Nano-enzyme with catalyst inactivation resistance and preparation method and application thereof

By constructing a high-density DNA coating on the surface of nanoenzymes, the problem of inactivation and low detection sensitivity of nanoenzymes in complex biological environments is solved, and efficient catalytic activity and highly sensitive molecular detection in high salts and serum are achieved.

CN120243012APending Publication Date: 2025-07-04SHANGHAI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510411957.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

Nanozymes are prone to inactivation and have low detection sensitivity in complex biological environments.

Method used

By functionalizing the DNA, a high-density DNA-coated nanoenzyme is constructed, and the negative charge of DNA is used to neutralize cations to prevent the aggregation of nanoenzymes, and the adsorption of biological macromolecules such as proteins through molecular sieve are prevented, allowing small-molecular substrates to contact and maintain catalytic activity.

Benefits of technology

In complex biological environments such as high salt and serum, nanoenzyme aggregation and non-specific adsorption are effectively inhibited, catalytic activity is maintained, and high-sensitive molecular detection is achieved, especially in serum miRNA detection reaches the detection limit of 1 fM.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120243012A_ABST
    Figure CN120243012A_ABST
Patent Text Reader

Abstract

The invention discloses a nano enzyme with catalyst inactivation resistance and a preparation method and application thereof, and the preparation method comprises the following steps: 1) performing functional pretreatment on DNA to obtain functional modified DNA for subsequent DNA coating construction; and 2) connecting a certain size of metal nanoparticles with catalytic activity with the functionalized modified DNA to construct the DNA coating-coated nano enzyme with catalyst inactivation resistance. The DNA coating on the surface of the prepared nano-enzyme can effectively prevent catalyst inactivation caused by particle aggregation in a high-salt environment, meanwhile, the coating has the function of a molecular sieve, can effectively inhibit non-specific adsorption of biomacromolecules such as protein and the like, allows a small-molecule substrate to be in contact with a catalytic interface, and improves the catalytic activity of the nano-enzyme. Therefore, catalytic activity is maintained in complex biological environments such as serum, sensitive detection of molecules is realized, and a solution is provided for precise medical diagnosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of nanozyme engineering, and particularly relates to a nanozyme with the ability to resist catalyst inactivation, a preparation method thereof, and the maintenance of catalytic activity and high-sensitivity molecular diagnosis applications in complex biological environments. Background Art

[0002] Nanozymes represented by metal nanoparticles have shown important application prospects in the fields of biological diagnosis and treatment due to their stronger modifiability, higher material stability, and lower production costs. However, the catalytic activity of nanozymes is also affected by the environment. For example, the complex molecular environment in biological systems may cause non-specific adsorption of nanozymes, shielding their catalytic activity. Currently, surface modification is one of the core means to regulate the catalytic activity of nanozymes. By changing the surface physicochemical properties, the exposure degree of active sites, and the anti-interference ability of nanozymes, the catalytic efficiency, selectivity, and stability of nanozymes can be directly regulated. Currently, materials such as chitosan, polyethylene glycol, mesoporous silica, and metal-organic frameworks are mostly used to modify the surface of nanozymes. These materials lack controllable coating ability, easily block the active sites on the surface of nanozymes; have limited biocompatibility, restricting biomedical applications; only provide physical support and protection, cannot directly specifically recognize and bind target molecules, and require additional functionalization steps.

[0003] Therefore, it is necessary to provide a method that can solve the problems of nanozyme inactivation and low detection sensitivity in the prior art. Summary of the Invention

[0004] The purpose of the present invention is to provide a nanozyme with the ability to resist catalyst inactivation, a preparation method thereof, and applications, so as to solve the problems of nanozyme inactivation and low detection sensitivity in the prior art.

[0005] To solve the above technical problems, the present invention adopts the following technical solutions:

[0006] According to the first aspect of the present invention, there is provided a preparation method of a nanozyme with the ability to resist catalyst inactivation, including the following steps: 1) performing functionalization pretreatment on DNA to obtain functionalized modified DNA for subsequent DNA coating construction; 2) connecting metal nanoparticles with catalytic activity of a certain size to the functionalized modified DNA to construct a DNA-coated nanozyme with the ability to resist catalyst inactivation.

