrifuge at 300g for 5min, and discard the supernatant. Prepare magnetic adsorption column and fix it to the magnetic stand. 7 Add 200µL of sorting buffer to the cells and resuspend them and transfer them to the adsorption column. After washing the column thoroughly with sorting buffer to remove unbound cells, remove the adsorption column from the magnetic stand and place it in a 15mL centrifuge tube. Add 2mL of sorting buffer to the adsorption column and use the supplied squeeze rod to remove the adsorbed CD34 + The cells were placed in a centrifuge tube, and the above steps were repeated. After centrifugation and counting, the supernatant was discarded, which was the enriched CD34 + HSPCs.

[0084] 3. CD34 cells derived from virus-infected umbilical cord blood obtained in Example 1 + HSPCs.

[0085] (1) According to 7x10 5 Prepare cells at a density of 1:2000 cells / mL, calculate the volume of virus to be added according to the virus titer, and add 8 mg / mL polybrene.

[0086] (2) Wrap with sealing film and centrifuge at 37°C, 2000 rpm for 90 minutes.

[0087] (3) After centrifugation, remove the sealing film and place the culture medium in the incubator. After 12 hours, change to Mk differentiation medium.

[0088] 4. CD34 after induced infection + HSPCs differentiate into MK.

[0089] (1) Prepare Day 0 / Day 3 differentiation solution: Stemspan + 20ng / mL IL-3 + 20ng / mL SCF + 50ng / mL TPO + 1% P / S; Day 6 / Day 9 differentiation solution: Stemspan + 20ng / mL IL-11 + 50ng / mL TPO + 1% P / S.

[0090] (2) GFP was obtained by flow cytometry + cells, induced to differentiate into Mk. The cell density was 1x10 5 cells / mL / well, and the medium was changed every 3 days. Excess cells were collected each time the medium was changed, and a portion was used to extract RNA and detect the gene knockdown effect by RT-qPCR; the other portion was used to incubate CD41a-APC, CD42b-PE flow cytometry antibodies, and detect CD34 + The proportion of cells differentiating into MK.

[0091] Results: The expression of FASN gene was knocked down, and the effect of knocking down this gene on Mk differentiation was detected.

[0092] In order to achieve specific knockdown of FASN gene, the corresponding shRNA lentiviral vector was constructed in Example 1. The vector was first used to knock down FASN gene expression in MEG-01 cell line. It was found that knockdown of the gene significantly reduced Mk (CD41a) expression compared with the control group Scramble on Day 3 and Day 6. + CD42b + ) (results see Figure 1 ). Further validation was performed in primary human samples to investigate the CD34 +After gene knockdown of HSPCs, they were induced to differentiate into MK. On Day 9 and Day 12 of differentiation, compared with the control group Scramble, the MK (CD41a + CD42b + ) ratio was significantly reduced (see the results in Figure 2 The above results indicate that inhibiting the expression of FASN gene can significantly inhibit the differentiation of HSPCs into MK, suggesting that this gene may play an important role in promoting the abnormal increase of MK and platelets in ET.

[0093] Example 3: Effect of FASN inhibitor C75 on the differentiation of MEG-01 cell line into Mk.

[0094] To induce MEG-01 cell line to differentiate into MK, C75 was used to treat MEG-01 cells throughout the process. The cell density was 1x10 5 cells / mL / well, and the medium was changed every 3 days until Day 6. During each medium change, a portion of the cells was removed for incubation with CD41a-APC and CD42b-PE flow cytometry antibodies to detect the proportion of cells differentiating into MK.

[0095] Example 4: Effects of FASN inhibitor C75 on mouse ET phenotype.

[0096] 1. Screening of mice with ET phenotype.

[0097] JAK2 V617F The tail blood of the gene mutant mice was tested for hemogram parameters using the SYSMEX XN-1000 fully automatic modular blood and body fluid analyzer. Other parameters were normal, and the platelet count was >1700×10 9 / L was used as the standard and the mice were identified as ET mice.

[0098] 2. Intraperitoneal injection of FASN inhibitor C75.

[0099] ET mice were divided into a control group and an experimental group, with 5 mice in each group. Each mouse in the experimental group received an intraperitoneal injection of 30 mg / kg of C75 every two days for 14 days; the control group received the same dose and frequency of DMSO. Blood counts were measured every 7 days.

[0100] Example 3, 4 results:

[0101] To investigate whether the FASN inhibitor C75 can improve the ET phenotype, in Example 3, C75 was first applied to the MEG-01 to Mk differentiation system, and a concentration gradient of 0μM (DMSO), 10μM, and 20μM was set. It was found that C75 could significantly inhibit the differentiation of MEG-01 to Mk (CD41a) in a dose-dependent manner. + CD42b +), suggesting that C75 may improve the ET phenotype by inhibiting the Mk differentiation process (see Figure 3 In order to further explore the possibility of C75 as a potential drug for treating ET, this Example 4 conducted an intraperitoneal injection experiment of C75 on an ET mouse model. The experimental results showed that after 14 days of administration, the peripheral blood platelet parameters of the experimental group mice were significantly reduced compared with the control DMSO group, and the ET-related phenotype was improved (see the results). Figure 4 The above results indicate that C75 can significantly improve the ET phenotype in mice and has potential application value in the treatment of ET.

[0102] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of an inhibitor of fatty acid synthase or its gene activity in the preparation of a medicament for treating essential thrombocythemia, characterized in that: The activity inhibitor is a small molecule compound inhibitor, and the small molecule compound inhibitor is C75.

2. Use of a composition in the preparation of a medicament for treating essential thrombocythemia, characterized in that: The composition comprises an activity inhibitor of fatty acid synthase or its gene, wherein the activity inhibitor is a small molecule compound inhibitor, and the small molecule compound inhibitor is C75.

3. Use of an inhibitor of fatty acid synthase or its gene activity in the preparation of a product that reduces the level of differentiation of hematopoietic stem / progenitor cells into megakaryocytes, characterized in that: The method of reducing the differentiation level of hematopoietic stem / progenitor cells into megakaryocytes is to reduce the differentiation level of hematopoietic stem / progenitor cells into megakaryocytes in vitro, and the activity inhibitor is a small molecule compound inhibitor, and the small molecule compound inhibitor is C75.

Images