[0007] According to the method provided by the present invention, its working principle is as follows: The high-density DNA coating on the surface of the nanozyme is negatively charged, which can effectively neutralize the cations in the solution and prevent the aggregation of the nanozyme. At the same time, the high-density DNA coating can provide a molecular sieve effect, effectively preventing the adsorption of biological macromolecules such as proteins, while allowing small substrate molecules to contact the catalytic surface, thereby ensuring the catalytic activity of the nanozyme in a complex biological environment and achieving highly sensitive molecular detection.

[0008] Among them, the DNA is a conventional DNA material, including: single-stranded DNA, double-stranded DNA, i-motif. The DNA nanostructure is preferably single-stranded DNA.

[0009] Preferably, the length of the functionalized DNA is 6-24 nt to facilitate high-density modification of the nanozyme.

[0010] It should be understood that the functionalization modification of DNA refers to the modification of DNA molecules by chemical or biological means to endow them with new functions or properties. The types of functionalization modification according to the present invention include DNA with thiol, thio, alkynyl, amino, charged groups, hydrophobic groups, polyadenine or incorporation of unnatural bases, etc.

[0011] The functionalization modification is a conventional method in the art. Preferably, a thiol functional group (SH-DNA) is covalently modified at the end of the single-stranded DNA. The SH-DNA can be reduced and used for nanozyme modification. The reducing agents include: DTT (Dithiothreitol), TCEP (Tris(2-carboxyethyl)phosphine) and DsbA (Disulfideisomerase), preferably TCEP. The pre-functionalization treatment can effectively break the disulfide bond and keep the thiol-modified DNA strand in a monothiol-modified state, so as to better form covalent bonds or coordination bonds with the surface of metal nanoparticles in subsequent experiments.

[0012] The nanozyme is a metal nanoparticle with enzyme-like catalytic activity, including: metal elemental nanoparticles, metal oxide nanoparticles and alloy nanoparticles, such as: gold, platinum, palladium, ruthenium, rhodium, magnetite, Au@Ag, Au@Pt, Au@Pd, Pt@Pd, Pt@PdRuRh and other nanoparticles. Preferably, the nanozyme is platinum nanoparticles (PtNPs), with a size of about 30 nanometers and peroxidase catalytic activity, which are commercially available. It should be understood that this nanozyme is only used as an example of a preferred embodiment and is not intended to limit. In fact, metal nanoparticles with enzyme-like catalytic activity are all applicable to the present invention.

[0013] Preferably, in step 2), the molar concentration ratio of the metal nanoparticles to the functionalized DNA is more than 1000:1.

[0014] Among them, the connection methods described in step 2) include: salt aging method, microwave method, extraction method, etc., preferably the rapid freeze-thaw method, so that SH-DNA forms a Pt-S bond with platinum nanoparticles.

[0015] According to a preferred embodiment of the present invention, the rapid freeze-thaw method includes: accurately weighing 900 μL of PtNPs with a concentration of 50 μg / mL, 2 μL of PolyT-SH with a concentration of 100 μM, and 100 μL of 5×TBE buffer solution, mixing them thoroughly and vortexing evenly, freezing at -80 °C for 4 hours, immediately thawing at room temperature, then centrifuging at 4 °C and 7000 rpm for 15 minutes. After centrifugation, discard the supernatant, and wash the precipitate 3 times with 0.5×TBE buffer solution to remove unbound DNA.

[0016] It should be understood that the reaction in step 2) depends on the functionalization selection in step 1), and it can also be other chemical bonds and reactions such as hydrophobic interaction or click. The above preferred embodiment selects SH-functionalized DNA to utilize the formation of Pt-S bonds between SH-DNA and platinum nanoparticles.

[0017] According to the second aspect of the present invention, there is also provided a nanozyme with the ability to resist catalyst deactivation prepared by the above preparation method. The nanozyme has metal nanoparticles with enzyme-like catalytic activity as the core and is coated with a DNA coating on the outer surface.

[0018] According to a preferred embodiment of the present invention, the nanozyme with the ability to resist catalyst deactivation has PtNPs as the core and SH-DNA as the surface DNA coating.

[0019] It should be understood that the above nanozyme is only used as a preferred embodiment to illustrate the present invention and is not used for limitation. In fact, according to different selections of nanozyme materials and surface DNA materials, other nanozymes with the ability to resist catalyst deactivation can also be provided.

[0020] According to the third aspect of the present invention, there is also provided an application of a nanozyme with the ability to resist catalyst deactivation in highly sensitive molecular detection in a complex biological environment.

[0021] The application includes the application in highly sensitive detection of serum miRNA. It should be understood that the nanozyme provided by the present invention is not limited to the detection of the above serum miRNA. In fact, it can be used for molecular detection in a variety of complex biological environments, such as a high-salt biological environment.

[0022] Therefore, it is expected that the method of the present invention can be further extended to the preparation of nanozymes, using DNA as a nanozyme surface modification material to reduce the aggregation and non-specific adsorption of nanozymes in a complex biological environment, maintain their catalytic activity, and thus achieve highly sensitive molecular detection in a complex biological environment.

[0023] It should be known that traditional spherical nucleic acid construction technologies mainly use gold and silver metal nanoparticles as cores, aiming to enhance the anti-enzyme degradation ability and tissue penetration ability of nucleic acids. They cannot be applied to other metal nanoparticle materials, so they have certain limitations. In contrast, the present invention focuses on the metal nanoparticle core. By optimizing and improving the nucleic acid density, length, etc., it is not restricted by the nanoparticle material, and develops a general nanozyme engineering preparation technology from nucleic acid functionalization technology, achieving the maintenance of high catalytic activity of nanozymes in complex biological environments, and at the same time having molecular recognition ability.

[0024] The positive progress effect of the present invention compared with the prior art lies in:

[0025] The nanozymes with anti-catalyst deactivation ability prepared according to the method of the present invention can effectively inhibit their aggregation and non-specific adsorption in complex biological environments such as high salt and serum, and effectively maintain their catalytic activity in complex biological environments, which is beneficial to highly sensitive molecular detection in biological samples. In practical applications, optimally, the detection limit of this nanozyme for miRNA in serum reaches 1 fM.

[0026] In summary, the present invention provides a method that can significantly resist the loss of catalytic activity of nanozymes in complex biological environments, and has good clinical application prospects. Brief Description of the Drawings

[0027] Figure 1 is the TEM image of platinum nanoparticles (PtNPs) and DNA-coated platinum nanozymes (DPNEs);

[0028] Figure 2 is the ultraviolet-visible absorption spectra of PtNPs and DPNEs;

[0029] Figure 3 is the statistical chart of the hydrodynamic radius and surface potential of PtNPs and DPNEs;

[0030] Figure 4 is the TEM image and hydrodynamic radius distribution diagram of PtNPs and DPNEs in high-salt environment;

[0031] Figure 5 is the catalytic kinetics and Michaelis-Menten equation fitting diagram of PtNPs and DPNEs in high-salt environment;

[0032] Figure 6 is the hydrodynamic radius distribution diagram of PtNPs and DPNEs in BSA and serum;

[0033] Figure 7 is the Michaelis-Menten equation fitting diagram of PtNPs and DPNEs in BSA and serum;

[0034] Figure 8 It is the specificity and sensitivity test of DPNEs for the detection of miR-545 in serum. Specific implementation mode

[0035] The following further illustrates the present invention in conjunction with specific embodiments. It should be understood that the following embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. Unless otherwise specified, the technical means used in the embodiments are conventional operations in the art or experimental methods recommended by instrument equipment manufacturers. The reagents and materials used in the embodiments can be obtained from commercial channels unless otherwise specified.

[0036] The DNA sequences (5'-3') (SEQ ID No. 1-8) used in the present invention are shown as follows:

[0037] SH-DNA: TTTTTTTTTTTTTT-SH

[0038] Capture probe: ACATTTACTGATTTTTTTTTT-Biotin

[0039] Detection probe: SH-TTTTTTTTTTTCATCTAATAA

[0040] miR-545: UCAGUAAAUGUUUAUUAGAUGA

[0041] miR-1233: AGUGGGAGGCCAGGGCACGGCA

[0042] miR-190a: UGAUAUGUUUGAUAUAUUAGGU

[0043] mir-193b: AACUGGCCCUCAAAGUCCCGCU

[0044] miR-183: GUGAAUUACCGAAGGGCCAUAA

[0045] In the embodiments of the present invention, platinum nanoparticles (PtNPs, with a particle size of about 30 nanometers) are mainly selected as the core, and the surface DNA coating is represented by SH-DNA to construct a nanozyme that can resist catalyst inactivation and is used for the highly sensitive detection of miRNA in serum. The following embodiments specifically illustrate the implementation effects of the present invention.

[0046] Example 1 Preparation of nanozyme that can resist catalyst inactivation

[0047] In this embodiment, PtNPs are used as the core, and the surface DNA coating is represented by SH-DNA to illustrate the preparation process of the nanozyme that can resist catalyst inactivation.

[0048] Pretreatment of SH-DNA. SH-DNA was purchased from Sangon Biotech (Shanghai) Co., Ltd., with the sequence: TTTTTTTTTTTTTT, and the 3'-end was modified with SH. 100 μL of SH-DNA (100 μM) was mixed with 10 μL of TCEP (10 mM), and shaken at room temperature for 30 minutes to reduce the disulfide bond. Subsequently, it was washed and recovered using a G-25 desalting column to remove the excess TCEP reagent, obtaining SH-DNA strands that could be used for subsequent PtNPs modification.

[0049] DNA modification of PtNPs. 900 μL of PtNPs (50 μg / mL), 2 μL of the treated SH-DNA (100 μM), and 100 μL of 0.5×TBE buffer (Tris 44.5 mM, boric acid 44.5 mM, EDTA 1 mM, pH = 8.0) were mixed and shaken evenly. It was stored at -80 °C for 4 hours, melted at room temperature, immediately centrifuged at 7000 rpm for 15 minutes at 4 °C, and washed three times with 0.5×TBE buffer, and finally resuspended in this buffer to obtain DNA-coated platinum nanozymes (DPNEs).

[0050] Results: As Figure 1 shown, transmission electron microscopy (TEM) imaging showed a low-contrast shell around the platinum nanoparticles of DPNEs, and the ultraviolet-visible absorption spectrum of DNPEs showed a characteristic absorption peak of DNA at 260 nm ( Figure 2 ), the hydrodynamic radii of PtNPs and DPNEs were 41.64 ± 0.16 and 43.03 ± 0.43 nm, respectively; their Zeta potentials were -5.47 ± 0.55 and -23.97 ± 1.24 mV ( Figure 3 ), these results indicate that compared with PtNPs, the platinum nanoparticles of DPNEs are covered with a DNA coating, that is, DNA-coated platinum nanozymes that can resist catalyst inactivation are successfully synthesized.

[0051] Example 2 Nanozymes that can resist catalyst inactivation can resist the activity decline caused by high-salt environment

[0052] To verify the resistance ability of DPNEs to high-salt environment, three groups were set up. The first group: 300 μL of DPNEs (50 μg / mL) was mixed with 100 μL of NaCl (500 mM) and 100 μL of 0.5×TBE buffer (100 mM Na + ); The second group: 300 μL of DPNEs (50 μg / mL) was mixed with 100 μL of MgCl2 (25 mM) and 100 μL of 0.5×TBE buffer (5 mM Mg 2+), Group 3: Mix 300 μL DPNEs (50 μg / mL) with 200 μL deionized water (0 mM Mg 2+ / Na + ). The same three groups were also set for the corresponding PtNPs. After oscillating the above groups at room temperature for 6 hours, the aggregation of nanozymes was analyzed by TEM and dynamic light scattering (DLS). Then, 10 μL of nanozymes were taken out and added with 10 μL of TMB (10 mM), 10 μL of H2O2 (1 M) and 170 μL of sodium acetate solution for the determination of nanozyme catalytic kinetics and the calculation of enzyme kinetic parameters.

[0053] Results: The TEM images showed that PtNPs aggregated in high-salt environments, while DNPEs remained monodispersed ( Figure 4 left); the DLS results also indicated that the particle size of PtNPs increased significantly in high-salt environments compared to that in deionized water, while the particle size of DPNEs remained basically unchanged in deionized water and high-salt environments ( Figure 4 right). The catalytic kinetic curves showed that the catalytic ability of PtNPs decreased in high-salt environments, while DPNEs were not affected; according to the Michaelis-Menten equation V = (Vmax * [S]) / (Km + [S]), the analysis of the signals generated by the nanozymes catalyzing different concentrations of TMB showed that the Michaelis constant (Km) of the three groups of PtNPs was 0.248 ± 0.026 mM (deionized water), 0.565 ± 0.106 mM (100 mM Na + ), and 0.975 ± 0.191 mM (5 mM Mg 2+ ), and the Km of the three groups of DPNEs was 0.108 ± 0.017, 0.090 ± 0.021, 0.107 ± 0.005 mM ( Figure 5 ). In summary, it was shown that DPNEs could resist the decrease in catalytic activity caused by high-salt environments.

[0054] Example 3 Nanozymes resistant to catalyst deactivation can resist the decrease in activity caused by non-specific adsorption

[0055] To verify the resistance of DPNEs to non-specific adsorption of biomacromolecules, three groups were set up. The first group: Mix 300 μL of DPNEs (50 μg / mL) with 80 μL of bovine serum albumin (BSA, 5 mg / mL) and 120 μL of PBS buffer (NaCl 137 mM, KCl 2.7 mM, Na2HPO4 10 mM, KH2PO4 2 mM, pH = 7.4) (BSA); the second group: Mix 300 μL of DPNEs (50 μg / mL) with 80 μL of fetal bovine serum and 120 μL of PBS buffer (serum), and the third group: Mix 300 μL of DPNEs (50 μg / mL) with 200 μL of deionized water (deionized water). Corresponding three groups were also set up for the same PtNPs. After shaking the above groups at room temperature for 6 hours, the molecular adsorption of nanozymes was analyzed by DLS. Then, 10 μL of nanozymes were taken out and added with 10 μL of TMB (10 mM), 10 μL of H2O2 (1 M) and 170 μL of sodium acetate solution for calculating the enzyme kinetic parameters.

[0056] Results: The DLS measurement results showed that the particle sizes of PtNPs gradually increased in BSA and serum compared with those in deionized water, while the particle sizes of DPNEs remained basically unchanged in deionized water, BSA and serum ( Figure 6 ). According to the Michaelis-Menten equation V = (Vmax * [S]) / (Km + [S]), the analysis of the signals generated by the nanozymes catalyzing different concentrations of TMB showed that the Michaelis constants (Km) of the three groups of PtNPs were 0.248 ± 0.026 mM (deionized water), 0.358 ± 0.053 mM (BSA) and 0.987 ± 0.192 mM (serum), and the Km of the three groups of DNPEs were 0.108 ± 0.017, 0.093 ± 0.009, 0.086 ± 0.008 mM ( Figure 7 ). In summary, it was shown that DPNEs could resist the decrease in catalytic activity caused by non-specific adsorption.

[0057] Example 4 Nanozyme Resisting Catalyst Inactivation for Highly Sensitive Detection of miRNA in Serum

[0058] Capture probe modification of magnetic nanoparticles. A magnetic nanoparticle (MNPs, Fe₃O₄ particles modified with streptavidin on the surface, with a diameter of 1 μm, Nanjing Nanoorient Biotechnology Co., Ltd.) was provided. 10 μL of the streptavidin-modified MNPs (10 mg / mL) was taken, washed 5 times with a binding buffer (Tris 5 mM, EDTA 0.5 mM, NaCl 1 M, pH = 7.4), and mixed with 50 μL of a capture probe (ACATTTACTGATTTTTTTTTT-Biotin) (1 μM) dissolved in the binding buffer, and shaken at 37 °C for 60 minutes. It was washed 5 times with a reaction buffer (Tris 50 mM, NaCl 140 mM, MgCl₂ 1 mM, pH = 7.4), and finally resuspended and fixed to a volume of 20 μL.

[0059] Construction of DPNEs for miRNA detection. The detection probe (SH-TTTTTTTTTTTCATCTAATAA) was modified on PtNPs according to the method of Example 1 to obtain DPNEs for serum miRNA detection. This probe can specifically recognize mir-545.

[0060] Serum miRNA sample treatment. 5 μL of miRNA (100 μM) was added to 995 μL of serum solution and mixed evenly. The samples for sensitivity verification were serially diluted 10-fold to obtain serum miRNA samples with concentrations ranging from 1 fM to 1 nM.

[0061] Specificity verification of DPNEs detection. DPNEs and MNPs that specifically recognize mir-545 were constructed, and at the same time, 5 kinds of serum miRNA samples (mir-545, mir-183, mir-190a, mir-193b, and mir-1233) were prepared. 10 μL of MNPs (10 mg / mL), 20 μL of DENPs (10 μg / mL), 10 μL of serum RNA (10 nM), and 60 μL of reaction buffer were mixed and shaken, and incubated at 27 °C and 1500 rpm for 120 minutes. The reaction buffer was washed 5 - 7 times, 10 μL of TMB (10 mM) and 80 μL of acetate buffer (pH = 4.5) were added and mixed evenly, and finally 10 μL of 1 M H₂O₂ was added, and the absorbance value was measured.

[0062] Sensitivity verification of DPNEs detection. Different concentrations of miRNA-545 were mixed with DPNEs and MNPs. The miRNA would bind to the probes on the surfaces of DPNEs and MNPs to form a complex, and was recovered by magnetic separation. The concentration of miRNA would determine the number of DPNEs recovered, and finally the absorbance value signal generated by its catalysis was measured and read.

[0063] Results: The signals generated by miR-183, miR-190a, miR-193b, and miR-1233 were similar to those of the blank, while the signal generated by miR-545 was significantly increased, approximately 8 times stronger than the signals of other miRNAs. The linear detection range of DNPEs was 10 -4 -1 nM, and the detection limit was as low as 10 -6 nM. This indicates that DNPEs can specifically and highly sensitively detect miRNAs in serum.

[0064] The above are only the preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various changes can be made to the above embodiments of the present invention. That is, all simple, equivalent changes and modifications made according to the claims and the content of the specification of the present invention application fall within the scope of the claims of the present invention patent. The content not described in detail in the present invention is all conventional technical content.

Claims

1. A preparation method of a nanozyme with the ability to resist catalyst deactivation, characterized in that, It includes the following steps: 1) Pretreat the DNA for functionalization to obtain functionalized DNA for subsequent DNA coating construction; 2) Connect metal nanoparticles with catalytic activity of a certain size to the functionalized DNA to construct a nanozyme with the ability to resist catalyst deactivation and coated with a DNA coating.

2. The preparation method according to claim 1, characterized in that, In step 1), the types of functionalization modification include thiol, thio, alkynyl, amino, charged group, hydrophobic group, polyadenine or DNA incorporated with unnatural bases.

3. The preparation method according to claim 1, wherein In step 1), the DNA is single-stranded DNA, double-stranded DNA, i-motif, or DNA nanostructure.

4. The preparation method according to claim 1, characterized in that, In step 2), the metal nanoparticles include: elemental metal nanoparticles, metal oxide nanoparticles, alloy nanoparticles.

5. The preparation method according to claim 1, wherein In step 2), the molar concentration ratio of the metal nanoparticles to the functionalized DNA is above 1000:

1.

6. The preparation method according to claim 1, wherein, In step 2), the length of the functionalized DNA is 6 - 24 nt.

7. The preparation method according to claim 1, characterized in that, In step 2), the metal nanoparticles are connected to the functionalized DNA by the rapid freeze-thaw method.

8. A nanozyme with the ability to resist catalyst deactivation prepared by the preparation method according to any one of claims 1 - 7, wherein the nanozyme has metal nanoparticles with mimetic enzyme catalytic activity as the core and is coated on the outer surface with a DNA coating.

9. An application of the nanozyme with the ability to resist catalyst deactivation according to claim 8 in molecular detection in a complex biological environment.

10. The application according to claim 9, wherein, The complex biological environment includes high-salt and serum environments.